ID: 952295699

View in Genome Browser
Species Human (GRCh38)
Location 3:32060026-32060048
Sequence GATCTGGTTGGTGGTTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 10, 2: 40, 3: 147, 4: 474}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952295699 Original CRISPR GATCTGGTTGGTGGTTACAC AGG Intronic