ID: 952298675

View in Genome Browser
Species Human (GRCh38)
Location 3:32084989-32085011
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952298674_952298675 16 Left 952298674 3:32084950-32084972 CCAAGACTGTGTAATTTATAAAG 0: 77
1: 3806
2: 4606
3: 3190
4: 3275
Right 952298675 3:32084989-32085011 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
952298673_952298675 17 Left 952298673 3:32084949-32084971 CCCAAGACTGTGTAATTTATAAA 0: 61
1: 3017
2: 11575
3: 15005
4: 13379
Right 952298675 3:32084989-32085011 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952298675 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr