ID: 952298755

View in Genome Browser
Species Human (GRCh38)
Location 3:32085473-32085495
Sequence TGACTAACACAAGCTGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 19, 1: 19, 2: 43, 3: 62, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952298755_952298761 14 Left 952298755 3:32085473-32085495 CCATAGGCAGCTTGTGTTAGTCA 0: 19
1: 19
2: 43
3: 62
4: 133
Right 952298761 3:32085510-32085532 CTGCCTTATGGCAAGGACAGAGG No data
952298755_952298763 30 Left 952298755 3:32085473-32085495 CCATAGGCAGCTTGTGTTAGTCA 0: 19
1: 19
2: 43
3: 62
4: 133
Right 952298763 3:32085526-32085548 ACAGAGGCTATCAGTATCCCAGG No data
952298755_952298756 2 Left 952298755 3:32085473-32085495 CCATAGGCAGCTTGTGTTAGTCA 0: 19
1: 19
2: 43
3: 62
4: 133
Right 952298756 3:32085498-32085520 TCAATTAGACCCCTGCCTTATGG No data
952298755_952298757 7 Left 952298755 3:32085473-32085495 CCATAGGCAGCTTGTGTTAGTCA 0: 19
1: 19
2: 43
3: 62
4: 133
Right 952298757 3:32085503-32085525 TAGACCCCTGCCTTATGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952298755 Original CRISPR TGACTAACACAAGCTGCCTA TGG (reversed) Intergenic
904544674 1:31259876-31259898 TGACTAAGGCAAGCTCCCTGTGG - Exonic
907537804 1:55180811-55180833 TCACTAGACCAAGCTGCCTAAGG + Intronic
907962215 1:59294349-59294371 TGGCTAACACAAGCCACCCACGG + Intergenic
909922809 1:81402517-81402539 TTATTAAAACAAGCTGGCTATGG - Intronic
910369923 1:86504397-86504419 TTAAAAACAGAAGCTGCCTAAGG + Intergenic
911430056 1:97773962-97773984 TGATTAACACAAGCTGCCTGTGG + Intronic
917238349 1:172919059-172919081 TTACCACCACAAACTGCCTAAGG + Intergenic
918809309 1:189094607-189094629 TGACTAACACAAGCTGCCTATGG + Intergenic
920897759 1:210074885-210074907 TGACTAACACAAGCCGCCTATGG - Intronic
921974881 1:221191489-221191511 TGACTAACACAGGTAGCATAAGG + Intergenic
923109900 1:230882358-230882380 TGACTAACACAAGCCGCCTACGG - Intergenic
1063357721 10:5416883-5416905 TGATGAATACAAGCCGCCTACGG - Intronic
1063718336 10:8552940-8552962 AGACTAAGACAAGTTGTCTAAGG - Intergenic
1063941481 10:11134499-11134521 GGACAAGCACAAGATGCCTAGGG - Intronic
1067405463 10:46019251-46019273 TGCCTAACACAGGCAGCTTATGG - Intronic
1069099162 10:64296602-64296624 TGACTAAGAAATGCTGTCTATGG + Intergenic
1069209100 10:65733774-65733796 TGACTAACACAAGCCAACTATGG + Intergenic
1071074353 10:81733032-81733054 TGACTAACACAAGATGCCTAAGG + Intergenic
1071867029 10:89746201-89746223 TGATTAACACAAGCCGCCTGTGG - Intronic
1074177918 10:111029803-111029825 TGATTAACACAAGCCTCCTGTGG - Intergenic
1075367450 10:121905057-121905079 TGTCTGACACAAGCTGCCTGAGG + Intronic
1075613000 10:123868331-123868353 TGCCTCAGAGAAGCTGCCTAGGG - Intronic
1076415816 10:130287686-130287708 TGAAAAACACAAGCTTCCTGTGG - Intergenic
1077471104 11:2760964-2760986 TGACTAACGCAAGCTGTCTATGG - Intronic
1077951971 11:6968938-6968960 TGAATAAAACAAGCTGCTTCTGG + Intronic
1078113898 11:8426007-8426029 TGACTAACACAAGCCACCTATGG - Intronic
1081330019 11:41790913-41790935 TGACTAACACAAGCTGCCTATGG + Intergenic
1083388775 11:62333036-62333058 TGATTAACACAAGCTGCCTGTGG - Intergenic
1084290621 11:68163738-68163760 TGACTAGCACAGACTGCCAATGG + Intronic
1084927017 11:72522109-72522131 TGGTTAACACAATCTGCCTATGG - Intergenic
1087286033 11:96265992-96266014 TAGTTAACACAAGCTGCCTTTGG + Intronic
1087353395 11:97061750-97061772 AAACTAACACAATCTGCCTGGGG - Intergenic
1087461926 11:98456591-98456613 TGACTAACACAAGCCACCTGTGG - Intergenic
1088484149 11:110325060-110325082 TGAGTAACACAAGCCGCCTGCGG - Intergenic
1088507277 11:110539125-110539147 TGAGTAACACAAGCTACCTACGG - Intergenic
1090124266 11:124069663-124069685 TGATTAACACAAGCTGCCAACGG - Intergenic
1090458118 11:126867025-126867047 TGGTTAACACAAGCTGCCAACGG + Intronic
1092459854 12:8676788-8676810 TGTCTGACTCAAGGTGCCTATGG - Intergenic
1092598646 12:10034848-10034870 TGACTAACACAAGCCACCTATGG - Intronic
1095234266 12:39777949-39777971 TGACTAACACGAGCTACCTATGG + Intronic
1095641868 12:44495015-44495037 TGATAAACACAAGCTGCCTATGG - Intergenic
1096086271 12:48867140-48867162 TGCCTAGCAGAAGCTGCTTAGGG + Intergenic
1096907355 12:54947502-54947524 TGACAAACACCAGTTTCCTAGGG - Intergenic
1097555100 12:61127200-61127222 GCACTTACTCAAGCTGCCTAGGG - Intergenic
1098276127 12:68813122-68813144 TAACTAACCCAAGCTGACAAGGG - Intronic
1101738577 12:107482241-107482263 GCTCTGACACAAGCTGCCTAAGG + Intronic
1102086898 12:110149449-110149471 TGACTAACACAAGCCGCCTATGG - Intronic
1103224406 12:119274579-119274601 TGATTAACACAAGCTGCCTGTGG + Intergenic
1105594974 13:21828499-21828521 TGGTAAACACAAGCTGCCTATGG + Intergenic
1105638584 13:22239929-22239951 TGGTTAACACAAGCTGCCTACGG - Intergenic
1106016021 13:25869883-25869905 TGGTTTACACAAGCTGCCTACGG - Intronic
1106319478 13:28624494-28624516 TGACTAACACAAGCCGCCTACGG + Intergenic
1107007614 13:35632416-35632438 TGTCTCAAACAAGTTGCCTAGGG - Intronic
1108644899 13:52417722-52417744 AGACTAACACAAAATGTCTAAGG + Intronic
1109172854 13:59117791-59117813 TGACTAACACAAGCTGCCTAGGG - Intergenic
1109432232 13:62251124-62251146 TGATTAACACAAGCCGCCTGCGG + Intergenic
1110941758 13:81359642-81359664 TGACTACTAGAAGCTGCCAAGGG - Intergenic
1111156763 13:84337962-84337984 TGACGAACACAAGCCGCCTATGG - Intergenic
1111206749 13:85020620-85020642 TGATTAACACAAGCTGCCTGTGG + Intergenic
1111292209 13:86185192-86185214 TGGTTGACACAAGCTGCCTATGG + Intergenic
1111343905 13:86924353-86924375 TGACTAACACAAGCTGCCTATGG - Intergenic
1111430633 13:88144951-88144973 TGCTTAACACAAGCCACCTACGG + Intergenic
1111584555 13:90268122-90268144 TGATTAACACAAGCCACCTTCGG - Intergenic
1112125375 13:96460907-96460929 TGCCAAAAACAAGCTGCCTGGGG + Intronic
1112718792 13:102218075-102218097 TTACTAGCACAATCTGCCTTGGG + Intronic
1112941429 13:104866713-104866735 TGGTAAACACAAGCTGCCTACGG + Intergenic
1117046210 14:51816191-51816213 TGATTAATACAAGCCGCCTGCGG - Intergenic
1121475624 14:94199463-94199485 TGACTAACACAAGCCGCCTACGG - Intronic
1124698354 15:31887496-31887518 TGATTAACACAAGCTGCCTGCGG - Intergenic
1124711579 15:32016972-32016994 TGACTAATACACCCTGCCAATGG + Intergenic
1126475627 15:49062783-49062805 TGACTAACACAAGCTGCCTATGG - Intergenic
1126981999 15:54255168-54255190 TGACTAACACAGGCCACCTACGG - Intronic
1127851147 15:62913011-62913033 TGAGTAACACTAGCTGCCTGGGG - Intergenic
1128046040 15:64618443-64618465 GAGCTAACACAAGCCGCCTAAGG - Intronic
1129792851 15:78353223-78353245 TGACTCAAACCAGCTGCATAAGG - Intergenic
1130617671 15:85427780-85427802 TGACTAACATAAGCTTATTATGG - Intronic
1130682679 15:86010323-86010345 TGACTAACATAAGCCACTTAGGG - Intergenic
1130927324 15:88395516-88395538 TGATTAACACGAGCTGCCTGCGG - Intergenic
1131997154 15:98143863-98143885 TGACTAACACAATCTGCTTTGGG - Intergenic
1133201088 16:4204980-4205002 GGACTAAGAGCAGCTGCCTAAGG - Intronic
1133354081 16:5123258-5123280 TTACTAACACAAGCTACCTACGG - Intergenic
1133765067 16:8832238-8832260 TCACAAACACAACCTGCCTCAGG - Intronic
1134346625 16:13397760-13397782 TGGTTAACACAATCTGCCTGTGG - Intergenic
1137633575 16:49966070-49966092 TGACTGACACCAGCTGCCATTGG - Intergenic
1139017877 16:62711860-62711882 TGATGAACCCAAGCCGCCTATGG + Intergenic
1144302885 17:13939266-13939288 TGATTAACACAAGCCACCTGAGG + Intergenic
1146523902 17:33549589-33549611 TGGCTGACAGATGCTGCCTATGG + Intronic
1149082740 17:52677985-52678007 TGACTACCAGTAGCTGCCTGTGG - Intergenic
1150936428 17:69640723-69640745 TGACTAACACAAACTCCTTCAGG - Intergenic
1153713090 18:7819691-7819713 TGACTAACACAAGCTGCCTATGG + Intronic
1155703521 18:28779156-28779178 TGATTAACACAAGCCGCCTACGG + Intergenic
1157002343 18:43542142-43542164 TGATTAACACAAGCCGCCTGAGG - Intergenic
1159215273 18:65384131-65384153 TGACTAACACAAGCCACCTATGG + Intergenic
1159416271 18:68152842-68152864 TGATTAACACAAGCTGCCTGCGG + Intergenic
1165295803 19:34925207-34925229 TGACTAACATAAGCCGCCTGCGG - Intergenic
1166456805 19:42948730-42948752 TAACTCACAGAAGCTCCCTATGG - Intronic
1166472894 19:43095677-43095699 TAACTCACAGAAGCTCCCTATGG - Intronic
1166493676 19:43282663-43282685 TAACTCACAGAAGCTCCCTATGG - Intergenic
1168178920 19:54646331-54646353 TGATACACACAAGTTGCCTATGG - Intronic
926139289 2:10358893-10358915 TGACTAACACAAGCTGCCTACGG + Intronic
926580044 2:14625103-14625125 TGACTTACAAAATCTGCCTTGGG - Intergenic
929628544 2:43434854-43434876 TGACTAACACAAGCTGCCTATGG + Intronic
931034724 2:58227271-58227293 TGACTAACACAAGCTGCCTATGG - Intronic
931470139 2:62531487-62531509 GAGCTAACACAAGCAGCCTATGG - Intergenic
931967398 2:67548865-67548887 TGACAATCACAGGCAGCCTAGGG - Intergenic
932576565 2:72965485-72965507 TGACTAATACAAGCCACCTATGG + Intronic
933315245 2:80706983-80707005 TGACTAACACAAGCCACACATGG + Intergenic
933596117 2:84284956-84284978 AGACTAACACAGGGTGTCTATGG + Intergenic
933733158 2:85473386-85473408 TAACTTTCACAAGCTACCTATGG + Intergenic
934957153 2:98632163-98632185 TAACAAACACAAGCCACCTATGG + Intronic
935062574 2:99621249-99621271 TGACTATAACAAGCTGCCTGGGG + Intronic
935383187 2:102474507-102474529 TGAGTAATACAAGTTGCCTATGG - Intronic
939210308 2:139166432-139166454 TATCTAACACAAGCTGCCAGAGG - Intergenic
940445963 2:153777825-153777847 TGACTAACCCAAGCCACCTACGG - Intergenic
940963434 2:159811382-159811404 TGAGTAACAGAAGCAGCCTGAGG + Intronic
941106814 2:161363911-161363933 TGTCTAACACAAGCCACCTATGG - Intronic
943221513 2:185113351-185113373 TGAGGAACAGAAGCTGCTTATGG + Intergenic
944289974 2:197993989-197994011 TGACTCACTGAAGCAGCCTAGGG - Intronic
948302636 2:236919589-236919611 TGACTAACACGAGATCCCTATGG - Intergenic
948624044 2:239256718-239256740 TGAATAAATCAAGCTACCTATGG + Intronic
948726317 2:239936211-239936233 TGACTCACACAAGCAGCTTCCGG + Intronic
1169338319 20:4775932-4775954 TGCTTAACACAAGCGGCTTATGG - Intergenic
1169663397 20:8006025-8006047 TGACGAACACAAGCCACCTATGG + Intronic
1169810425 20:9604203-9604225 TGTGGAACACAAGCTGCCTAGGG + Intronic
1171149612 20:22815585-22815607 TGACCAACACCAGCAGCCTTAGG - Intergenic
1171205694 20:23279034-23279056 GGACTTACACAGGCTGCCTCAGG - Intergenic
1171517535 20:25750059-25750081 TGACTAACACAAGTCGCCTACGG - Intergenic
1173493883 20:43505082-43505104 TGATTAAAACGAGCTGTCTACGG + Intergenic
1174432200 20:50478556-50478578 GAGCTAACACAAGCTGTCTATGG - Intergenic
1174534318 20:51238975-51238997 TGACTGACACAGGCCACCTAAGG - Intergenic
1176071786 20:63230717-63230739 TGGTTAACACAAGCCACCTACGG - Intergenic
1176345555 21:5742408-5742430 TGACTAATACAATCTGCAAATGG + Intergenic
1176352369 21:5862992-5863014 TGACTAATACAATCTGCAAATGG + Intergenic
1176499272 21:7582047-7582069 TGACTAATACAATCTGCAAATGG - Intergenic
1176539876 21:8140478-8140500 TGACTAATACAATCTGCAAATGG + Intergenic
1176558827 21:8323523-8323545 TGACTAATACAATCTGCAAATGG + Intergenic
1177339549 21:19782323-19782345 TGATTAACACAAGCCACCTACGG + Intergenic
1177883744 21:26723901-26723923 TCACAAAGACAAGGTGCCTAGGG + Intergenic
1178195788 21:30344110-30344132 GAGCTAACACAAGCTGCCTATGG - Intergenic
1178384553 21:32138610-32138632 TGATTAACACAAGCTGCCTATGG + Intergenic
1178438699 21:32581449-32581471 TGATAAACACAAGCTGCCTACGG + Intronic
1178585210 21:33865791-33865813 TGACTCCCACAGGCTGTCTAAGG - Intronic
1179246585 21:39638656-39638678 GAGCTAACACAAGCTGCCTACGG + Intronic
1180969842 22:19809526-19809548 TGACTAATACAAGCCACCTATGG + Intronic
1185325172 22:50221959-50221981 TGACCAACACCAGGTGCCGAGGG + Intronic
1203244827 22_KI270733v1_random:56833-56855 TGACTAATACAATCTGCAAATGG + Intergenic
949368849 3:3312779-3312801 TAACTTACACAAGTTGTCTAAGG - Intergenic
949444160 3:4115429-4115451 TGATTAACACAAGCAGCCTGAGG + Intronic
949806236 3:7958919-7958941 TGACTAGCGCAATCTGCCTATGG - Intergenic
949828285 3:8185885-8185907 TGACTAACACAAGCTGCCTATGG - Intergenic
950528883 3:13540865-13540887 TGACTCACTCATGCTGCCTGGGG + Intergenic
951549415 3:23861958-23861980 TGGTTAACAGAAGCCGCCTATGG + Intronic
951564709 3:24001932-24001954 TGACTAACACAGGGAGGCTAAGG - Intergenic
952298755 3:32085473-32085495 TGACTAACACAAGCTGCCTATGG - Intergenic
952564187 3:34635242-34635264 TGACTAACACAAGCTGCCTACGG - Intergenic
952827494 3:37536520-37536542 AGACTAACATCAGCTGCTTATGG - Intronic
953255695 3:41288451-41288473 TCTCTAAGACAACCTGCCTAAGG - Intronic
955480598 3:59385594-59385616 TGACTAACACAAGCCACCTATGG + Intergenic
955615282 3:60800805-60800827 GGACTAACAGAAGCTGTCAAGGG - Intronic
956194140 3:66635256-66635278 TAACTAACACAAACTGCCTATGG + Intergenic
957057981 3:75458945-75458967 CGACTAACACAAGCTACCTACGG - Intergenic
957479210 3:80769956-80769978 TGATTAACACAAGCCACCTGCGG - Intergenic
959583464 3:108004627-108004649 TGATAAACATAAGCGGCCTACGG + Intergenic
961295467 3:125880770-125880792 CGACTAACACAAGCTACCTACGG + Intergenic
962095073 3:132284996-132285018 TGACTAGCACAAGCCGCCTACGG - Intronic
964308001 3:155361521-155361543 TGATCAACACAAGCCACCTATGG - Intergenic
967408615 3:189144744-189144766 TGTCTAACACAACCTGTTTATGG - Intronic
967917030 3:194586381-194586403 TGAGTAACACGAACTACCTAAGG - Intergenic
970273136 4:14368320-14368342 TGATTAACACAAGTTGTCTGTGG - Intergenic
970697537 4:18696043-18696065 TGATTAACACAAGCTGCCTACGG - Intergenic
972394838 4:38649865-38649887 TGACTGACACAAGCCACCTACGG + Intergenic
972917887 4:43903538-43903560 TGACTAACACAAGCCACCTATGG + Intergenic
972918465 4:43907325-43907347 TGTGTAACACAAGCTGCCTATGG + Intergenic
973057422 4:45678643-45678665 TAACTAACACAAGCTGGCTGTGG - Intergenic
974250071 4:59374735-59374757 GAGCTAACACAAGCTGCCTATGG - Intergenic
974250613 4:59378516-59378538 TGACTAACACAAGCTGCCTATGG - Intergenic
974669681 4:65013979-65014001 TGACTAACACAAGCTGCCTAGGG - Intergenic
974974975 4:68880712-68880734 TGACTAACACAAGCCATCTATGG - Intergenic
974983732 4:68993751-68993773 TGACTAACACAAGCCATCTATGG - Intergenic
975888203 4:78991514-78991536 TTACTAACACAAACTGGCTTGGG + Intergenic
977486629 4:97656252-97656274 TGACTAACACCATTTGCCCAAGG + Intronic
977766583 4:100805859-100805881 TGACTAACACAAGCTGCCTATGG - Intronic
978703421 4:111675806-111675828 GAGCTAACACAAGCCGCCTATGG + Intergenic
979140198 4:117162717-117162739 TGACTAACACAAGCCACCTATGG + Intergenic
979859550 4:125676638-125676660 TGATGAACACAAGCTGCCTGAGG + Intergenic
980485472 4:133451306-133451328 TGACTAACACAAGCGGCCTACGG + Intergenic
980716513 4:136636636-136636658 TGGTTAACACAAGCCACCTATGG + Intergenic
980734518 4:136867596-136867618 TGATTAACACAAGCTGCCTGTGG + Intergenic
981423831 4:144581260-144581282 TGATTAACACAACCCGCCTGAGG + Intergenic
982504458 4:156199078-156199100 TGATTAACACAAGCCGCCCATGG + Intergenic
982534012 4:156585743-156585765 TGATTAAAACAAGCTGCAGAGGG - Intergenic
982959473 4:161818443-161818465 TGGTCAACACAAGCCGCCTATGG + Intronic
983145937 4:164215053-164215075 TGATGAACACAAGCCGACTACGG - Intronic
984289828 4:177781478-177781500 TGGTTAATACAAGCTGCCTATGG - Intronic
985712380 5:1436733-1436755 TGACAAACAGAAGCTGGCTGAGG + Intronic
986165244 5:5267271-5267293 TGATTAACACAAGCTGCCCAGGG - Intronic
986364739 5:7019133-7019155 TGACTAACACAAGCTGTGTATGG - Intergenic
986365300 5:7022872-7022894 TGACTAACACAAGCTGCCTATGG - Intergenic
987212166 5:15694013-15694035 TGATTAACACAAGCTGCCTGGGG + Intronic
987673375 5:21044059-21044081 TGGTTAACACAAGCCGCCTATGG - Intergenic
988038080 5:25853303-25853325 TGATTAACACAAGCCACTTATGG - Intergenic
988267254 5:28967880-28967902 TGACTAACACAAGCCATCTATGG + Intergenic
988573263 5:32393071-32393093 TGAATAACACATGTTGCCTCTGG - Intronic
988825754 5:34932775-34932797 TGAGCAACTCAGGCTGCCTATGG - Intronic
990585518 5:57207563-57207585 GAGCTAACACAAGCCGCCTATGG - Intronic
992324997 5:75651746-75651768 TGACTAAGACACTATGCCTAGGG - Intronic
992672723 5:79075964-79075986 TGATTAACACAAGCTGCCAGTGG - Intronic
995005202 5:107184284-107184306 TGAGTAACTCCAGCTGCCTGAGG + Intergenic
995266208 5:110164214-110164236 ATAATAACACAAGCTGCCAAAGG + Intergenic
995979039 5:118079015-118079037 TGACTAACACAAGCCGCCTACGG + Intergenic
1003069900 6:2937895-2937917 TGGTTAACACAAGCCACCTATGG - Intergenic
1003809878 6:9767821-9767843 TGGTTAACACAAGCCGCCTATGG - Intronic
1004027282 6:11831538-11831560 GACCTAACACAAGCTGCCTGTGG - Intergenic
1005712230 6:28513276-28513298 GAGCTAACACAAGCTGCCTATGG + Intronic
1006731044 6:36236318-36236340 TGATTAACACAAGCTGTCTGCGG + Intergenic
1007307602 6:40919078-40919100 TGACTACCACAAGCTGCCTACGG + Intergenic
1007854927 6:44845951-44845973 TGACTAACACAAGCTGCCTATGG + Intronic
1008727636 6:54441538-54441560 TGACTAACAGAAGCTGCTGATGG - Intergenic
1011136440 6:84105692-84105714 TGACTAATCCAGGCTGCCAAGGG - Intergenic
1011883546 6:92061562-92061584 TGAATAACACAGGCTCTCTAAGG - Intergenic
1012606842 6:101168098-101168120 TGACTAATACAAGCTGCCTATGG + Intergenic
1012831695 6:104211351-104211373 TGAATAAGACAACCAGCCTATGG - Intergenic
1015168300 6:130223866-130223888 TGATTAACACAAGCCACCTGCGG - Intronic
1016557223 6:145352628-145352650 TGATTAACACAAGAGGCCTGAGG - Intergenic
1017980164 6:159394349-159394371 TGATTAACACAAGCTGCCTGCGG + Intergenic
1021955848 7:25823625-25823647 TGACTGGCACAAGGTGACTAAGG - Intergenic
1022372383 7:29783812-29783834 TGATTAACACAAGCTGCCTGTGG + Intergenic
1024265143 7:47600649-47600671 TGACTAACACAAGCTGCCTATGG + Intergenic
1024268103 7:47621926-47621948 TGATTAACACAAGCCGCCTACGG - Intergenic
1024440291 7:49408596-49408618 TGATTAACACAAGCTGCCTGTGG + Intergenic
1024643842 7:51355249-51355271 TGATTAACACAAGTCCCCTATGG - Intergenic
1025104850 7:56162478-56162500 TAATTAACACAAGCTGCCTGAGG + Intergenic
1026111038 7:67459127-67459149 TGATTAACACAAGCCGCCTATGG - Intergenic
1026248436 7:68645092-68645114 TGATTAACACAAGCCACCTGTGG + Intergenic
1030746586 7:113173213-113173235 TGATTAACACAAGCCGCCTGCGG + Intergenic
1032643544 7:133796162-133796184 TGACTAAAAGAAGTTGCCTATGG - Intronic
1035026008 7:155826491-155826513 TGACTACCACAGGCTCCTTAGGG + Intergenic
1038248620 8:25882095-25882117 TGAGTAACACAAGCCGCCTACGG + Intronic
1039076219 8:33692852-33692874 GAGCTAACACAAGCTGCCTACGG - Intergenic
1039086287 8:33783435-33783457 TGACTAACAGAAGCTGCCTATGG - Intergenic
1039306912 8:36272936-36272958 TGATTAACAGAAGCTGCCTGTGG + Intergenic
1039865654 8:41499321-41499343 GAGCTAACACAAGCCGCCTATGG - Intronic
1040782144 8:51121977-51121999 TGATTAACACAAGCTGCAAGTGG - Intergenic
1040787419 8:51181783-51181805 TGGTCAACACAAGCTGCCTATGG + Intergenic
1040985236 8:53286811-53286833 TGTCTTACAGAAGCTGCCTTTGG + Intergenic
1041312377 8:56529932-56529954 TGACTAACACAAGCTGCCTATGG + Intergenic
1041548289 8:59071461-59071483 TAACTAAAACAAGCTGCCGTTGG - Intronic
1042485316 8:69340477-69340499 TGACTAATACAAACTCCCTCTGG + Intergenic
1043605258 8:81991553-81991575 TGAATAACACGAGCCGCCTATGG - Intergenic
1046260909 8:111766188-111766210 TGATTAACACAAGCCACCTGCGG + Intergenic
1047272322 8:123373869-123373891 TGATTAACAGATGCAGCCTAAGG - Intronic
1047542633 8:125785199-125785221 TGACTCACGCAAGCCACCTACGG + Intergenic
1047640879 8:126820709-126820731 TGACTAACACAAGCCGCCTATGG - Intergenic
1047883181 8:129218760-129218782 TGATTAACACAAGCTGCCTATGG + Intergenic
1048123481 8:131607616-131607638 TGATTAACACAAGCTGCCTGTGG - Intergenic
1048144941 8:131832365-131832387 TGTCCAACACAAGCTTCCCAGGG + Intergenic
1048671688 8:136730115-136730137 TGATAAACACAAGCTGTCTATGG - Intergenic
1050944544 9:11500678-11500700 TGACTAACACAAGCCGCCTATGG - Intergenic
1052690380 9:31809121-31809143 TGACTAACACAAGCCGCCTATGG - Intergenic
1055734484 9:79312707-79312729 TGACTAACACAAGCCACCTACGG + Intergenic
1056377475 9:86028612-86028634 TGATTAACACAAGCTGCCTGTGG + Intronic
1056573261 9:87834635-87834657 TGACTAATGCAAGCCGCCTATGG - Intergenic
1058584443 9:106492074-106492096 TGAGTAACACAAGCCACCTATGG - Intergenic
1061594359 9:131619356-131619378 GGACTAAAACCAGCTGCCGAAGG + Intronic
1061868814 9:133509279-133509301 TTACCAAAGCAAGCTGCCTAAGG - Intergenic
1203461158 Un_GL000220v1:39916-39938 TGACTAATACAATCTGCAAATGG + Intergenic
1185837723 X:3360778-3360800 TGAGTAACACAAGCCGCTTATGG - Intergenic
1187138549 X:16571309-16571331 TGATTAACACAAGCTGCCTGTGG + Intergenic
1188717272 X:33476071-33476093 TGACTCACACTAGCTGCTTCTGG - Intergenic
1189698899 X:43695797-43695819 TTACTTACAAAAGCTGCCTATGG - Intronic
1192748469 X:73963624-73963646 TGACTAACACAAGCTACCTATGG - Intergenic
1193846516 X:86478855-86478877 TGATTAACACAAGCTGCCTGCGG - Intronic
1194535651 X:95103382-95103404 TGACTAACACAAGCCGCCTATGG - Intergenic
1200690355 Y:6302903-6302925 TGACTAACTCAAGCCACCTACGG - Intergenic
1201044918 Y:9871813-9871835 TGACTAACTCAAGCCACCTACGG + Intergenic
1201238106 Y:11930957-11930979 TGAGTAACACAAGCCGCTTATGG + Intergenic