ID: 952298759

View in Genome Browser
Species Human (GRCh38)
Location 3:32085508-32085530
Sequence TCTGTCCTTGCCATAAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952298759_952298763 -5 Left 952298759 3:32085508-32085530 CCCTGCCTTATGGCAAGGACAGA No data
Right 952298763 3:32085526-32085548 ACAGAGGCTATCAGTATCCCAGG No data
952298759_952298764 8 Left 952298759 3:32085508-32085530 CCCTGCCTTATGGCAAGGACAGA No data
Right 952298764 3:32085539-32085561 GTATCCCAGGCCTCTTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952298759 Original CRISPR TCTGTCCTTGCCATAAGGCA GGG (reversed) Intergenic
No off target data available for this crispr