ID: 952298763

View in Genome Browser
Species Human (GRCh38)
Location 3:32085526-32085548
Sequence ACAGAGGCTATCAGTATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952298762_952298763 -10 Left 952298762 3:32085513-32085535 CCTTATGGCAAGGACAGAGGCTA No data
Right 952298763 3:32085526-32085548 ACAGAGGCTATCAGTATCCCAGG No data
952298758_952298763 -4 Left 952298758 3:32085507-32085529 CCCCTGCCTTATGGCAAGGACAG No data
Right 952298763 3:32085526-32085548 ACAGAGGCTATCAGTATCCCAGG No data
952298759_952298763 -5 Left 952298759 3:32085508-32085530 CCCTGCCTTATGGCAAGGACAGA No data
Right 952298763 3:32085526-32085548 ACAGAGGCTATCAGTATCCCAGG No data
952298760_952298763 -6 Left 952298760 3:32085509-32085531 CCTGCCTTATGGCAAGGACAGAG No data
Right 952298763 3:32085526-32085548 ACAGAGGCTATCAGTATCCCAGG No data
952298755_952298763 30 Left 952298755 3:32085473-32085495 CCATAGGCAGCTTGTGTTAGTCA 0: 19
1: 19
2: 43
3: 62
4: 133
Right 952298763 3:32085526-32085548 ACAGAGGCTATCAGTATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952298763 Original CRISPR ACAGAGGCTATCAGTATCCC AGG Intergenic
No off target data available for this crispr