ID: 952299061

View in Genome Browser
Species Human (GRCh38)
Location 3:32087831-32087853
Sequence CTGAACAGACAGATAGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952299061_952299067 10 Left 952299061 3:32087831-32087853 CCCTTTTCTATCTGTCTGTTCAG No data
Right 952299067 3:32087864-32087886 TGATTCAGGGTTTCCTTGGAGGG No data
952299061_952299064 -3 Left 952299061 3:32087831-32087853 CCCTTTTCTATCTGTCTGTTCAG No data
Right 952299064 3:32087851-32087873 CAGTTATTGATAATGATTCAGGG No data
952299061_952299066 9 Left 952299061 3:32087831-32087853 CCCTTTTCTATCTGTCTGTTCAG No data
Right 952299066 3:32087863-32087885 ATGATTCAGGGTTTCCTTGGAGG No data
952299061_952299068 11 Left 952299061 3:32087831-32087853 CCCTTTTCTATCTGTCTGTTCAG No data
Right 952299068 3:32087865-32087887 GATTCAGGGTTTCCTTGGAGGGG No data
952299061_952299063 -4 Left 952299061 3:32087831-32087853 CCCTTTTCTATCTGTCTGTTCAG No data
Right 952299063 3:32087850-32087872 TCAGTTATTGATAATGATTCAGG No data
952299061_952299065 6 Left 952299061 3:32087831-32087853 CCCTTTTCTATCTGTCTGTTCAG No data
Right 952299065 3:32087860-32087882 ATAATGATTCAGGGTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952299061 Original CRISPR CTGAACAGACAGATAGAAAA GGG (reversed) Intergenic
No off target data available for this crispr