ID: 952301474

View in Genome Browser
Species Human (GRCh38)
Location 3:32107486-32107508
Sequence TGTTTGGGTGAATGTAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952301466_952301474 13 Left 952301466 3:32107450-32107472 CCCTTAATCAAACGTACACTGTG 0: 1
1: 0
2: 0
3: 8
4: 70
Right 952301474 3:32107486-32107508 TGTTTGGGTGAATGTAGAGGTGG 0: 1
1: 0
2: 0
3: 27
4: 288
952301467_952301474 12 Left 952301467 3:32107451-32107473 CCTTAATCAAACGTACACTGTGG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 952301474 3:32107486-32107508 TGTTTGGGTGAATGTAGAGGTGG 0: 1
1: 0
2: 0
3: 27
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952301474 Original CRISPR TGTTTGGGTGAATGTAGAGG TGG Intronic
900509374 1:3051319-3051341 AGGATGGGTGAATGGAGAGGTGG - Intergenic
900747135 1:4368085-4368107 TGTCTGGGAGAATGGAGAGAAGG + Intergenic
901233536 1:7654715-7654737 TGTGTGGGTGTGTGTATAGGTGG - Intronic
902729288 1:18358056-18358078 TGTGTGTGTGAATGTTTAGGGGG + Intronic
903915156 1:26758408-26758430 TGTTTGTGTGTGTGTAGAGAAGG - Intronic
904560511 1:31394345-31394367 TGTTTAGGAGAATTAAGAGGAGG - Intergenic
905258074 1:36698242-36698264 TGTGTGGGTGTATGTACAGGAGG - Intergenic
905416929 1:37810078-37810100 TGTTTTGGAGAATGTGGGGGTGG - Exonic
905871657 1:41407875-41407897 GGGGTGGGTGAGTGTAGAGGAGG + Intergenic
906674910 1:47686681-47686703 GGTGTGGGTCAATGAAGAGGAGG + Intergenic
907143410 1:52210090-52210112 TGTTCGATTGAATGTAGAGTTGG + Intronic
908369479 1:63467539-63467561 TGATTGATTGAATGTAGAGATGG + Intronic
908708500 1:66989319-66989341 TGGTTGACTGAATGTAGAGCTGG + Intergenic
910349173 1:86276855-86276877 TGTTTGGGAGAAAGTAAGGGAGG - Intergenic
910734851 1:90442372-90442394 TGTGTGTGTGCATGTTGAGGGGG + Intergenic
911151127 1:94597663-94597685 AGTTTGGGTGATTGCAGAGGTGG + Intergenic
911245301 1:95510229-95510251 TGTTCGTGTCAATGTAGATGGGG + Intergenic
911814464 1:102327575-102327597 TGTTTTGGTTAATGTTGATGTGG - Intergenic
912050937 1:105526991-105527013 TTCTTGGTTTAATGTAGAGGAGG - Intergenic
912871698 1:113312259-113312281 TGTTTGGGAGAAAGTAAGGGAGG + Intergenic
913272339 1:117106804-117106826 GGTTTGGCTCAATGAAGAGGTGG - Exonic
913507317 1:119529080-119529102 TGATTGGGTGTTTGGAGAGGTGG - Intergenic
919442450 1:197653856-197653878 TGTTTTTGTGAATGTACATGTGG - Intronic
919517095 1:198539326-198539348 TCTTTGGATGAATGTAGTGATGG - Intronic
922349152 1:224721772-224721794 TGTGAGGCTGAATGAAGAGGGGG + Intronic
923678647 1:236101272-236101294 TGTGTGTGTGAATGTGGAGGTGG + Intergenic
1064894778 10:20222965-20222987 TGTTTATGTGAAAGAAGAGGAGG + Intronic
1066468262 10:35672036-35672058 TGTTTGTGTGTATGTGGGGGCGG + Intergenic
1069611543 10:69775893-69775915 TGGTTGGGGGAATGGAGAGAAGG + Intergenic
1069704309 10:70448190-70448212 TGTTTTGTTGAATGAAGAGGAGG - Intergenic
1070777859 10:79120508-79120530 TGTTTGTGTGTATGTTGGGGAGG + Intronic
1071915802 10:90294425-90294447 TGTTGGGAGGAATGTTGAGGAGG + Intergenic
1073006948 10:100331465-100331487 TGTTTTGCTGAATGTGAAGGTGG - Intergenic
1073851596 10:107625925-107625947 TATTTGGGTGAATATATATGGGG - Intergenic
1074253715 10:111779531-111779553 GAGTTGGGTGAAGGTAGAGGAGG - Intergenic
1075590973 10:123691488-123691510 TGCTTGGGTGCAGGTAGATGAGG + Exonic
1076319868 10:129569886-129569908 TGTTTGTGTGAATGTGTTGGTGG - Intronic
1078846560 11:15124072-15124094 TGTGTGGGTGAATGAACAAGAGG - Intronic
1083187736 11:61027196-61027218 TGTGTGGAAGAATGAAGAGGAGG - Intergenic
1083199901 11:61114426-61114448 TGTGTGTGTGTATGTAGAGATGG - Intronic
1083297148 11:61720931-61720953 TGGCTGAGTGAATGGAGAGGTGG - Intronic
1083634736 11:64114382-64114404 TGGATGGGTGAATGGACAGGTGG + Intronic
1083634805 11:64114764-64114786 TGGATGGATGAATGTACAGGTGG + Intronic
1084697483 11:70764331-70764353 TGAGTGGGTGAATGTATAGATGG - Intronic
1086033216 11:82384690-82384712 TGTTTGGGAGAAAGTAAAGGAGG + Intergenic
1089336334 11:117726345-117726367 TGTGTGGGGGAAGGGAGAGGAGG + Intronic
1089514548 11:119024186-119024208 TGTTCAGGTGAAGGCAGAGGAGG + Intronic
1091436544 12:477949-477971 TGTTTGGAAGATTATAGAGGGGG + Intronic
1091562827 12:1628013-1628035 TGCATGGATGAATGAAGAGGAGG + Intronic
1092723068 12:11460805-11460827 GGGTGGGGTGAATGTAGAAGAGG + Intronic
1092948127 12:13475586-13475608 GCTTTGCGTGAATGGAGAGGGGG - Intergenic
1092991172 12:13901114-13901136 TGTTGGTGAGAATGTAGAAGAGG - Intronic
1093577553 12:20751301-20751323 TGTGTGGGTGAGTGTATATGGGG + Intronic
1093915118 12:24793402-24793424 TGTGTGTGTGTGTGTAGAGGAGG + Intergenic
1095847007 12:46757284-46757306 TGTGTGTGTGAAGGTAGATGGGG + Intergenic
1096343840 12:50828180-50828202 TGTTTGGGAGAAAGTAAGGGAGG - Intergenic
1097055263 12:56245318-56245340 TGTTGGAGTGTGTGTAGAGGGGG - Intronic
1097392908 12:59037647-59037669 TGTTTGGGTGCTTGTGGTGGTGG - Intergenic
1098564888 12:71922731-71922753 TGTTTGTGGGAATGTGGAGGTGG + Intronic
1098627438 12:72689771-72689793 TGTGTGTGTGTGTGTAGAGGTGG - Intergenic
1099411814 12:82339280-82339302 TGATTGATTGATTGTAGAGGTGG + Intronic
1100539767 12:95547657-95547679 TGTGGGGGTGAAAGTAGGGGTGG - Intronic
1100788975 12:98109549-98109571 TGTTTGGGTGAGTGGGGAGGAGG + Intergenic
1102364362 12:112319152-112319174 GGGTTGGGTGAATGAAGAAGAGG - Intronic
1102376387 12:112424999-112425021 TGTGTGTGTGTATGTAGAGATGG + Intronic
1102927764 12:116839639-116839661 TGGATGGGTGAGTGTAAAGGTGG + Intronic
1102927784 12:116839739-116839761 TGGGTGGGTGAATGGATAGGTGG + Intronic
1103004422 12:117409606-117409628 TGGATAGGTGAATGGAGAGGTGG + Intronic
1104815381 12:131642638-131642660 TGAATGGGTGAATCTAGGGGAGG - Intergenic
1105532069 13:21229308-21229330 TGTGTGGGTGAGTGTGGGGGGGG - Intergenic
1106158407 13:27178714-27178736 TGTTTGTGTGTGTGTACAGGGGG - Intergenic
1107462513 13:40617645-40617667 TATTTGGGTGAAGGAACAGGTGG + Intronic
1107788771 13:43980011-43980033 TGTCTGGGTGAATGGAGACTGGG - Intergenic
1108057499 13:46499122-46499144 TGTGTGTGTGTATGTATAGGGGG - Intergenic
1108518839 13:51226479-51226501 TGTTTGGGGCAATGTTGAGTGGG + Intronic
1110471285 13:75862824-75862846 GGTTGGCATGAATGTAGAGGAGG + Intergenic
1112388924 13:98964959-98964981 TGTATGGGTGAAGGTGGAGCAGG - Intronic
1112844241 13:103618296-103618318 CCTTTGGGTGAATGAAGATGAGG - Intergenic
1113780170 13:112972266-112972288 TGGGTGGATGAATGTAGGGGTGG + Intronic
1115038583 14:28891460-28891482 CGTTTGGGTGAACGCAGAGTTGG + Intergenic
1115398438 14:32934335-32934357 TGTGTGTGTGTGTGTAGAGGGGG + Intergenic
1115722136 14:36174764-36174786 TGTTGGGGTGAGTCTAGAGTTGG + Intergenic
1115736477 14:36336668-36336690 TGTTTGGGTGTAAGGATAGGAGG - Intergenic
1116916174 14:50528222-50528244 TCTTTGGTTGAAAGAAGAGGAGG - Intronic
1117606329 14:57432051-57432073 TGTTTTGGAGAAAGTAAAGGAGG + Intergenic
1118554021 14:66993254-66993276 TGTATGTGTGTGTGTAGAGGGGG - Intronic
1119128530 14:72150771-72150793 TGATTGGATCAATGTGGAGGAGG - Intronic
1120592591 14:86393300-86393322 TGTGTGCGTGTATGTAGAGGGGG - Intergenic
1121345910 14:93135797-93135819 TGTGTGTGTGTATGTGGAGGGGG + Intergenic
1121816013 14:96929108-96929130 TGGATGGGTGAATGGATAGGTGG - Intronic
1122416142 14:101550433-101550455 TGGTTGGATGAATGGACAGGTGG + Intergenic
1122867581 14:104614399-104614421 TGTTTGGGTGGATGGAGAGATGG + Intergenic
1125458210 15:39882640-39882662 TGTTTTGGTGAATAAAGAAGTGG - Intronic
1126915175 15:53458339-53458361 TGTATGGGTGAAAGCAGAGGGGG - Intergenic
1127701934 15:61509633-61509655 TGTTTGTGTGAGTGGGGAGGGGG - Intergenic
1128262605 15:66243033-66243055 TGTGTGTGTGTATGTAGAAGAGG - Intronic
1128588959 15:68877325-68877347 TGTGTGCGTGAAGGTCGAGGAGG + Intronic
1128666896 15:69544924-69544946 TGGCTGGGTGAGTGTAGAGCAGG + Intergenic
1128902766 15:71440098-71440120 CATTTGGGTGAATGTGGAGGTGG - Intronic
1129032952 15:72631438-72631460 TGTTTGGGTTAATTTAGGAGTGG + Intergenic
1129407740 15:75330285-75330307 TGTTTGGGTTAATTTAGTTGTGG + Intergenic
1129645348 15:77425123-77425145 AGTTTGGGAGAGTGTAGAAGAGG - Intronic
1129734090 15:77950106-77950128 TGTTTGGGTTAATTTAGTTGTGG - Intergenic
1129841492 15:78745886-78745908 TGTTTGGGTTAATTTAGTTGTGG + Intergenic
1130356736 15:83139965-83139987 TATTTGGGTTAATGATGAGGGGG - Intronic
1130932869 15:88442914-88442936 TGTTTGGTTGTTTGTAGAGATGG + Intergenic
1132309407 15:100846133-100846155 TGTCTGGGTGAAGGGAGAGGAGG + Intergenic
1133104695 16:3499957-3499979 TCTTTGGGTTAAAGCAGAGGGGG - Intergenic
1134447035 16:14338544-14338566 TGGATGGGTGAATGGATAGGTGG - Intergenic
1134746651 16:16593880-16593902 TGGGTGGGTGAATGGAGAGTAGG - Intergenic
1135548131 16:23379203-23379225 TGGGTGGGAGAATGGAGAGGTGG - Intronic
1137826203 16:51497976-51497998 TGTGTGTGTGCATGTTGAGGGGG - Intergenic
1138225170 16:55288178-55288200 TGTTTGGGAGAATTTATCGGTGG - Intergenic
1138359214 16:56412687-56412709 TGTTTAGGTGTTTGTAGAGACGG - Intronic
1140982910 16:80127675-80127697 TCTTTGGGTGAAAGAAGATGAGG + Intergenic
1141801388 16:86311655-86311677 TGTGTGGGTGAATCCAGGGGTGG + Intergenic
1142388486 16:89782565-89782587 TGTGGGGTTGAATGGAGAGGTGG - Intronic
1143348397 17:6267516-6267538 TGTGTGTGTGTGTGTAGAGGTGG - Intergenic
1143462582 17:7113278-7113300 TGTGTGTGTGTGTGTAGAGGTGG - Intronic
1144298166 17:13899071-13899093 TGTGTGGTTCAATGTAGAGAAGG - Intergenic
1145942152 17:28748187-28748209 GGTCTGGCTGAATGTGGAGGAGG + Intronic
1147179718 17:38676554-38676576 TGTGTGTGTGTGTGTAGAGGTGG - Intergenic
1147528358 17:41249331-41249353 TGTTTGGCTGTATGTAGACTGGG - Intronic
1147693500 17:42333602-42333624 TGTTAGGGTGAGGGTAGAGTTGG - Intronic
1148686214 17:49502580-49502602 TGTTTGGGGGAAGGGAGAGGAGG + Intronic
1149072950 17:52564841-52564863 TGTGTGTGTGTGTGTAGAGGGGG - Intergenic
1151599442 17:75097381-75097403 GGTTTGGCTCAATGTGGAGGGGG - Intronic
1153944646 18:10008352-10008374 TGGTTGGGTGGATGAATAGGTGG - Intergenic
1154048793 18:10933580-10933602 TGTCTGGATGGATATAGAGGAGG - Intronic
1154190199 18:12224311-12224333 TGTGTAGGTGAATGCAGACGAGG - Intergenic
1158167492 18:54556961-54556983 GGTTTGGGGGATTGTAGAAGTGG + Intergenic
1158447050 18:57530777-57530799 TGTTTGTGTGTATGTGGGGGAGG - Intergenic
1159556463 18:69951000-69951022 TGTGTGTGTGTGTGTAGAGGTGG + Intronic
1161131316 19:2590645-2590667 TGAATGGGTGAATGGATAGGTGG - Intronic
1161838766 19:6665810-6665832 TGTGTGTGTGTTTGTAGAGGTGG + Intronic
1163158331 19:15450680-15450702 TGTTTGGGTGAATTAATAGGTGG - Intergenic
1163838019 19:19587922-19587944 TGCCTGGGTGAAGGGAGAGGAGG + Intronic
1164217135 19:23160667-23160689 GGTTTGGTTGAATGGAGAAGGGG - Intergenic
1164457256 19:28419103-28419125 TGTGTGTGTGTGTGTAGAGGTGG - Intergenic
1164733649 19:30524699-30524721 TGTTTGGGTGGGGGTGGAGGAGG - Intronic
1165016439 19:32884106-32884128 TGTGTGGGTCCCTGTAGAGGAGG - Intronic
1165737398 19:38185396-38185418 TGTACGGGTGATTGTTGAGGAGG - Intronic
1165973720 19:39656273-39656295 TGTTTGTGTGAGTGTAAGGGGGG + Intronic
1165993864 19:39831381-39831403 GGATTGGGTGAATTTGGAGGGGG - Intronic
1166687350 19:44803370-44803392 TGTTGGGGTGAAAGTATAGACGG - Intergenic
1167230439 19:48279572-48279594 TGGGTGGGTGGGTGTAGAGGGGG + Intronic
925588659 2:5488161-5488183 TGTTTGGGAGAAAGTAGAGAAGG + Intergenic
927559653 2:24060993-24061015 TGAGTGGGTGAAGGTGGAGGTGG - Intronic
928407963 2:31029307-31029329 TGTGACAGTGAATGTAGAGGTGG - Intronic
930262391 2:49162915-49162937 TGTTTCTGTGAATGTAGTGTAGG + Intergenic
930298560 2:49585900-49585922 TATTTGGCAGAATGTAAAGGGGG - Intergenic
931830720 2:66048367-66048389 TGTTTTGGTCATTGGAGAGGTGG + Intergenic
932187579 2:69712187-69712209 TGTTTGTGTGTATGTGGTGGTGG - Intronic
935320641 2:101885066-101885088 TGTTTGGATGAATGAATAGAAGG + Intronic
935364019 2:102270713-102270735 TGGGTGGGTGAATGGACAGGTGG + Intergenic
936230282 2:110694510-110694532 TGCTTGGGAGAAGGCAGAGGTGG + Intergenic
937045358 2:118848337-118848359 GGTTTGGGTGTGTGTAGTGGAGG + Intergenic
937353057 2:121179450-121179472 AGTTTGGATTAAAGTAGAGGAGG + Intergenic
940074384 2:149724677-149724699 TTTTTGGGTGACTGTGGATGTGG + Intergenic
941264960 2:163349239-163349261 TGTGTGCGTGTGTGTAGAGGAGG - Intergenic
941645844 2:168040213-168040235 TATTTGGATAAATGTACAGGTGG + Intronic
941664588 2:168231761-168231783 TGTCTGGGTGAAGGGAGAGGAGG + Intronic
942146138 2:173028598-173028620 TGTTTAGGTGAATGAGTAGGTGG + Intronic
942333834 2:174858972-174858994 TGTGTGTGTGTGTGTAGAGGAGG - Intronic
943515773 2:188884486-188884508 TGTTTGGGTGATGGGAGTGGAGG - Intergenic
943887545 2:193241108-193241130 TGTTTGTGTGTTAGTAGAGGAGG + Intergenic
945013210 2:205486652-205486674 TGGGTGGGTGAAGGTAGGGGAGG + Intronic
945438762 2:209852154-209852176 AGTAGGGGTGAATGTACAGGAGG + Intronic
947691365 2:232139655-232139677 AATTTGGGGGAATTTAGAGGAGG + Intronic
947731036 2:232431809-232431831 TGTTTGTGTGTATGCACAGGGGG - Intergenic
1171431510 20:25085764-25085786 TGTTTGTGTGTGTGTAGCGGGGG - Intergenic
1173576069 20:44113613-44113635 TGTCTGGGGGGATGCAGAGGTGG - Intronic
1174210752 20:48876102-48876124 TGTTTGTGTGGAGGGAGAGGAGG - Intergenic
1175410795 20:58767011-58767033 CGTTTGGGTAAATATATAGGAGG + Intergenic
1175772603 20:61633050-61633072 TGGATGGGTGAATGAAGAGATGG - Intronic
1178898813 21:36582991-36583013 TGTGTGGGTGATGGCAGAGGTGG - Intergenic
1179351858 21:40618746-40618768 TGACTGGGAGAATGGAGAGGTGG + Intronic
1179620992 21:42616199-42616221 TGTTTGTGTGTATGTATATGTGG - Intergenic
1180085956 21:45508006-45508028 TGGATGGGTGGATGGAGAGGTGG + Intronic
1181725571 22:24808587-24808609 TGGTTGGTTGAATGGGGAGGGGG + Intronic
1181732294 22:24855953-24855975 TGGATGGGTGAATGTAAAGATGG - Intronic
1181732299 22:24855977-24855999 TGGATGGGTGAATGTAAAGATGG - Intronic
1181941698 22:26483169-26483191 TATTTGGGTGCCTGTGGAGGGGG + Intronic
1183968782 22:41460236-41460258 TGTCTGGGTGAAGGGAGAGGAGG + Exonic
949315689 3:2752368-2752390 TGTTTGTGTGTTTGTTGAGGTGG + Intronic
949317440 3:2772382-2772404 GGTTTGGGTGAAGGTAGGGACGG + Intronic
949363127 3:3252762-3252784 TGTTTGGGTGTGTGTAGTGGGGG - Intergenic
949381122 3:3447041-3447063 AGTTTGGGTAAATGTTGAGAAGG - Intergenic
949944121 3:9176822-9176844 AGTTTGGGTCAGGGTAGAGGAGG - Intronic
951904427 3:27689424-27689446 TGTTTGGGAGAAAGTAAGGGAGG + Intergenic
952015929 3:28957925-28957947 GGTTTGGGGGAATGGAGAGAAGG - Intergenic
952301474 3:32107486-32107508 TGTTTGGGTGAATGTAGAGGTGG + Intronic
953335436 3:42090241-42090263 TGTTTGGACAAATGTAGATGCGG - Intronic
953660999 3:44891505-44891527 TGTGTGTGTGTGTGTAGAGGAGG - Intronic
954311884 3:49775753-49775775 TGTCTGGGTGAAGGGAGGGGAGG - Intronic
954558994 3:51539621-51539643 TGGTTTGGGGAGTGTAGAGGAGG + Intergenic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
957795955 3:85007734-85007756 AGTTTGTGTGCCTGTAGAGGAGG + Intronic
958088256 3:88840607-88840629 TGTTCTGGTGGATGTAGAAGAGG + Intergenic
959282561 3:104363163-104363185 TGTTTGTGGGAATGAGGAGGTGG - Intergenic
960065017 3:113362267-113362289 TGTCTGGGTGAAGGGACAGGAGG + Intronic
960373336 3:116868144-116868166 TGATAGTGGGAATGTAGAGGTGG + Intronic
961930833 3:130531008-130531030 TGTGTGTGTGTGTGTAGAGGAGG - Intergenic
962746144 3:138398574-138398596 TGTGTGCGTGTGTGTAGAGGGGG + Intronic
964982841 3:162707651-162707673 TGTTTATGTAAATGTAGAGAAGG + Intergenic
965191092 3:165530628-165530650 TCCTTGGTTTAATGTAGAGGAGG - Intergenic
965635229 3:170773902-170773924 TGTGTGTGTGTATGTAGTGGGGG + Intronic
965683370 3:171275084-171275106 TGTCTGGGTTGATGGAGAGGAGG - Intronic
966270745 3:178102293-178102315 TGTTTGGCTGGATGCAGAGAGGG + Intergenic
966613751 3:181892959-181892981 CGTATGTGGGAATGTAGAGGAGG + Intergenic
966621552 3:181969608-181969630 TGTTTGTGTGTATGTGTAGGAGG + Intergenic
966666714 3:182479840-182479862 TGGTTGGGTGATTGGAGAGTGGG + Intergenic
967319651 3:188183125-188183147 TGTTGGGGTGGAAGTAGAAGTGG + Intronic
967797784 3:193616772-193616794 AGTTTAGGTGTATGTGGAGGTGG + Intronic
968688503 4:1977212-1977234 TGTTTGAGGGAAAGTAGAGTGGG + Intronic
968946143 4:3665509-3665531 TGGGTGGGTGAATGGATAGGTGG - Intergenic
969037568 4:4267064-4267086 TCTTTGGCTGAAGGTAGATGGGG + Intergenic
969453983 4:7290723-7290745 TGTTTTGGGGAATGTAGGGCAGG + Intronic
970402319 4:15729279-15729301 TGTTTGTTTGCTTGTAGAGGCGG - Intronic
978957834 4:114636703-114636725 AGTTTGGGGGAAGGGAGAGGGGG - Intronic
980429043 4:132666396-132666418 AATGTGGGAGAATGTAGAGGAGG - Intergenic
980800482 4:137742811-137742833 TGTTTGGGTAAATGATGAGATGG - Intergenic
981883343 4:149643068-149643090 TGTTTGGTTGAATGTAACTGCGG - Intergenic
982635932 4:157896649-157896671 TGGTTGGGGGAATGAAGTGGAGG + Intergenic
983104229 4:163665900-163665922 TTTTTGGATGAATGCTGAGGAGG + Intronic
983593664 4:169441919-169441941 TGTTTGGGTGTCTGTGGTGGCGG - Intronic
984284683 4:177714266-177714288 GATTTGGGTGGAGGTAGAGGTGG + Intergenic
984501667 4:180565928-180565950 AGTTTGGGTGAATGCAGGTGAGG + Intergenic
984963455 4:185120501-185120523 TATGTGGGTGTATGTAGGGGCGG + Intergenic
988360126 5:30226654-30226676 TGTGTGGGCCAAGGTAGAGGTGG - Intergenic
989487241 5:42005829-42005851 TGCTTGGGTGATAGAAGAGGAGG - Intergenic
989961354 5:50419525-50419547 TGTGTGTGTGTATGTAGTGGGGG - Intronic
990293622 5:54379665-54379687 TGTTTCTGTGAATGGAGAAGAGG + Intergenic
991152184 5:63383262-63383284 TGTGTGGGTGGGTGAAGAGGAGG + Intergenic
991989102 5:72320087-72320109 TTTTTGGGTGAAGGGAGCGGTGG - Intronic
992850675 5:80804607-80804629 TGTTTGGGGGAAAGTAAAGGAGG - Intronic
994814344 5:104565783-104565805 TGTTTGGGTGTATGGATATGTGG - Intergenic
996820518 5:127621386-127621408 TGGTTGGTTGAACTTAGAGGAGG + Intergenic
997439196 5:133897357-133897379 TGGATGGGTGAATGGATAGGTGG + Intergenic
997660158 5:135583197-135583219 TGTTTGCGTGTGTGTAGGGGTGG + Intergenic
998721130 5:144950788-144950810 TGTGTGTGTGTGTGTAGAGGGGG - Intergenic
1000397283 5:160789100-160789122 TGTATGGGTGCATGTACATGAGG - Intronic
1000730511 5:164828889-164828911 TGCTTGGTTTAATGTAGAGGAGG + Intergenic
1001192906 5:169647245-169647267 TGATTGGATGGATGAAGAGGTGG + Intronic
1001453358 5:171842923-171842945 TGTGGGGCTGAAGGTAGAGGGGG - Intergenic
1001637813 5:173224914-173224936 TGTGTGTGTGTGTGTAGAGGTGG - Intergenic
1001730122 5:173947385-173947407 TGTATGAATGTATGTAGAGGGGG + Intronic
1001878934 5:175225980-175226002 TGGGTGGGTGAATGTATAGGTGG + Intergenic
1003603311 6:7538662-7538684 TGTGTGGGTGTGTGTTGAGGTGG + Intergenic
1004681727 6:17902270-17902292 TGTTTTGGAGAATGAAGGGGAGG - Intronic
1006035109 6:31205247-31205269 TGTTTCAGTGACAGTAGAGGAGG - Intergenic
1006448538 6:34092875-34092897 TGGTTGGGTGTATCTACAGGAGG - Intronic
1007181430 6:39931970-39931992 TGTGTGGGTCAATGGGGAGGTGG - Intronic
1007235929 6:40391559-40391581 TATTCGTGTGAATGAAGAGGAGG + Intergenic
1007286239 6:40749486-40749508 TGGGTGTGTGAATGCAGAGGGGG - Intergenic
1010449873 6:75990581-75990603 TGTGTGTGTGTGTGTAGAGGTGG - Intronic
1011019079 6:82790075-82790097 TGTTTGGGTGAAAGGAAGGGAGG + Intergenic
1012606437 6:101163669-101163691 TGTGTGGGTGTCAGTAGAGGAGG - Intergenic
1015166152 6:130202271-130202293 TGTATGTGTCAATGTACAGGAGG - Intronic
1015429247 6:133111120-133111142 TGTGTGTGTGAATGTACAGATGG + Intergenic
1015493703 6:133857558-133857580 TGTGTGTGTGTATGCAGAGGAGG - Intergenic
1015610042 6:135007241-135007263 TATTTAAGTGAAAGTAGAGGGGG + Intronic
1015990517 6:138936618-138936640 TGTTTGGGGGGGGGTAGAGGTGG + Intronic
1019617246 7:1970188-1970210 TGGCTGGGTGAATGGAAAGGGGG + Intronic
1020112559 7:5455744-5455766 TGTTTGTGTGTGTGTAGTGGGGG - Intronic
1020341490 7:7116008-7116030 TGTTTGGGTGAAGACTGAGGTGG - Intergenic
1020631270 7:10643096-10643118 TGTGTGTGTGTGTGTAGAGGGGG - Intergenic
1021415590 7:20380125-20380147 TCTTGAGGTGAATGTACAGGAGG + Intronic
1021641105 7:22736528-22736550 TGTTTGGGAGAAAGTAAAAGAGG + Intergenic
1021902121 7:25296526-25296548 TTTTTGGGTGAATATAAAGAGGG - Intergenic
1022764706 7:33398411-33398433 TGCTTGAGTGAATGTAAAGGTGG + Intronic
1024851361 7:53720984-53721006 TGGTTGCGTGAATGGGGAGGGGG + Intergenic
1026645899 7:72168539-72168561 TGTTTGTGTGAAGCTAGACGTGG + Intronic
1027698024 7:81435433-81435455 TGTGTGTGTGTATGTAGATGAGG - Intergenic
1028513471 7:91650537-91650559 TGGTTGTGAGAATGGAGAGGAGG - Intergenic
1030990439 7:116292349-116292371 TGTTTGGGAGAAAGTAAGGGAGG + Intronic
1033066169 7:138156189-138156211 TTTTTGTGTGTGTGTAGAGGTGG - Intergenic
1033754348 7:144385714-144385736 TGTGTGTGTGTGTGTAGAGGTGG + Intergenic
1035950740 8:4017829-4017851 TGTTTGGGTGACTGTATATCTGG + Intronic
1037710323 8:21350452-21350474 TGTTTGGGTTAAAGGAGAGATGG + Intergenic
1038063564 8:23938390-23938412 TGTGTGTGTGTGTGTAGAGGTGG + Intergenic
1039014105 8:33127109-33127131 TGTTTTGCTGAATTTATAGGCGG + Intergenic
1042951053 8:74201072-74201094 TGGTTGGCTGAATGAAGAGTGGG + Intergenic
1043385483 8:79743760-79743782 TGTTTGGGTGCATGTTTATGCGG - Intergenic
1043770341 8:84190877-84190899 TTTTTGAGTGAATGTAAAAGGGG + Intronic
1046049795 8:109009365-109009387 TGTTTGGGTGTATCTTTAGGTGG - Intergenic
1048047548 8:130786976-130786998 AGTTGGGGAGAATGTACAGGAGG + Intronic
1048477760 8:134758493-134758515 TGTTTTGGGGAAGGTAGAGGAGG + Intergenic
1048671928 8:136732335-136732357 TGTTTGTGTGTGAGTAGAGGAGG - Intergenic
1050727737 9:8670990-8671012 TGTGTGTGTGGATGTGGAGGTGG + Intronic
1052197624 9:25736655-25736677 TGTGTGGGGGGATGTAGAGGGGG + Intergenic
1053071236 9:35103219-35103241 TGATTGGGTGAGTGTTGAAGCGG - Intergenic
1053725221 9:40992267-40992289 TGTTTGGGTGAAGACGGAGGCGG + Intergenic
1055120653 9:72656856-72656878 TGTTAGGGTGAATTCAGAGCAGG + Intronic
1055237030 9:74134165-74134187 TGTTTGAATAAATGTGGAGGTGG - Intergenic
1055513676 9:77017666-77017688 TGTTTGGATGAGTGCAGAGCAGG + Intergenic
1056112707 9:83411450-83411472 TGTTAGGGTGAACCAAGAGGTGG - Intronic
1056537968 9:87547600-87547622 TGTGTGCGTGTGTGTAGAGGAGG + Intronic
1058658142 9:107243747-107243769 TGATTGAGTGAATGGAAAGGTGG - Intergenic
1062089651 9:134668819-134668841 TGGTTGGTTGAATGAATAGGTGG - Intronic
1185580896 X:1211014-1211036 AGTGTGGGTGAATGCATAGGTGG + Intronic
1185755491 X:2650099-2650121 TGTTTGGGTGGATGTGTAGGTGG + Intergenic
1187183239 X:16963457-16963479 TGGTTGGGTGAATGTATAGCAGG + Intronic
1187722456 X:22165481-22165503 TGCTTGGGTGGAGGCAGAGGCGG + Intronic
1188002585 X:24996068-24996090 TGTTTGTGTGAATGTAGACCAGG + Exonic
1191840909 X:65513173-65513195 TGTTTGGGTTGAGGTAGGGGAGG + Intronic
1192100150 X:68255713-68255735 TGTGTGTGTGTATGTAGAGCGGG - Intronic
1192556110 X:72090798-72090820 TGTGTGTGTGTATGGAGAGGGGG + Intergenic
1193447986 X:81628764-81628786 TGTTAGGGATACTGTAGAGGGGG + Intergenic
1194211742 X:91078860-91078882 TGTGTGTGTGAATGTATGGGAGG - Intergenic
1194578815 X:95645773-95645795 TGTTTGTGTGAATGTATAAATGG - Intergenic
1195174954 X:102305942-102305964 GGTTTGGGTGGAGGTAGCGGAGG + Intergenic
1195183911 X:102381151-102381173 GGTTTGGGTGGAGGTAGCGGAGG - Intronic
1196830762 X:119773762-119773784 TGATTGACTGAATGTAGGGGAGG + Intergenic
1196925431 X:120629636-120629658 TTTTTGGGTGAAGGTAGTTGGGG + Intronic
1198792667 X:140362568-140362590 TTCTGGGGTGAAGGTAGAGGTGG - Intergenic