ID: 952305005

View in Genome Browser
Species Human (GRCh38)
Location 3:32137867-32137889
Sequence GATCATTTACAGAGGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952304998_952305005 14 Left 952304998 3:32137830-32137852 CCTCACAGTGGCACTCTCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 158
Right 952305005 3:32137867-32137889 GATCATTTACAGAGGGGCCATGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952305005 Original CRISPR GATCATTTACAGAGGGGCCA TGG Intronic