ID: 952305005

View in Genome Browser
Species Human (GRCh38)
Location 3:32137867-32137889
Sequence GATCATTTACAGAGGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952304998_952305005 14 Left 952304998 3:32137830-32137852 CCTCACAGTGGCACTCTCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 158
Right 952305005 3:32137867-32137889 GATCATTTACAGAGGGGCCATGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952305005 Original CRISPR GATCATTTACAGAGGGGCCA TGG Intronic
902074144 1:13769250-13769272 GGACATTTACAGAGGGGAGATGG - Intronic
905101421 1:35526113-35526135 GATTTTTGACAGAGGTGCCAAGG - Intronic
908438640 1:64131526-64131548 TATCATTTACACAAGGGCCAAGG - Intronic
910354763 1:86341845-86341867 GGTCCTTCACAGAGGGGACACGG - Intergenic
916710955 1:167407612-167407634 GATTTTTGACAGAGGTGCCAAGG + Intronic
919577329 1:199327260-199327282 GATCTTTGACAAAGGTGCCAAGG + Intergenic
1063843562 10:10100646-10100668 GATCTTTGACAAAGGGGCAAAGG + Intergenic
1063904304 10:10766679-10766701 GCTCATGAACAGAGTGGCCATGG - Intergenic
1068190123 10:53640775-53640797 GATCTTTGACAGAGGAGCAAAGG + Intergenic
1071378495 10:85034205-85034227 GATCATGAACAAAGCGGCCATGG + Intergenic
1072521949 10:96236898-96236920 GATCATTAACAGAGGGGTGGGGG + Intronic
1079134763 11:17770217-17770239 GATCATTTGGAGGAGGGCCAAGG - Intronic
1083916811 11:65751389-65751411 GATCATTAACAAAGGGGCAAAGG - Intergenic
1084412009 11:69010837-69010859 GATCAATTCCAGAGGACCCAAGG - Intronic
1085036051 11:73300730-73300752 GGTCATTCAGAGAGGGGCAATGG + Intergenic
1085192907 11:74644417-74644439 GCTAATTTACAGAGCTGCCAGGG - Intronic
1087863796 11:103197807-103197829 GATCATCTCCAGAAGGGCAAAGG - Intronic
1088320598 11:108551125-108551147 CCTCATTTACAGAGAGGACATGG + Intronic
1089378706 11:118012720-118012742 AATCAAGTACAGAGGGGGCAGGG + Intergenic
1089407487 11:118210454-118210476 GCTTACTTAAAGAGGGGCCAAGG - Intronic
1089808062 11:121109342-121109364 GATCTATTACAGAGAGACCATGG + Exonic
1090794169 11:130120213-130120235 GATTAATTACAAAGGGGCAAAGG - Intronic
1093355844 12:18165876-18165898 AGTCATTTACAGAGGTGACAGGG + Intronic
1095865518 12:46967449-46967471 ATTCTTTTAGAGAGGGGCCAGGG - Intergenic
1096196351 12:49651308-49651330 GATCAGTGACACAGGGGCCAAGG + Intronic
1099813633 12:87618443-87618465 GCTCATGAACAGAGTGGCCAAGG - Intergenic
1102559243 12:113750325-113750347 GACCATTCACAGAAGGGACATGG - Intergenic
1107390961 13:39963791-39963813 AGTCATTTACAGAGAGGCCCAGG + Intergenic
1108397020 13:49999291-49999313 GGTGATTTACATAGGGCCCAGGG - Intronic
1110009934 13:70319717-70319739 GATCATTGACAAAGGAGCAAAGG - Intergenic
1110361272 13:74628501-74628523 TATCATTAACATAGAGGCCAAGG - Intergenic
1112395266 13:99024246-99024268 TCTAATTTACAGTGGGGCCATGG - Intronic
1112606466 13:100911512-100911534 ACTCATTTAGGGAGGGGCCAGGG - Intergenic
1113567459 13:111327390-111327412 AACAACTTACAGAGGGGCCAGGG + Intronic
1116226683 14:42162337-42162359 GATCATAAACAAAGCGGCCATGG - Intergenic
1116946897 14:50844180-50844202 GATCATTTACCAAAGGGTCAGGG - Intergenic
1118956325 14:70485262-70485284 GATCCTTGACAAAGGTGCCAAGG + Intergenic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1123121279 14:105918201-105918223 GACCACTTACACACGGGCCAGGG - Intronic
1123150984 14:106181609-106181631 GGCCATTGACAGAGGGGCCGTGG + Intergenic
1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG + Intergenic
1123404005 15:20009865-20009887 GACCACTTACACATGGGCCAGGG - Intergenic
1123513344 15:21016511-21016533 GACCACTTACACATGGGCCAGGG - Intergenic
1128643461 15:69357861-69357883 AATCATTTGCTGAGGGCCCAGGG + Intronic
1129954984 15:79628092-79628114 GATGATTGAGAGTGGGGCCAAGG + Intergenic
1131551519 15:93361183-93361205 GCGCATTTCCAGAGGGACCAGGG + Intergenic
1136987775 16:35127183-35127205 GATCATTTACAGAAGTTACATGG + Intergenic
1137856477 16:51799308-51799330 GACCATTTTCAGAGGGCACAGGG + Intergenic
1144580638 17:16457143-16457165 GAGCAGTTACAGAGGTGCCTGGG - Intronic
1150094683 17:62363381-62363403 GCGGATTTACAGAGGGGTCATGG - Intergenic
1157300863 18:46478027-46478049 GATCATTTATAGATGAGCAAGGG - Intronic
1164720579 19:30429005-30429027 CATGATTCAGAGAGGGGCCAGGG + Intronic
1165245799 19:34497795-34497817 GATGGTCTGCAGAGGGGCCAGGG + Intronic
926018296 2:9473799-9473821 GATGAGTAACAGAAGGGCCAGGG - Intronic
928434954 2:31248910-31248932 GCTCATTTGAAGAGGAGCCAGGG + Intronic
928765804 2:34644236-34644258 GACCATTTACAGAGATGTCATGG + Intergenic
935209513 2:100926613-100926635 AATGATTTAAAAAGGGGCCATGG - Intronic
936039423 2:109138555-109138577 GATCTTTTAGAGAGGGGTCAGGG + Intronic
936818846 2:116493512-116493534 CATCATTTACTGTGTGGCCATGG + Intergenic
939788565 2:146545298-146545320 GATCATGAACAAAGTGGCCATGG - Intergenic
941629977 2:167873437-167873459 AACTATTTACAGAGGAGCCAAGG + Exonic
944437554 2:199706415-199706437 GAGCATTAACAGAGTGCCCAAGG - Intergenic
944767071 2:202874701-202874723 GGTCAGTGACAGTGGGGCCATGG + Intergenic
946693578 2:222329576-222329598 GATCTTTGACAGGGGTGCCAAGG - Intergenic
946921911 2:224589245-224589267 GAACATTTCCAGAGCTGCCAGGG - Intergenic
1169592025 20:7154850-7154872 AATCATTTACAGTGGGCCAATGG - Intergenic
1170075051 20:12410237-12410259 GATCATTTACAGACGTGCTCAGG + Intergenic
1170665795 20:18384931-18384953 GATGATTTTAAGAGGGGCCTTGG - Intronic
1171438456 20:25141960-25141982 GATCATGTCCTGTGGGGCCAGGG - Intergenic
1175047293 20:56119038-56119060 GATCACATGCACAGGGGCCAGGG + Intergenic
1175667534 20:60873099-60873121 GGGCATTTACACAGGGCCCATGG - Intergenic
1182962384 22:34488046-34488068 GATCATTTGCTGATGAGCCAGGG + Intergenic
950843497 3:15990481-15990503 GATCTTTGACAGAGGAGCAAAGG - Intergenic
952305005 3:32137867-32137889 GATCATTTACAGAGGGGCCATGG + Intronic
953274719 3:41483687-41483709 GATCATATTCACAGGGTCCAGGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953873898 3:46653273-46653295 GATTTTTTACAGAGGAGCAAAGG + Intergenic
956580651 3:70808518-70808540 GATCATTACCAGAGAGGCCAGGG + Intergenic
958964125 3:100539312-100539334 GATCTTTGACAAAGGGGCAAAGG + Intronic
959499960 3:107095239-107095261 GATCTTTGACAGAGGAGCAAAGG + Intergenic
963731511 3:148978396-148978418 GATCTTTGACAAAGGGGCAAAGG - Intergenic
965259810 3:166467628-166467650 GCTCATGTAAAGAGTGGCCATGG + Intergenic
969352625 4:6606494-6606516 GGGCATGTACAGAGGGGGCATGG - Intronic
969960059 4:10935516-10935538 TATCATTTACATAGTGTCCATGG + Intergenic
972105094 4:35474886-35474908 GATCATTGACAGGAGGGCAATGG - Intergenic
972915969 4:43880273-43880295 GATCTTTGACAGAGGAGCAAAGG + Intergenic
973651413 4:53000545-53000567 GATTGTGTACAGAGGAGCCAGGG + Intronic
973883107 4:55293501-55293523 GAGCAACTTCAGAGGGGCCAAGG - Intergenic
974795222 4:66740412-66740434 AATCAGTGATAGAGGGGCCAAGG - Intergenic
977086798 4:92610090-92610112 GATCCTATACAGAGGGCCAATGG + Intronic
977374853 4:96189131-96189153 GATCTTTTACAAAGGAGCAAAGG - Intergenic
979015870 4:115433038-115433060 GATGATTAAAAGTGGGGCCAAGG + Intergenic
979749924 4:124266634-124266656 CATCATTGACAGAGGAGCAAAGG + Intergenic
980789772 4:137605313-137605335 GATCATTTGCACATGGGCCCTGG - Intergenic
987977727 5:25036419-25036441 AATAATTTAGAAAGGGGCCAAGG - Intergenic
988196475 5:28012029-28012051 GATGATTTACATAGGGTCCAGGG - Intergenic
991319740 5:65358740-65358762 GATCTTTGACAAAGGTGCCAAGG + Intronic
991441388 5:66653608-66653630 TGTCATTTCCAGATGGGCCAGGG + Intronic
993242032 5:85402599-85402621 GATTTTTGACAGAGGGGCAAAGG + Intergenic
994851759 5:105063969-105063991 AAACATTAACAGAGGGTCCAAGG + Intergenic
995699815 5:114922466-114922488 GATCTTTGACAAAGGGGCAAAGG + Intergenic
996043000 5:118837648-118837670 TATAATTTACTGAGAGGCCAAGG + Intronic
997230874 5:132242086-132242108 TTTGATTTACACAGGGGCCAGGG - Intronic
997999404 5:138611696-138611718 GATGCTTTTCAGAGGGGTCATGG + Intronic
1003502291 6:6712571-6712593 GAACATTTTCAGAGGGACCCAGG - Intergenic
1004247494 6:13993875-13993897 GATCTTTCACAGAGGAGCAAAGG - Intergenic
1004514790 6:16313310-16313332 GTTCAGTTACAGAGGTGCGAGGG + Intronic
1005228178 6:23667312-23667334 GATCATTGACAAAGGGGCAAAGG - Intergenic
1005519902 6:26590591-26590613 GATTTTTGACAGAGGTGCCAAGG - Intergenic
1006307339 6:33231642-33231664 GATCAGTGACAGAGGTGCCCAGG + Intergenic
1009930289 6:70169253-70169275 GAACTTTTACAGAGGCTCCATGG - Intronic
1015132895 6:129834371-129834393 TATCATTTACAAAGGGACCTTGG - Intronic
1019941051 7:4291445-4291467 GACCATGTACAGAGGAGACAAGG - Intergenic
1020098090 7:5379648-5379670 GAACACTCAAAGAGGGGCCAGGG - Intronic
1020415431 7:7940713-7940735 GATCATTTACAGAGGGTTTAGGG + Intronic
1022942426 7:35253722-35253744 GAGCAGTCACAGCGGGGCCAGGG + Exonic
1023092183 7:36627692-36627714 GAACATCTGAAGAGGGGCCATGG - Intronic
1024257895 7:47551949-47551971 GTGCATTTGCAGAGAGGCCAAGG - Intronic
1029312079 7:99676768-99676790 GTTCATTCACAGAGAGGCCTTGG + Intronic
1032428377 7:131840347-131840369 GAACTTTTAGAGAGGGGGCAGGG + Intergenic
1033758986 7:144420646-144420668 AATCTTTTCCAGAGGGACCAGGG - Intergenic
1035918211 8:3648710-3648732 GATCATTTACAGAAGTTACATGG + Intronic
1038230220 8:25692688-25692710 GCTCATTTAAAAAGGTGCCAAGG + Intergenic
1038248784 8:25883591-25883613 GATAATTTAAAGTGTGGCCAAGG + Intronic
1039924946 8:41921206-41921228 GATCTTTGACAAAGGGGCAAAGG + Intergenic
1042648641 8:71014650-71014672 GATCATATACACAGGTCCCAGGG + Intergenic
1042657774 8:71119325-71119347 GATCTTTAACAAAGGGGCAAAGG - Intergenic
1044146702 8:88724978-88725000 GAGCATTAACAGAGTGACCATGG + Intergenic
1044650538 8:94489850-94489872 TATCATATACAGAGGGGGCTAGG - Intronic
1047395862 8:124498423-124498445 AAACATTTACACAGGGGCCGGGG - Intronic
1048124576 8:131619262-131619284 GATCATTGACAAAGGAGCAAAGG - Intergenic
1051383867 9:16485937-16485959 GACCATTTACAGAGAGGAAAAGG + Intronic
1053290228 9:36874844-36874866 TATTATTTACACAGGGGCCTGGG - Intronic
1057269679 9:93643818-93643840 GGCCATTTACAGAGGGCCCACGG - Intronic
1059697126 9:116740037-116740059 GAGCTTGGACAGAGGGGCCAGGG + Intronic
1061802303 9:133119316-133119338 GACCATTTACCAAGGGCCCAAGG - Intronic
1062026323 9:134342340-134342362 CCTCATTTACAGAGGGGGCCTGG + Intronic
1185956222 X:4493823-4493845 CATCTTTTACGGAGGGTCCACGG + Intergenic
1186543807 X:10427745-10427767 CATCATTTATAAAGTGGCCATGG - Intergenic
1187076978 X:15945173-15945195 CATCTTTTACAGAGGGTCCATGG - Intergenic
1188343168 X:29030023-29030045 GATCTTTGACAAAGGGGCAAAGG - Intronic
1190318698 X:49166670-49166692 GCTCCTTTACAGAGTGGCCCGGG - Intronic
1192824596 X:74682028-74682050 GCTCATTTACAAAGTGGTCATGG + Intergenic
1193141652 X:78034116-78034138 GATAATTTGCAGAGGGACAAAGG - Intronic
1193252000 X:79301897-79301919 TATCATTTATAGAGGGTCAATGG + Intergenic
1193656570 X:84205605-84205627 GGGCATTTAGAGAAGGGCCAGGG - Intergenic
1194105555 X:89762723-89762745 GTTGATTTACATAGGGCCCAGGG + Intergenic
1196806624 X:119593724-119593746 GATTATTGACAAAGGTGCCAAGG + Intronic
1200457519 Y:3410548-3410570 GTTGATTTACATAGGGCCCAGGG + Intergenic