ID: 952309231

View in Genome Browser
Species Human (GRCh38)
Location 3:32172481-32172503
Sequence GTAGAATCCTGGCTGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952309231_952309242 29 Left 952309231 3:32172481-32172503 CCCCTTTTCAGCCAGGATTCTAC No data
Right 952309242 3:32172533-32172555 CACATTGGTCTGTGATTGATAGG No data
952309231_952309236 14 Left 952309231 3:32172481-32172503 CCCCTTTTCAGCCAGGATTCTAC No data
Right 952309236 3:32172518-32172540 AAAGTACCCCCCAATCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952309231 Original CRISPR GTAGAATCCTGGCTGAAAAG GGG (reversed) Intergenic
No off target data available for this crispr