ID: 952324911

View in Genome Browser
Species Human (GRCh38)
Location 3:32312487-32312509
Sequence CTGCCCACATGCCTTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 2, 2: 5, 3: 48, 4: 359}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952324911_952324917 -9 Left 952324911 3:32312487-32312509 CCCAGGGCAAGGCATGTGGGCAG 0: 1
1: 2
2: 5
3: 48
4: 359
Right 952324917 3:32312501-32312523 TGTGGGCAGGGGTGTGGAGCAGG 0: 1
1: 2
2: 8
3: 119
4: 903
952324911_952324919 13 Left 952324911 3:32312487-32312509 CCCAGGGCAAGGCATGTGGGCAG 0: 1
1: 2
2: 5
3: 48
4: 359
Right 952324919 3:32312523-32312545 GAGCTGTGTCCCCATGGAGTTGG 0: 1
1: 0
2: 4
3: 34
4: 681
952324911_952324922 16 Left 952324911 3:32312487-32312509 CCCAGGGCAAGGCATGTGGGCAG 0: 1
1: 2
2: 5
3: 48
4: 359
Right 952324922 3:32312526-32312548 CTGTGTCCCCATGGAGTTGGGGG 0: 1
1: 0
2: 4
3: 43
4: 263
952324911_952324921 15 Left 952324911 3:32312487-32312509 CCCAGGGCAAGGCATGTGGGCAG 0: 1
1: 2
2: 5
3: 48
4: 359
Right 952324921 3:32312525-32312547 GCTGTGTCCCCATGGAGTTGGGG 0: 1
1: 0
2: 4
3: 52
4: 245
952324911_952324920 14 Left 952324911 3:32312487-32312509 CCCAGGGCAAGGCATGTGGGCAG 0: 1
1: 2
2: 5
3: 48
4: 359
Right 952324920 3:32312524-32312546 AGCTGTGTCCCCATGGAGTTGGG 0: 1
1: 0
2: 2
3: 33
4: 295
952324911_952324918 7 Left 952324911 3:32312487-32312509 CCCAGGGCAAGGCATGTGGGCAG 0: 1
1: 2
2: 5
3: 48
4: 359
Right 952324918 3:32312517-32312539 GAGCAGGAGCTGTGTCCCCATGG 0: 1
1: 0
2: 2
3: 39
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952324911 Original CRISPR CTGCCCACATGCCTTGCCCT GGG (reversed) Intronic
900165461 1:1242708-1242730 CTGCCCACCTGCCCTGCGCTAGG + Intronic
900371794 1:2335515-2335537 CCACCCACCTGCCTTGCCCAAGG + Intronic
900687117 1:3955643-3955665 TTTCCCACAGGCCATGCCCTGGG + Intergenic
901112552 1:6810125-6810147 CTGCCCAAATGCCTGACCCATGG - Intronic
902634122 1:17724067-17724089 CAGCCCACTGGCCTTGACCTTGG + Intergenic
902691390 1:18111881-18111903 CTACTCACATGCCCTGCCCAAGG - Intronic
903158930 1:21470747-21470769 CTGCCCACCTGCCTGACCCCAGG - Intronic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903468038 1:23566218-23566240 CTGCCCAAATGTGTTGGCCTAGG + Intergenic
904291563 1:29489091-29489113 CTGCCCACATGCATGTCCCAAGG - Intergenic
904482919 1:30805390-30805412 CTGCCCCCAACCTTTGCCCTGGG - Intergenic
904880987 1:33696725-33696747 CTGCCCACCTGCCAGGCCCCAGG - Intronic
904924756 1:34038722-34038744 CTGACCACTTCCTTTGCCCTTGG - Intronic
905278716 1:36835529-36835551 TTCTCCACATCCCTTGCCCTTGG + Intronic
906132317 1:43468055-43468077 CTCCACACCTGGCTTGCCCTTGG - Intergenic
907562491 1:55403546-55403568 CTGCCCACAGGCCTTTCTCAGGG - Intergenic
908480529 1:64534864-64534886 CAGCCCCCTGGCCTTGCCCTTGG + Intronic
909501449 1:76339363-76339385 CTTCCCACATGCCTGGCTCATGG - Intronic
910398255 1:86812847-86812869 CTGCCCCCAGGCCTGGCCCATGG - Intergenic
912044607 1:105438055-105438077 CTGCTCACCTGGCTTACCCTTGG + Intergenic
912966023 1:114238290-114238312 CAAGCCACATGCCTTGGCCTGGG + Intergenic
913543302 1:119842399-119842421 CTGCCCACCTGCCTGTCCCACGG + Intergenic
914858577 1:151369379-151369401 CTGCCCTCATCCCTGGCCCTGGG - Intronic
914921959 1:151853337-151853359 CTGCCCACCTGCCCTGGCCATGG + Intronic
915129692 1:153687940-153687962 CCGCCCCCATGCCTTGGTCTTGG + Intronic
915283067 1:154835986-154836008 CTGTCCCCATGCCTGGCCATGGG - Intronic
916433569 1:164755867-164755889 CTGCCAACATGGCTTTCTCTGGG + Intronic
918742236 1:188147150-188147172 CTGCCCTCATTCCTTGCTCTTGG + Intergenic
919283422 1:195520932-195520954 CTGACCACATGCTCTGCCATAGG + Intergenic
919946744 1:202324939-202324961 CTGCCCACAGCCCTTGCACAAGG - Intergenic
920034872 1:203059316-203059338 CTACCCACTTCCCTTCCCCTGGG + Intronic
920089479 1:203441980-203442002 CTGCTCACTTTCCCTGCCCTCGG - Intergenic
920156848 1:203958876-203958898 CTGACCGCATGATTTGCCCTCGG - Intergenic
920209157 1:204315504-204315526 GTGTCCACCTGCCTTCCCCTGGG - Intronic
920519279 1:206611662-206611684 CTGACTTCATGCCTAGCCCTTGG + Intronic
921097938 1:211902780-211902802 CTGCACACCTGGCTCGCCCTTGG + Intergenic
921153568 1:212420562-212420584 CTGTCCACATGCACTTCCCTTGG + Intergenic
921257321 1:213354397-213354419 CTGCTCACCTGCCCTGACCTGGG + Intergenic
921476551 1:215617157-215617179 CTTCCCACACACCTTACCCTGGG + Intronic
921701792 1:218276776-218276798 CTGACCACCTGCCTTCCCATTGG + Intergenic
922551277 1:226496446-226496468 CTGCACATTTGCCGTGCCCTTGG + Intergenic
922579450 1:226686126-226686148 TGGCCCACATGGCTTTCCCTTGG - Intronic
922758290 1:228108926-228108948 ATGCCCACATCCCTCTCCCTCGG + Intronic
923039534 1:230309779-230309801 CTGCCCAGAAACCTTGCTCTAGG + Intergenic
923075218 1:230603523-230603545 CTGCAGACATTCCTTGGCCTGGG - Intergenic
923685370 1:236149715-236149737 CTGAGCACAGTCCTTGCCCTTGG - Intronic
923809181 1:237293709-237293731 CTTCCCACATTTCCTGCCCTAGG - Intronic
924628887 1:245718504-245718526 CTGTGCACATGCCTTGAGCTGGG + Intergenic
1063349246 10:5338798-5338820 CAGCCCCCATGTCTTGACCTTGG - Intergenic
1063434300 10:6018152-6018174 CTGCCCCCATGCCAAGCCCAGGG - Intronic
1063493416 10:6485901-6485923 CTGAGCACCGGCCTTGCCCTTGG - Intronic
1064433377 10:15290290-15290312 CTGACCCCATCCCCTGCCCTCGG + Intronic
1065408324 10:25392334-25392356 CTCCACACTTGGCTTGCCCTTGG + Intronic
1067059592 10:43071097-43071119 CTGCACACATGCCTTGAGTTTGG + Intergenic
1067137509 10:43624448-43624470 CTTCCCACATGCCTCACCCTAGG - Intergenic
1067204705 10:44202800-44202822 CTACCCACTTACCTTGCCTTAGG + Intergenic
1067472730 10:46548291-46548313 TTGCCCACATGACCTGACCTAGG - Intergenic
1067514577 10:46927056-46927078 CTGCATACAAGCCTGGCCCTTGG - Intronic
1067647683 10:48124757-48124779 CTGCATACAAGCCTGGCCCTTGG + Intergenic
1067741073 10:48896613-48896635 CTGTCCTCATGCCTTGCCAGCGG + Intronic
1069121942 10:64577746-64577768 CTCCACACCTGGCTTGCCCTTGG + Intergenic
1072729084 10:97832697-97832719 CTGCATACAGGGCTTGCCCTGGG - Intergenic
1072977814 10:100074440-100074462 CTGCCCACATCCTTTGCAGTAGG - Intronic
1073753368 10:106555115-106555137 ATGCCCATATGCCTGGCCCAAGG + Intergenic
1073915355 10:108396940-108396962 CTTCTCTCATGCCTTGCCCTAGG - Intergenic
1073993369 10:109289069-109289091 CAGCAAACAAGCCTTGCCCTGGG + Intergenic
1074535866 10:114328384-114328406 CTGCACAGCTGCCTGGCCCTGGG - Intronic
1075100181 10:119501118-119501140 CTGCCCTCCTCCCTTGCCCCAGG + Intronic
1075463303 10:122632727-122632749 CTGGACACAGGCCTTGCCCTTGG - Intronic
1075689902 10:124387713-124387735 CTGGGCACCAGCCTTGCCCTTGG + Intergenic
1075899034 10:126023501-126023523 CTGCCCATATGTCTTGACCTTGG - Intronic
1075906113 10:126083392-126083414 CTGCCCAGAGGCCCTGCCCTGGG - Intronic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1077262580 11:1630601-1630623 CTGCCCAGCTTCCTTGCCCTGGG + Exonic
1077300478 11:1844300-1844322 CTGCCCACAACCCCTGCCCTGGG - Intergenic
1077399025 11:2343970-2343992 CTGCGCACCTGCCTTGCCCAAGG - Intergenic
1077420499 11:2447783-2447805 CTGCACACATGCCTGGGCCCTGG - Intronic
1077468997 11:2748099-2748121 CTGGCCACAAGCCCAGCCCTGGG - Intronic
1077506499 11:2932099-2932121 CTGCCCACAGTCCCTGCCCCAGG + Intergenic
1078021253 11:7657484-7657506 CTCCTCCCAGGCCTTGCCCTTGG + Intergenic
1078326493 11:10385751-10385773 CTGCCCGCTTTCCTGGCCCTTGG - Intronic
1078328463 11:10399069-10399091 CTTCCCACATCTCTTGCCTTAGG - Intronic
1079092481 11:17490893-17490915 CAGCCCACCTGCCTTCCCCAGGG + Intergenic
1079695272 11:23474632-23474654 CTTCCCACATACTTTGCCCCAGG + Intergenic
1080135264 11:28846564-28846586 TTGACCACATGCCATGCACTGGG + Intergenic
1081044001 11:38249846-38249868 CTCCACACCTGTCTTGCCCTTGG - Intergenic
1083630170 11:64091187-64091209 CTGCCCACTTCCCTTGCCCCAGG - Intronic
1083651774 11:64208365-64208387 TTACCCTCATGCCGTGCCCTGGG - Intronic
1083996728 11:66276659-66276681 CTGGCCACATTCCTCGCCCTGGG - Exonic
1084164161 11:67367249-67367271 CTGCCCACATGCCTAGTCCTGGG + Intronic
1084327840 11:68411956-68411978 CTGAGCACATGACTTGCCTTAGG + Intronic
1084427283 11:69091829-69091851 CCACCCACATTCCTTGCCATAGG + Intergenic
1085776415 11:79370519-79370541 CTGCCTAGTTGCCTTCCCCTTGG + Intronic
1086305325 11:85473153-85473175 CGGCACACCTGGCTTGCCCTTGG + Intronic
1090237308 11:125158780-125158802 CTGCCCACAACCCCTGCCCAGGG - Intergenic
1090429803 11:126636215-126636237 CTTAGCACATGCCATGCCCTGGG - Intronic
1090669877 11:128938668-128938690 CTGCCCACATCGCTTCCCCAGGG + Intronic
1090876277 11:130791568-130791590 CCGCACACATGCCCTGACCTTGG - Intergenic
1091563571 12:1631663-1631685 CTGTCCACATTCCTTTTCCTTGG + Intronic
1097624704 12:61985975-61985997 CAGCCCACAACCATTGCCCTTGG + Intronic
1097967168 12:65593768-65593790 CTGCACACATGCACTGCACTGGG - Intergenic
1099003257 12:77206148-77206170 CTGGCCACATGACTTGGCCCTGG + Intergenic
1099931853 12:89084294-89084316 CTGCACTCATGCTTTGCCCCTGG - Intergenic
1100672694 12:96834419-96834441 CTCCACACCTGACTTGCCCTTGG - Intronic
1101842028 12:108334587-108334609 CTTCCCTCATGCCCAGCCCTGGG + Intronic
1103859567 12:124001513-124001535 CTCCACGCATGCCTTTCCCTCGG + Intronic
1105307107 13:19176799-19176821 ATGCCCACATGCCTAGCCCATGG + Intronic
1105480343 13:20769554-20769576 CTGAGCCCATGCCTTTCCCTGGG - Intronic
1105796249 13:23856441-23856463 CAGCCCACAAGCCTGGCTCTGGG - Intronic
1107470846 13:40689783-40689805 CTGCCCACAGCCCCTGCTCTGGG + Intergenic
1109426356 13:62169165-62169187 CTCCACACCTGGCTTGCCCTTGG + Intergenic
1110789191 13:79568652-79568674 CAGGCTACATGCCCTGCCCTTGG - Intergenic
1111706906 13:91761669-91761691 CTTGCCCCATACCTTGCCCTAGG - Intronic
1112203699 13:97303155-97303177 CTGCCCACATGTCCTTCACTGGG - Intronic
1113433936 13:110274460-110274482 CTGGCCGCATTCCTTGCCTTTGG + Intronic
1115889162 14:38007832-38007854 CTTCCCACATGACTTGTCATTGG - Intronic
1116152499 14:41158983-41159005 CTTCCTGCATGCCTTGCCTTTGG + Intergenic
1117828297 14:59726407-59726429 AGGCCCAAATCCCTTGCCCTTGG + Intronic
1118036941 14:61877966-61877988 CTGCCAGTATACCTTGCCCTGGG + Intergenic
1118234875 14:63993125-63993147 CTGCCAACATGAGTGGCCCTGGG + Intronic
1118597219 14:67445109-67445131 CTGAACGCATGTCTTGCCCTTGG + Intergenic
1118889913 14:69900200-69900222 CTTCCCACATGGCTGGCTCTAGG - Intronic
1119078003 14:71663788-71663810 CTGCCCACATGTCTTGAGCAGGG - Intronic
1119102293 14:71891232-71891254 CTTCCCAAATTCCTGGCCCTGGG - Intergenic
1119201074 14:72753359-72753381 CTGTCCACAGGCCTTGCCCCGGG - Exonic
1119842488 14:77803737-77803759 CCTCCCACATGCCTGGCACTGGG + Intronic
1120902331 14:89586657-89586679 CTGCCCGCATCCCCTGCACTGGG - Intronic
1121089943 14:91174232-91174254 CTTCCCCCACACCTTGCCCTGGG + Intronic
1121465336 14:94111960-94111982 CTGGCCAGATGCCCAGCCCTGGG + Intronic
1122024081 14:98862169-98862191 CTGCCCAGATGACTTGGCCGGGG + Intergenic
1124247481 15:28083433-28083455 CTGCCGACATGGCCTGCCTTCGG - Intronic
1125499448 15:40230056-40230078 CCTCCCATGTGCCTTGCCCTGGG - Intergenic
1125862204 15:43009437-43009459 CTCCACACCTGGCTTGCCCTTGG + Intronic
1126780812 15:52137612-52137634 CTGTCCCCATGTCTTTCCCTGGG - Intronic
1128945918 15:71820710-71820732 GTGCCCACAGGCATTGTCCTAGG - Intergenic
1129360372 15:75020509-75020531 CTGCCTACAGGCCTTGGTCTTGG + Exonic
1129380821 15:75165002-75165024 CACCCCACATACCTTGACCTAGG + Intergenic
1129689929 15:77707452-77707474 ATGGCCACATGGCTTGCCCAAGG + Intronic
1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG + Intronic
1130543964 15:84841106-84841128 CTGCCCACATGCCTGGCATCTGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132314260 15:100879287-100879309 CTGCGCACGTGCCCTGCTCTTGG - Intronic
1132784040 16:1644631-1644653 CTTCCCACCTTCCTTTCCCTGGG - Intronic
1133219148 16:4311473-4311495 CTGACAACATGCCAGGCCCTGGG + Intergenic
1133717764 16:8465861-8465883 CTGTGCCCATGCCTTGCTCTAGG - Intergenic
1136748633 16:32614035-32614057 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1137044081 16:35640027-35640049 CTGCTCCCTTGCATTGCCCTAGG - Intergenic
1138380751 16:56600724-56600746 CAGCCTACGTGCCTTGGCCTGGG - Intergenic
1138436680 16:57004687-57004709 CAGCCCACAGGCCTTTGCCTTGG - Intronic
1139421983 16:66854692-66854714 CTGCACACTTGCCCTTCCCTTGG - Intronic
1139447475 16:67006735-67006757 CTGCCCCCAGGCCTTTCCATGGG + Intronic
1140144526 16:72293614-72293636 CTGACAACATGCCTTGCCTTTGG + Intergenic
1140902412 16:79381578-79381600 CTCCCCCCATTCCTGGCCCTGGG + Intergenic
1141148300 16:81547287-81547309 CTGCACACACCCCATGCCCTCGG - Intronic
1141423124 16:83930154-83930176 GTGCCCACAGGCCTGGCCCCGGG + Intronic
1141615040 16:85205659-85205681 CTGCCCATCTCCCCTGCCCTGGG + Intergenic
1203050766 16_KI270728v1_random:873249-873271 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1144684792 17:17218936-17218958 CTGCCCACACGCCTTGCCTCTGG - Intronic
1146347349 17:32068632-32068654 CTGCCCCCTTCCCTGGCCCTTGG + Intergenic
1146354222 17:32120423-32120445 CTCCACACATGCATGGCCCTGGG + Intergenic
1146542552 17:33710169-33710191 CTTGCCACATGGCTTGCCGTTGG - Intronic
1146673377 17:34756989-34757011 CTTCCTCCACGCCTTGCCCTTGG - Intergenic
1146907937 17:36629861-36629883 TTGGCCATCTGCCTTGCCCTTGG + Intergenic
1146934621 17:36805076-36805098 CTGCCCCCAAGCCTGGCCCTGGG + Intergenic
1147170107 17:38613411-38613433 CTCCCCACATGCCAGGCCCTGGG + Intergenic
1147443005 17:40458785-40458807 ATCCCCACAGGCCTTGGCCTGGG - Intergenic
1148086010 17:44994247-44994269 CTGCCCTCATGTCTTCCTCTAGG - Intergenic
1149256743 17:54836172-54836194 CTCCACACCTGGCTTGCCCTTGG - Intergenic
1149638215 17:58186796-58186818 CTTCCCACATGCCCAGCCCTGGG + Intergenic
1149651290 17:58278177-58278199 CTGGGCACCTTCCTTGCCCTCGG - Intronic
1150144352 17:62755292-62755314 CTTCCCACATGTCTGGCCCTAGG + Intronic
1150316831 17:64175915-64175937 CTACCCATATGCCTTGACCTGGG + Intronic
1151930317 17:77228024-77228046 CTGCCCACATTCTCTGCCCTGGG + Intergenic
1152258059 17:79251827-79251849 CTGCCCACCTGCTTCTCCCTCGG + Intronic
1152388613 17:79989948-79989970 CTGCACACAGGCCTGCCCCTGGG - Intronic
1152483608 17:80573952-80573974 CTGCCCACATGCCTGGGTCGGGG + Intronic
1153759870 18:8320189-8320211 CTGCCCCCATGCCTAACCTTTGG - Intronic
1154045896 18:10904532-10904554 GTGCCCACAGGCCTTGGGCTTGG + Intronic
1155554317 18:27001340-27001362 CTGCTCACATTCCATGCCCAAGG + Intronic
1155584169 18:27345697-27345719 CTGCCAGCTTGCCTTACCCTTGG + Intergenic
1155830749 18:30512979-30513001 CTGCACACCTGGCTTGCCCTTGG - Intergenic
1159782438 18:72675664-72675686 CTGCCCACATTCCTCGCTCACGG + Intergenic
1159782446 18:72675709-72675731 CTGCCCACATTCCTCGCTCAGGG + Intergenic
1159782461 18:72675799-72675821 CTGCCCACATTCCTCGCTCAGGG + Intergenic
1160451907 18:78972077-78972099 TTGCCCACATGCCTGGACCTTGG - Intergenic
1160608090 18:80067203-80067225 CTGCTCACCTGCCTAGGCCTGGG + Intronic
1160717140 19:581609-581631 CTGCCCACATGCCCTGCTCTCGG + Intronic
1161465173 19:4425703-4425725 CTGCACACATGCATTCCTCTGGG + Intronic
1163131577 19:15276776-15276798 GTCCTAACATGCCTTGCCCTAGG + Intronic
1163237390 19:16037593-16037615 CTGCACACACCCCTTGCTCTGGG - Intergenic
1163748488 19:19061731-19061753 GTGCCCACCTGCCAGGCCCTGGG - Intergenic
1164573526 19:29391438-29391460 TTGCCCTCTTGCCTTGCACTTGG - Intergenic
1164574519 19:29397923-29397945 TGGGCCACATGCCGTGCCCTGGG - Intergenic
1165050721 19:33139853-33139875 CTGCCCAGTTGTCATGCCCTTGG - Intronic
1165068717 19:33243054-33243076 CTGCCCTAATGCCTTTCCCTGGG - Intergenic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1165508338 19:36249442-36249464 CTTCCCACATATGTTGCCCTAGG - Intergenic
1165632208 19:37311336-37311358 CTTCCCACATATTTTGCCCTAGG + Intergenic
1165902609 19:39175679-39175701 CTGCCCAGATCCCTGCCCCTGGG - Intronic
1166875673 19:45895804-45895826 CTTCCCACATGTCGTTCCCTGGG + Intronic
1168059784 19:53884377-53884399 TGGCCCAGATTCCTTGCCCTTGG + Intronic
1168082080 19:54017497-54017519 CTGCCCACATTCCTTCTGCTAGG - Intergenic
925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG + Intronic
925843497 2:8013817-8013839 CTGCCCATCTCTCTTGCCCTCGG - Intergenic
926227467 2:10978556-10978578 CAGCCCACAGGGCTTTCCCTGGG - Intergenic
927041365 2:19233989-19234011 CCTCCCACTTGCCTTACCCTAGG + Intergenic
927116912 2:19913673-19913695 CTGCCAACATGCGTTGCCACAGG - Exonic
927198144 2:20562111-20562133 CTTTCCCCATGCCTCGCCCTAGG + Intronic
927509076 2:23633063-23633085 CATCCCACCTGCCTGGCCCTGGG - Intronic
928638010 2:33267248-33267270 CTCCACACCTGGCTTGCCCTTGG + Intronic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
929598547 2:43190962-43190984 CTGCCCACTGTCCTTGCCCATGG - Intergenic
931441935 2:62296263-62296285 CTGACCCCACGCCTTTCCCTGGG - Intergenic
931769683 2:65486815-65486837 GTGCCCACAGGTCTTGCTCTTGG - Intergenic
931802752 2:65774487-65774509 CTGCCCGCGTTCCTTGCCTTGGG + Intergenic
936547537 2:113405437-113405459 CTGCCCACCAGCCTGTCCCTGGG - Intergenic
937239927 2:120453392-120453414 CACCCCACATGCCTGGCCCCAGG + Intergenic
938067754 2:128291308-128291330 TTGCCCACTGCCCTTGCCCTGGG + Intronic
938298491 2:130193665-130193687 ATGCCCACATGCCTAGCCCATGG + Intronic
938458241 2:131480848-131480870 ATGCCCACATGCCTAGCCCATGG - Intronic
939249704 2:139667902-139667924 CTGCTAAGATGCCTTGCACTGGG + Intergenic
939802027 2:146721686-146721708 CTCCGCACCTGGCTTGCCCTTGG + Intergenic
941543465 2:166815907-166815929 CTCCCCACCTACGTTGCCCTAGG + Intergenic
943369560 2:187001371-187001393 CTGCCCACTTCCCCGGCCCTGGG - Intergenic
946927665 2:224641713-224641735 CTAGCCCCATGCCTGGCCCTGGG + Intergenic
947668542 2:231922573-231922595 CTAACCACAGGCCTTGCCCTTGG + Intronic
947699112 2:232217716-232217738 CTTCCCCCATACCTCGCCCTAGG - Intronic
947931500 2:233968595-233968617 CTGGGCACCTGCCCTGCCCTTGG - Intronic
948195284 2:236091080-236091102 CTGCCTGCATGCCCTGTCCTTGG + Intronic
948262042 2:236611708-236611730 CAGCCCTCATGACTTGCCCTGGG - Intergenic
948461982 2:238134235-238134257 CTGCCCACTCGCTATGCCCTTGG + Intergenic
949002462 2:241624090-241624112 CTTCCCACAGCCCTTTCCCTGGG + Intronic
1169191073 20:3659720-3659742 CAGCCTACATCCCTTGCCCCAGG + Intronic
1169340926 20:4795667-4795689 CTGCCCACCTGCCTTAGCCTTGG - Intronic
1169513484 20:6291626-6291648 CTGCCCCCATGCCATGCTCAAGG + Intergenic
1169555289 20:6743118-6743140 CTGCCCAGATGCCTTGCCTTTGG - Intergenic
1170582661 20:17710872-17710894 CTGCCCACACACCCAGCCCTGGG - Intronic
1170646647 20:18202813-18202835 CTGCCCATGTACCTTGCCCAAGG - Intergenic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1172477821 20:35252141-35252163 ATGCCCACATGCCTGGCTCTTGG - Intronic
1173022673 20:39281077-39281099 CTGACCTCTTGCCTTGACCTAGG + Intergenic
1173497420 20:43529603-43529625 ATGCCAACATCCCTGGCCCTCGG - Intronic
1175144450 20:56885116-56885138 CTGCCCACAGGCCTGGGCCCGGG - Intergenic
1175199930 20:57269864-57269886 CTCCACACAAGACTTGCCCTCGG - Intergenic
1175224646 20:57437928-57437950 CCAGCCACATGCCTAGCCCTAGG - Intergenic
1175400280 20:58696297-58696319 CTGCCCACATTCCCTCCCCAGGG + Intronic
1175499765 20:59441514-59441536 CTGCCCACATGGTCTCCCCTTGG + Intergenic
1175814256 20:61875302-61875324 CTGCCCCCATGTGTTACCCTGGG - Intronic
1175908070 20:62391617-62391639 CTGCCCATGCGCCCTGCCCTGGG - Intronic
1175943149 20:62547130-62547152 CTGCCCAGCTGCGGTGCCCTGGG - Intergenic
1175943289 20:62547598-62547620 CGGCCCCCATGCCTGGCGCTGGG + Intergenic
1178774737 21:35539084-35539106 CTGCAGAAGTGCCTTGCCCTTGG + Intronic
1179587818 21:42384842-42384864 GGGACCACATGCCTTGCCCCAGG - Intronic
1179667010 21:42919903-42919925 CTGCCCGGGTACCTTGCCCTGGG + Intergenic
1179809944 21:43864537-43864559 CGGCCCACGTGCCGCGCCCTTGG - Intergenic
1180921339 22:19523092-19523114 GTGCCCACAAGCCTTGCCTGGGG + Exonic
1181307930 22:21927490-21927512 CTGCCCACATTCCTGCCTCTGGG - Intronic
1181319735 22:21995132-21995154 CTGCCCACAGGGCTTGTCCCAGG - Intergenic
1181687741 22:24541287-24541309 CTGCCACCATGCCATGCCTTGGG + Intronic
1181983346 22:26782033-26782055 CTGCCCTCCTTCCCTGCCCTGGG + Intergenic
1181989758 22:26828553-26828575 CTGCCCATATGATTTGCCTTGGG - Intergenic
1182002902 22:26935754-26935776 CTGCCCACTTGCCTGGCACAGGG + Intergenic
1183456498 22:37925908-37925930 CTGGCCACCAGCCCTGCCCTGGG + Exonic
1184038431 22:41929348-41929370 CTGCCCACATGGCTGGCACAAGG - Intergenic
1184118097 22:42433578-42433600 TTGCACACATGCTTTTCCCTGGG + Intergenic
1184118360 22:42434924-42434946 CTGAACACCTGCCCTGCCCTGGG + Intergenic
1185284979 22:49996081-49996103 CTGCCCACAGGACATGCCCAGGG - Exonic
1185419633 22:50728293-50728315 CTCCTCACATCTCTTGCCCTCGG + Intergenic
949776787 3:7642215-7642237 CTACCAACATACCTTGTCCTGGG + Intronic
950554631 3:13687921-13687943 CTGCCTGCATGCCCTGTCCTGGG - Intergenic
950831612 3:15880038-15880060 CTGCCCCCTTCCCTGGCCCTGGG + Intergenic
951169187 3:19519213-19519235 CTGCCCACATGCCCTTGCCTGGG - Intronic
952324911 3:32312487-32312509 CTGCCCACATGCCTTGCCCTGGG - Intronic
954063060 3:48085091-48085113 CTGCCAAGATGCCTTCCACTGGG + Intronic
954372197 3:50174767-50174789 CTCCCCACAACCCTGGCCCTGGG - Intronic
955533877 3:59902780-59902802 TTTCCCCCATGCCTGGCCCTTGG - Intronic
955958819 3:64318124-64318146 CTGACCACATGCCAGGCACTGGG + Intronic
959975291 3:112452218-112452240 CTTCCCATATCCCTAGCCCTAGG - Intergenic
960738285 3:120804298-120804320 CTTCCCACATGCCTTGCCCTAGG - Intergenic
960803361 3:121560364-121560386 CTTCCCACAAACCTTGCCATAGG - Intergenic
960961228 3:123071825-123071847 CTGACGACATGCCAGGCCCTGGG - Intronic
961043714 3:123694733-123694755 CCTGCCCCATGCCTTGCCCTGGG - Intronic
961611383 3:128142675-128142697 CTGCCCACATGCCTGGACTCAGG + Intronic
961653578 3:128429420-128429442 CTGCCCCCATCCCGGGCCCTGGG + Intergenic
962165815 3:133046611-133046633 GTGCCCACATGCATTGTACTAGG - Intronic
962194834 3:133352695-133352717 CCTCCCATATACCTTGCCCTAGG - Intronic
965719006 3:171640724-171640746 CTGAGCACGTGCATTGCCCTGGG + Intronic
965732246 3:171784539-171784561 CTGCACACATGCCATGTCCCAGG + Intronic
966191819 3:177278289-177278311 CTGGCCATATGCCTTGTCTTGGG + Intergenic
966840279 3:184082303-184082325 CTCCACACCTGGCTTGCCCTTGG + Intergenic
966868668 3:184276342-184276364 CTTCCCACCTGCCCTGCTCTCGG - Intronic
967856840 3:194124431-194124453 CTTCCCACGTACCTTACCCTGGG + Intergenic
968164426 3:196452933-196452955 CTCCACACCTGCCTCGCCCTTGG - Intergenic
968698499 4:2043802-2043824 CTGCCCACTGGCATTCCCCTGGG - Intronic
969172714 4:5376845-5376867 CTGGCCCCATGCTCTGCCCTCGG + Intronic
969232341 4:5840400-5840422 CGGGCCACATCTCTTGCCCTTGG - Intronic
969507728 4:7598561-7598583 CAGCCGCCATGCCTTGCCCAAGG - Intronic
972285711 4:37645960-37645982 CTGCCCTCAGGCCCTGCCCTGGG - Intronic
972848411 4:43018225-43018247 CTGCCCTCAGGTCTTTCCCTTGG - Intronic
974381509 4:61146489-61146511 CTGCCCACAAGCCTTCTCCATGG + Intergenic
976089569 4:81442152-81442174 CTACCCACTTTCCTTTCCCTGGG + Intronic
979488523 4:121297009-121297031 CTGCTCCCATGCCCAGCCCTTGG - Intergenic
979961834 4:127029796-127029818 TTGCCCACATTCTTTGCCTTGGG - Intergenic
984760256 4:183357243-183357265 CTGGCCACATGCCTGACCTTGGG + Intergenic
986043603 5:4016782-4016804 CTGCCCACCTGGCCTGCACTAGG - Intergenic
986343279 5:6811128-6811150 CTTCCCACAGGCCTTGGCATAGG + Intergenic
987537817 5:19209795-19209817 CTCCATACCTGCCTTGCCCTTGG + Intergenic
988081040 5:26416059-26416081 CTCCACACCTGGCTTGCCCTTGG - Intergenic
990587436 5:57225789-57225811 CTGTCCACATGCTTTGAACTTGG + Intronic
991281398 5:64918262-64918284 CTGCCTTCCTGCCTAGCCCTTGG - Intronic
991404023 5:66284162-66284184 CTGCCCAAATGCCTTACCTGTGG - Intergenic
994039492 5:95242731-95242753 CTGCCTTCATCCCTTTCCCTAGG - Intronic
996633302 5:125663239-125663261 CTGCCCCCTTGCCTTGCCTTTGG - Intergenic
998353530 5:141516191-141516213 CTGCCCACAGGCTCTGGCCTGGG + Exonic
998390531 5:141784383-141784405 CTGTCCACTTCCCTAGCCCTTGG - Intergenic
999160522 5:149492737-149492759 TTACCAACATGCCTTGCCTTGGG + Intronic
999282096 5:150372638-150372660 CAGCCCCCCTGTCTTGCCCTTGG - Intronic
1001227506 5:169957836-169957858 CTCCCCACCTGCATTGCCTTAGG + Intronic
1001557626 5:172647326-172647348 CTGCACACCTGCCCTGCACTAGG + Intronic
1001966447 5:175913230-175913252 CTGCCCAGATGCTTTTCCCTTGG - Intergenic
1001990509 5:176112410-176112432 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002226363 5:177725730-177725752 CTGCCCAGAGGCTCTGCCCTGGG + Intronic
1002250500 5:177925974-177925996 CTGCCCAGATGCTTTTCCCTTGG + Intergenic
1002267484 5:178045483-178045505 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002298976 5:178247037-178247059 CTGCCTGCATGCCCTGCCCCAGG - Intronic
1002616729 5:180460852-180460874 CTGACCACATGTCTTCCCCAGGG - Intergenic
1002721328 5:181262773-181262795 CTGCCTACACTCCTTGCCCCAGG - Intergenic
1003181894 6:3799361-3799383 CTGTGCCCATGCCCTGCCCTGGG + Intergenic
1003706942 6:8543086-8543108 CTTCCCAAACACCTTGCCCTAGG - Intergenic
1004888297 6:20072695-20072717 CTGCCCACATTCCTTGGCTCAGG + Intergenic
1005055703 6:21727002-21727024 CTGGCCACATGCCTTTTTCTCGG + Intergenic
1005197319 6:23302888-23302910 CTGCCCACATTCCTTGACGGTGG + Intergenic
1006107650 6:31726259-31726281 GTGCCCACGTGCCTTGGCTTTGG + Intronic
1006364587 6:33607993-33608015 CTCCCCACGTGCCTCACCCTGGG + Intergenic
1006506204 6:34490411-34490433 CTGCCCTTCTGGCTTGCCCTGGG + Intronic
1008551486 6:52636528-52636550 CTACCCAAATGCCTTTCACTTGG - Intergenic
1008583658 6:52929425-52929447 CTGGCTACATGGCTGGCCCTTGG - Intergenic
1010519829 6:76818722-76818744 CTCCGCACCTGGCTTGCCCTTGG + Intergenic
1011794385 6:90936695-90936717 CTGCCCCGGTGCCTTGCCTTTGG - Intergenic
1014253634 6:119140197-119140219 CTGCCCTCATGAGTTGCCTTGGG + Intronic
1015312742 6:131783074-131783096 CTGCCCACTTATCTTGCCCTGGG - Intergenic
1015879074 6:137852622-137852644 TTGGCCACATGCTTTTCCCTTGG + Intergenic
1015976698 6:138798079-138798101 TTGCCCACATACCTTTCTCTGGG - Intronic
1019767995 7:2865497-2865519 CTGCCCCCAAGCTTTGGCCTTGG + Intergenic
1020678488 7:11207798-11207820 GTGCCCACATCACATGCCCTTGG - Intergenic
1020832432 7:13109365-13109387 CTCCACACCTGGCTTGCCCTTGG - Intergenic
1023153505 7:37224638-37224660 CTGTCCCCACGCCTGGCCCTTGG - Intronic
1023617037 7:42030148-42030170 CTGCCCACATTCCTTGGCTCAGG + Intronic
1024396785 7:48878546-48878568 CTGCCCAAAACCCTTGTCCTGGG - Intergenic
1024696802 7:51866393-51866415 CTAACCACTTACCTTGCCCTAGG + Intergenic
1025004269 7:55342865-55342887 CTGCCCTCAGCCCTTGTCCTTGG - Intergenic
1025978443 7:66388118-66388140 CTCCCCACTTACCTTGCCCTGGG + Intronic
1029410482 7:100406600-100406622 CTCCCGACATGGCTTACCCTGGG + Intronic
1029539243 7:101173157-101173179 CGGCCCATGAGCCTTGCCCTGGG - Intronic
1030162341 7:106521640-106521662 TTGTCCACATGGCTTGCCTTGGG - Intergenic
1031998230 7:128246825-128246847 CTACCCTCATCCCTTGCCATGGG - Intronic
1032089450 7:128903993-128904015 CTGGACACCTGCCCTGCCCTGGG - Intronic
1032489600 7:132314405-132314427 CTCCCCACAGACCTTCCCCTTGG + Intronic
1032577355 7:133069334-133069356 CTGCCCAAATGCCATTCACTTGG - Intronic
1033551821 7:142454657-142454679 CTGCCCTCATGCCTTTCTTTGGG - Intergenic
1035686659 8:1528364-1528386 CTGCCCTCATCCCTGGCACTGGG - Intronic
1036630620 8:10511700-10511722 CTTCCCCCATACCTTGCCCTGGG - Intergenic
1036744014 8:11391222-11391244 CTGCACACATGCATTGCCCGGGG - Intronic
1036782788 8:11661080-11661102 CTGCCAAAATGGCTTGCGCTGGG + Intergenic
1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG + Intergenic
1039170181 8:34736151-34736173 CTGCCCACATGTCTTGGCTCAGG + Intergenic
1039418489 8:37416499-37416521 CTGCCCACTTGCCTTGCTCTGGG - Intergenic
1041019786 8:53627192-53627214 CTTCCCACATGCCGTGAACTGGG + Intergenic
1041194511 8:55387499-55387521 CTGACCACAGCCCTAGCCCTAGG - Intronic
1042642975 8:70955738-70955760 CTGCACACCTGGCCTGCCCTTGG - Intergenic
1043667307 8:82832074-82832096 CTGAGCCCATGCCTTTCCCTCGG + Intergenic
1044802870 8:95975087-95975109 CTGTCCACATTCCTTGGCTTGGG - Intergenic
1045906462 8:107351694-107351716 CTTTCCACATACCTGGCCCTAGG - Intronic
1046140513 8:110084112-110084134 CTCCACACCTGGCTTGCCCTTGG + Intergenic
1046249506 8:111611760-111611782 CTCCCCGCCTGGCTTGCCCTCGG - Intergenic
1046767413 8:118084682-118084704 CTTCCCTAATGCCATGCCCTAGG - Intronic
1047760633 8:127951409-127951431 CTACCCACTGGCCTTGCCCTGGG - Intergenic
1048321468 8:133403782-133403804 CTGCTCACATCCCTTGTTCTTGG + Intergenic
1048965158 8:139609564-139609586 CAGCCCACAGGCCTGGCCCCTGG - Intronic
1049045512 8:140148137-140148159 CTGCACACTTCCCTAGCCCTGGG - Intronic
1049375208 8:142286104-142286126 CTGGCCAGATGCATGGCCCTGGG + Intronic
1049733424 8:144190984-144191006 CTCCCCACATTCCCTGCCCGTGG + Intronic
1049847608 8:144810639-144810661 CTGCCCACATGCCCGCCACTGGG + Intronic
1050182460 9:2935179-2935201 CTCCGCACCTGGCTTGCCCTTGG + Intergenic
1050645199 9:7712170-7712192 CTGCACACATGACTTACCATAGG + Intergenic
1055361878 9:75500359-75500381 CTGCACACACACCTTTCCCTTGG - Intergenic
1055816657 9:80213856-80213878 CTCCACACCTGGCTTGCCCTTGG + Intergenic
1056901845 9:90607174-90607196 CTGCCCACATGCTCTACCCTGGG - Intergenic
1057046684 9:91891717-91891739 CTGCCCACATTCCCGGCCCTGGG + Intronic
1057533322 9:95874683-95874705 CTGTCCACATTCCTTGGCTTTGG - Intergenic
1057934878 9:99228577-99228599 CTGTCCCCATGCCTTGCTCAGGG + Intronic
1059506691 9:114805809-114805831 CTGCACACAGGCCTCTCCCTGGG + Exonic
1059628733 9:116096438-116096460 CTGCACACCTGCCAAGCCCTTGG + Intergenic
1060511764 9:124239829-124239851 CCCCCCACATGCCTGGCTCTTGG - Intergenic
1060882964 9:127131433-127131455 CTCACCACATGCCTGGCACTGGG + Intronic
1061139123 9:128753649-128753671 CCGGCCCCAGGCCTTGCCCTGGG + Intronic
1061941233 9:133885228-133885250 CTGCATACATGCCCTTCCCTGGG - Intronic
1062501455 9:136853706-136853728 CTGCCCACCCGCCCTCCCCTTGG - Intronic
1186250431 X:7660240-7660262 CTGTCAACATGCCTTGCCTCTGG - Intergenic
1186438905 X:9567765-9567787 TTGCCCCCATCCCTTGCCTTTGG + Intronic
1187312631 X:18160316-18160338 CTGCCCACATGTCTGGCCATGGG + Intergenic
1187936585 X:24342176-24342198 CTGCCCACAAGCTTGGACCTGGG - Intergenic
1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG + Intronic
1189316081 X:40057521-40057543 CTGCCCAGCTGCCTGGCCCTGGG + Intronic
1192009792 X:67256680-67256702 CAGCCACCATGCCTAGCCCTGGG - Intergenic
1192195194 X:69023279-69023301 CTGACCATATCCCTTGGCCTTGG + Intergenic
1194212328 X:91083421-91083443 CTCCACACCTGCCTTGCCCTTGG + Intergenic
1195719343 X:107851522-107851544 CTTCCCCCATCCCCTGCCCTGGG + Intronic
1197663729 X:129200757-129200779 CTGTTCACAGGCCTTGCCCAGGG - Intergenic
1198842773 X:140876664-140876686 CTCCCCCCATGCCTTGCCCTAGG + Intergenic
1200377194 X:155795400-155795422 CTTCCCCAATACCTTGCCCTAGG + Intergenic
1200424757 Y:3008740-3008762 CTGCACATCTGGCTTGCCCTTGG - Intergenic
1202232808 Y:22672551-22672573 CAGGCCACATGCCCTGCCCATGG - Intergenic
1202310348 Y:23523607-23523629 CAGGCCACATGCCCTGCCCATGG + Intergenic
1202560454 Y:26146987-26147009 CAGGCCACATGCCCTGCCCATGG - Intergenic