ID: 952334279

View in Genome Browser
Species Human (GRCh38)
Location 3:32391728-32391750
Sequence CCCTCCGGTGACTGGCCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952334279_952334285 -7 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334285 3:32391744-32391766 CGGAGGGATCCCGCCAGAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 64
952334279_952334294 20 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334294 3:32391771-32391793 GCGTCTCCAGCAGCGGGGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 167
952334279_952334296 26 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334296 3:32391777-32391799 CCAGCAGCGGGGCAGGGACCCGG 0: 1
1: 0
2: 7
3: 63
4: 522
952334279_952334290 14 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334290 3:32391765-32391787 GGCTCCGCGTCTCCAGCAGCGGG 0: 1
1: 0
2: 2
3: 67
4: 2334
952334279_952334293 19 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334293 3:32391770-32391792 CGCGTCTCCAGCAGCGGGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 139
952334279_952334283 -10 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334283 3:32391741-32391763 CACCGGAGGGATCCCGCCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
952334279_952334291 15 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334291 3:32391766-32391788 GCTCCGCGTCTCCAGCAGCGGGG 0: 1
1: 0
2: 0
3: 30
4: 178
952334279_952334289 13 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334289 3:32391764-32391786 CGGCTCCGCGTCTCCAGCAGCGG 0: 1
1: 0
2: 3
3: 8
4: 105
952334279_952334297 27 Left 952334279 3:32391728-32391750 CCGGCCGGCCAGTCACCGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 952334297 3:32391778-32391800 CAGCAGCGGGGCAGGGACCCGGG 0: 1
1: 0
2: 4
3: 63
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952334279 Original CRISPR CCCTCCGGTGACTGGCCGGC CGG (reversed) Exonic
900284261 1:1891498-1891520 CCCTCCGGGGACGGGGCGGGTGG + Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
913118124 1:115715079-115715101 CCCTCTGGAGTCTGGCCAGCAGG + Intronic
1064692265 10:17930399-17930421 CCCTCTGTTGACTGGCCAGCTGG + Intergenic
1075051357 10:119184621-119184643 ACCTCAGGTGATTGGCCCGCAGG + Intergenic
1076523557 10:131096057-131096079 CCCGACGGTGCCTGGCAGGCAGG - Intronic
1076726396 10:132416148-132416170 CCCTCCAGTGACTTCTCGGCGGG + Intronic
1077038187 11:505377-505399 CCCTGGGGTGTCTGGGCGGCCGG + Intronic
1077334646 11:1997908-1997930 CCCTGCTCTGATTGGCCGGCAGG - Intergenic
1079132100 11:17753065-17753087 CCCTCCGTTGACTTGCATGCAGG + Intronic
1081630764 11:44688174-44688196 CCCTCTGGTGCCTGCCTGGCAGG + Intergenic
1083674039 11:64315785-64315807 CCCTCCGGGGCCAGCCCGGCCGG - Exonic
1085640247 11:78188796-78188818 CCCGCCGGTGTCCGGCCGGCTGG + Exonic
1090768143 11:129895246-129895268 CCCTCCGGTGCCAGCCCGGCTGG + Intronic
1202817629 11_KI270721v1_random:53090-53112 CCCTGCTCTGATTGGCCGGCAGG - Intergenic
1094338914 12:29389347-29389369 CCCTCCGGACCCGGGCCGGCGGG + Intergenic
1102148247 12:110670690-110670712 CTCTCCGGTCACTGGCTGCCTGG - Intronic
1105344384 13:19560172-19560194 CCCTCCGGTGCCAGCTCGGCCGG + Intergenic
1105535650 13:21261402-21261424 CCCTCCGGTGCCAGCCCGGCCGG - Intergenic
1108797018 13:54044160-54044182 CCCTCCCGTGCCTGGCCTGGTGG + Intergenic
1109476210 13:62882789-62882811 CCCTCCCATGACTGGCCTGGAGG - Intergenic
1111672320 13:91347576-91347598 GCCTGCGGTGATTGGCGGGCGGG + Intergenic
1113542260 13:111118058-111118080 CCCTCCGCTCACTGGCTGTCAGG - Intronic
1119682028 14:76599632-76599654 TTCCCAGGTGACTGGCCGGCGGG - Intergenic
1121496384 14:94394334-94394356 CCCTCCGGTTACTTGCAGCCTGG - Intergenic
1122858092 14:104569587-104569609 CTCTCCGGTGTCTGCCAGGCAGG + Intronic
1125349464 15:38752274-38752296 CCCACAGGTTACTGGCGGGCAGG + Intergenic
1126849556 15:52789047-52789069 CCCTTCGGTGACCGGCGCGCAGG - Exonic
1127253886 15:57271386-57271408 CCCTCCCGTGCCTGGCCTGGTGG - Intronic
1132406435 15:101544134-101544156 CCCTCCGCTGCCTGGCAGGATGG + Intergenic
1132691063 16:1182176-1182198 CCCTCCGGTGGGTGGCAGGTGGG + Intronic
1132893307 16:2215003-2215025 CGCCCCGGTGATTGGCTGGCAGG + Intergenic
1136490565 16:30605175-30605197 CCCGCCGGTGACTGACCAGCAGG + Exonic
1139583117 16:67884835-67884857 CCCTCCGGGGGCTGGGCGGACGG + Exonic
1140479969 16:75257125-75257147 CTCTCCACTGACTGGCCGGGTGG + Intronic
1145163150 17:20589242-20589264 CCCTCCAGAGCCTGGCCGGGGGG - Intergenic
1145739642 17:27262455-27262477 CCCTGCGATGACTGGCCTGGGGG + Intergenic
1151712190 17:75813225-75813247 CCCTCCCGTGGCTGGCCTCCTGG - Intronic
1152861572 17:82699138-82699160 ACCTCGGGTGCCTGGCCGGGTGG + Intergenic
1160138680 18:76298187-76298209 CACTTCTGTGACTGGCTGGCAGG + Intergenic
1160495781 18:79374269-79374291 CCCGTCGGTCACTGGCTGGCCGG + Intronic
1160495794 18:79374315-79374337 CCCGTCGGTCACTGGCTGGCCGG + Intronic
1160495807 18:79374361-79374383 CCCGTCGGTCACTGGCTGGCCGG + Intronic
1160495820 18:79374407-79374429 CCCGTCGGTCACTGGCTGGCCGG + Intronic
1160495833 18:79374453-79374475 CCCGTCGGTCACTGGCTGGCCGG + Intronic
1160495846 18:79374499-79374521 CCCGTCGGTCACTGGCTGGCCGG + Intronic
1160495859 18:79374545-79374567 CCCGTCGGTCACTGGCTGGCTGG + Intronic
1161085400 19:2332836-2332858 CCCTCTGGTGACTGGCATCCTGG + Intronic
1161353419 19:3806047-3806069 CCAGCCGGTGTCTGGGCGGCAGG + Exonic
1161795400 19:6383495-6383517 CCCCCCTGTGCCTGGCCCGCAGG - Exonic
1162724679 19:12682921-12682943 CCCTCAGGTGACCGCCCGCCTGG + Intergenic
1163606684 19:18279712-18279734 CCCGCCGGGGCCTGGCGGGCTGG - Intergenic
1164152394 19:22566273-22566295 CCCTCCGGTGCCTGGCTTGGTGG - Intergenic
929760520 2:44802621-44802643 CCCTCCGCAGACTCGCGGGCCGG + Intergenic
930217013 2:48707823-48707845 CCCTCCCGTGCCTGGCTCGCTGG - Intronic
931004806 2:57836896-57836918 CCAGCCTGTGACTGGCAGGCCGG + Intergenic
947722998 2:232380585-232380607 TCCTGTGGTGACTGGCAGGCTGG - Intronic
947727348 2:232408666-232408688 TCCTGTGGTGACTGGCAGGCTGG - Intronic
948955929 2:241291331-241291353 CCCTCCTGTGACAGGCAGGCAGG + Intronic
1172581323 20:36050872-36050894 CCCTCCGGCCCCGGGCCGGCGGG - Intergenic
1173930238 20:46811646-46811668 TCCTCCGGGGACTGGGAGGCGGG + Intergenic
1176088736 20:63309672-63309694 CCCTCCTGTGAGTGGCCACCAGG + Intronic
1180703476 22:17794465-17794487 CCATCCGGTGACGGGCCTCCAGG + Intronic
1181013533 22:20055774-20055796 CCCTCAGGTGCCTGGCAGGCGGG - Intronic
1183180563 22:36257371-36257393 CCCCTCGGTGACTGGGCTGCTGG + Exonic
1183309835 22:37103378-37103400 CCCCCAGGTGGCTGGCGGGCAGG - Exonic
1184129922 22:42511688-42511710 CCCACCTGTGGCTGGCTGGCTGG + Exonic
1184284461 22:43461282-43461304 CCCTCCTGTGACTGCTAGGCTGG + Intronic
952334279 3:32391728-32391750 CCCTCCGGTGACTGGCCGGCCGG - Exonic
957939755 3:86990602-86990624 CCGTCCGGTGACTCACCTGCTGG + Exonic
960060692 3:113317440-113317462 CCCGGCAGTGACTGGCAGGCAGG - Intronic
961603437 3:128077189-128077211 CCCTCCCGTCACTTGGCGGCAGG - Intronic
966869087 3:184278374-184278396 CTCTCCTGTGACAGGCAGGCTGG + Intronic
966885904 3:184378059-184378081 CCACCCGGTGAGTGGCCAGCAGG - Exonic
969492921 4:7510245-7510267 CCCTCCGCTGAGTGTCCGGGTGG + Intronic
971844944 4:31906472-31906494 CCCTCCTGTCACAGGCCTGCAGG - Intergenic
974285134 4:59855777-59855799 CCGTCCGGGGACTGGCAGCCTGG + Intergenic
983399611 4:167246262-167246284 CACTCAGGTGTCTGGCTGGCTGG - Intergenic
986877167 5:12125976-12125998 CCCTCCCGTGTCTGGCTGGGTGG + Intergenic
994886104 5:105564013-105564035 CCCACCGGTGGATGGCCTGCCGG - Intergenic
995136600 5:108686052-108686074 CCCTCCCGTGCCTGGCCCGGTGG - Intergenic
998037347 5:138928154-138928176 CCCTCCTGTCACAGGCCAGCCGG + Intronic
1001383270 5:171317776-171317798 CCCTGGGGTGCCTGGCTGGCTGG + Intergenic
1002189663 5:177472103-177472125 CTCTCCTGTGACTGACCTGCAGG + Exonic
1002673110 5:180886216-180886238 CCCTCCTGTGCCTGGCTTGCTGG - Intergenic
1002696886 5:181098062-181098084 CCCTGCGCGGACTGGACGGCGGG - Intergenic
1002697736 5:181101311-181101333 CCCTGCGCGGACTGGACGGCGGG + Intergenic
1007921264 6:45611710-45611732 CCCTCTGGTTATTGGCCTGCTGG - Intronic
1019541617 7:1554293-1554315 CCATCAGGAGACTGGCAGGCAGG - Intronic
1019994542 7:4715652-4715674 CCCTGCTGTGACTGACTGGCAGG + Intronic
1022473268 7:30694578-30694600 CCCTCCGGTCCCTGGCAGCCTGG - Intronic
1022738931 7:33102880-33102902 CCCTCAGGGGCCTGGCAGGCAGG + Intronic
1033146121 7:138871264-138871286 CCCCCCGGAGGCTAGCCGGCGGG - Exonic
1035340586 7:158158300-158158322 CCCTCCTGAGACTGGGCTGCGGG + Intronic
1041944303 8:63424389-63424411 CCCGCCGGTGACTGGCTTGGAGG + Intergenic
1043446630 8:80325594-80325616 CCCTGGGGTGACAGGCAGGCAGG + Intergenic
1043527591 8:81112791-81112813 CCCTCGGGTGACTGTCAGACAGG - Intergenic
1047277503 8:123416882-123416904 CCCGCGGGGGGCTGGCCGGCTGG - Exonic
1048833532 8:138497661-138497683 CCATCGGATGACGGGCCGGCTGG - Intergenic
1049826418 8:144671699-144671721 CCCTAGGGTGGCTGGCCGGGAGG - Intergenic
1059042626 9:110830653-110830675 CCCACCGGTGGATGCCCGGCCGG + Intergenic
1061896749 9:133652278-133652300 CCATCCGGTGAGTGCCCAGCGGG + Exonic
1062103933 9:134742461-134742483 CCCTCAGGTGACTGGTGAGCAGG + Intronic
1191121682 X:56912763-56912785 CCCTCCGGTGCCTGGCTTGGTGG - Intergenic
1191197888 X:57744317-57744339 CCCTCCGGTGCCTGGCTCGGTGG + Intergenic
1193397673 X:81004128-81004150 CCCTCCGGCCCCTGGCCGGCGGG - Intergenic
1196684061 X:118495854-118495876 CCCTCTGTTTACTCGCCGGCCGG - Intergenic