ID: 952336184

View in Genome Browser
Species Human (GRCh38)
Location 3:32404983-32405005
Sequence GTTGAGAGAGGGCCTGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952336174_952336184 29 Left 952336174 3:32404931-32404953 CCTTCCCAAAGGGAGAGAGTCTC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 952336184 3:32404983-32405005 GTTGAGAGAGGGCCTGTGAGGGG 0: 1
1: 1
2: 1
3: 26
4: 306
952336175_952336184 25 Left 952336175 3:32404935-32404957 CCCAAAGGGAGAGAGTCTCCTGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 952336184 3:32404983-32405005 GTTGAGAGAGGGCCTGTGAGGGG 0: 1
1: 1
2: 1
3: 26
4: 306
952336176_952336184 24 Left 952336176 3:32404936-32404958 CCAAAGGGAGAGAGTCTCCTGCT 0: 1
1: 1
2: 2
3: 23
4: 217
Right 952336184 3:32404983-32405005 GTTGAGAGAGGGCCTGTGAGGGG 0: 1
1: 1
2: 1
3: 26
4: 306
952336178_952336184 7 Left 952336178 3:32404953-32404975 CCTGCTGGCTCTGAAGAAGTGAA 0: 1
1: 0
2: 7
3: 50
4: 279
Right 952336184 3:32404983-32405005 GTTGAGAGAGGGCCTGTGAGGGG 0: 1
1: 1
2: 1
3: 26
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952336184 Original CRISPR GTTGAGAGAGGGCCTGTGAG GGG Intronic
900490250 1:2944604-2944626 GTTGAGTGTGTGCATGTGAGTGG + Intergenic
900774211 1:4569803-4569825 GCTGAGAGGAGGCCTTTGAGGGG - Intergenic
900917915 1:5651291-5651313 GTTGACAGAGGGGCTTAGAGAGG + Intergenic
901211946 1:7531667-7531689 GTAGAGGGAGGGGCTGGGAGTGG - Intronic
901807826 1:11749167-11749189 GTTCAGAGAGGGCGTGGGAGAGG - Intronic
902619470 1:17642531-17642553 GTGGGGAGAGGGCATGGGAGGGG + Intronic
902974779 1:20080857-20080879 GCCGAGAGAGGGGCTATGAGAGG + Intronic
903705326 1:25281337-25281359 GACCAGAGAGAGCCTGTGAGGGG - Intronic
903721900 1:25411993-25412015 GACCAGAGAGAGCCTGTGAGGGG + Intronic
904423929 1:30411228-30411250 GGTGAGAGAGTGCGTGAGAGAGG + Intergenic
904616759 1:31754168-31754190 GATCAGAGAGGGCCGGTGATGGG - Intronic
904641887 1:31937747-31937769 GTGAAGGGAGGGCGTGTGAGTGG - Intronic
904789769 1:33010705-33010727 GGTGAGGGAGGGCTGGTGAGGGG - Intronic
905228371 1:36494652-36494674 GTAGAGAGAAAGACTGTGAGGGG - Intergenic
905313137 1:37064481-37064503 GCTGAGAGAAGGCAGGTGAGAGG + Intergenic
905789159 1:40781300-40781322 GTGGAGACAGGGCCTGGGGGTGG + Intergenic
907867035 1:58408323-58408345 GTTCAGGGAAGGCCTGTGTGAGG - Intronic
907890290 1:58630717-58630739 GGTGAGGGAGGGCTGGTGAGGGG - Intergenic
908109935 1:60886930-60886952 CTTGAGAAAGGGGCTGGGAGGGG + Intronic
908137049 1:61143865-61143887 GTTGACATAAGGCCTCTGAGAGG + Intronic
909186487 1:72493055-72493077 GTTGATAGAGGGCTTCAGAGTGG + Intergenic
909406127 1:75291641-75291663 ATGGACAAAGGGCCTGTGAGGGG + Intronic
909428902 1:75562773-75562795 TTTGAAAGAGAGACTGTGAGAGG - Intronic
909977648 1:82064189-82064211 CTTGAGAGAGAGCCTGAGAAAGG + Intergenic
910596618 1:88987309-88987331 GTTGGGAGAGGGCCTGAAAAAGG + Intronic
912146663 1:106802680-106802702 GCTGAGAGAGCTCCTGTCAGTGG + Intergenic
912958361 1:114172543-114172565 GATGAGGTAGGGCCTTTGAGAGG + Intergenic
913149220 1:116023984-116024006 GATGATACAGGGCCTGTGATGGG + Intronic
915077474 1:153320972-153320994 GTTGTGAGAAGGCCTATGAAGGG + Intergenic
915279484 1:154812933-154812955 GTCGGGAGAGTGGCTGTGAGCGG - Intronic
915681201 1:157583448-157583470 TTGGAGACAGGGCCTTTGAGAGG + Intronic
918094951 1:181326801-181326823 GCTGAAAGAGGCCATGTGAGAGG - Intergenic
919986565 1:202679835-202679857 TCTGAGTGAGGGCCTGGGAGGGG - Intronic
921105040 1:211968623-211968645 GTTGAGAGAAGGCTTGTAAAAGG + Exonic
924600530 1:245484837-245484859 TGTGTGAGAGGGCCTGTGACTGG + Intronic
1063163840 10:3442069-3442091 GCTGAGACTGGGCCTGTGTGGGG - Intergenic
1063685971 10:8237543-8237565 ATTGAGAGAGGACTTGTGGGGGG + Intergenic
1065433728 10:25685398-25685420 GTTGAGACAAGGCTTGTGACAGG - Intergenic
1065867283 10:29925222-29925244 GTAGTGAGAGGCACTGTGAGAGG + Intergenic
1069383840 10:67866367-67866389 GTTGTGAGGGTGGCTGTGAGAGG - Intergenic
1070746893 10:78939160-78939182 CATGAGAGAGGGGCTGTGAGCGG + Intergenic
1071252669 10:83836961-83836983 GTTGGGAAAAGGCCTCTGAGAGG - Intergenic
1071274251 10:84038439-84038461 ATTGTGAGAGGGTCTGTGAGGGG + Intergenic
1071336699 10:84606223-84606245 CTTGGGAGAGGGCATGTGATGGG + Intergenic
1071711473 10:88054043-88054065 GTGGTGAGAGGACCTATGAGTGG + Intergenic
1074492547 10:113952151-113952173 TTGGAGATAGGGCCTGTAAGGGG - Intergenic
1075362870 10:121855142-121855164 GCAGAGAGGGGGCCTGGGAGAGG - Intronic
1075489836 10:122857072-122857094 GGAGTGAGAGGGCCTGTGAGTGG - Intronic
1076060965 10:127413602-127413624 GATGAGACAGGGCCTGCGTGAGG + Intronic
1076378023 10:130004555-130004577 GTTGTAAGAGGGCCTGTGCAGGG - Intergenic
1076691865 10:132227838-132227860 GGCTAGAGAGGGCCTGTGGGTGG + Intronic
1076762078 10:132610978-132611000 GGGGAGAGAGGCCCTGTCAGAGG + Intronic
1077186566 11:1238113-1238135 GTTCAGATGGGGCCTGGGAGGGG + Intronic
1077252978 11:1568772-1568794 GTACAGAGAAGGCCTCTGAGGGG - Intronic
1078348574 11:10573622-10573644 GGTGGGAGAGGGCCTGTGCCTGG + Exonic
1078598148 11:12706917-12706939 GCTGAGAAAGGGCATGTGATAGG + Intronic
1079075048 11:17379897-17379919 TTCGAGAGAGAGCCTGTGTGAGG + Intergenic
1079359717 11:19760281-19760303 GTTGGGAGTGGGCCTGAGAATGG - Intronic
1079422159 11:20303731-20303753 GTTGAGACAGGGACTGGGAATGG + Intergenic
1081563797 11:44243546-44243568 ATTGACAGAGGGCCTGTAAGTGG - Intronic
1081615270 11:44587154-44587176 GTTTAGGGAGGGCCTTTGGGAGG + Intronic
1081679043 11:44989065-44989087 GTTGATGGAGCCCCTGTGAGAGG - Intergenic
1081793451 11:45804660-45804682 CTTGGGAGAGGGCCTGGGGGCGG + Exonic
1083304372 11:61754908-61754930 TGTGAGAGAAGGCCTGGGAGTGG + Intronic
1084462010 11:69301545-69301567 AGTGAGGGAAGGCCTGTGAGCGG - Intronic
1085814012 11:79716726-79716748 GATGAGAGAGGGCCTGAAGGAGG + Intergenic
1089961807 11:122623323-122623345 GTTGACAGAGCTCCTGAGAGGGG + Intergenic
1090846055 11:130530900-130530922 GGTGAGAGAGGGCAAGAGAGAGG + Intergenic
1091495680 12:970667-970689 GTTGGGAGAGGGCATTTGGGAGG + Intronic
1091947150 12:4557199-4557221 ATTAAGAGAGGCCCTGAGAGAGG - Intronic
1092564354 12:9648593-9648615 GTTGGGGGAGGGCCCGTGGGTGG - Intergenic
1093187272 12:16035129-16035151 GTGGAAAGAGTGCATGTGAGGGG + Intronic
1093263460 12:16970028-16970050 GGTGAGAGAGAGCATGAGAGAGG - Intergenic
1095102853 12:38201832-38201854 GGTGGGAGAGGGGCTGGGAGAGG + Intergenic
1095923639 12:47556670-47556692 GTGGAGAGGGGGCCTGAAAGAGG - Intergenic
1096770770 12:53934635-53934657 GTTCAGAAAGGGCATATGAGGGG - Intergenic
1096778682 12:53979378-53979400 GGGGAGAGAGGGGCTCTGAGGGG + Intergenic
1101060150 12:100962703-100962725 GTTGTGTGAGGGTCTCTGAGGGG - Intronic
1102046258 12:109832202-109832224 GCTAAGAGCGGGCCTGTGTGGGG - Intronic
1102476519 12:113192040-113192062 GTTGAGACAGGGCTGGAGAGAGG - Exonic
1102981824 12:117247652-117247674 TTTGAGATAGGGCCTTTAAGGGG + Intronic
1103007490 12:117433275-117433297 GTTGAGAGTGTGCATGTGAGGGG - Intronic
1103007503 12:117433395-117433417 GTTGAGAGTGTGCATGTGAGGGG - Intronic
1103007613 12:117434640-117434662 GTTGAGAGTGTGCATGTGAGGGG - Intronic
1104543283 12:129686859-129686881 GTTGAGATAGGGCCATTGATGGG - Intronic
1105070091 12:133229057-133229079 GCTGAGACATGGCCAGTGAGAGG - Intronic
1105641603 13:22270674-22270696 CTTGACACAGGGTCTGTGAGAGG - Intergenic
1107561625 13:41562063-41562085 TTAGACAGAGGGCCTGTGATGGG - Intergenic
1107766771 13:43743899-43743921 GTAGAGAGAGAGCCAGAGAGAGG + Intronic
1108581788 13:51834133-51834155 GAGAAGAGAGGGCCTGTGTGAGG + Intergenic
1109442566 13:62394510-62394532 TTTGAGAGGGGGCCTGAAAGTGG - Intergenic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1111509135 13:89238078-89238100 TTAGAAAGAGGGCATGTGAGTGG + Intergenic
1111944419 13:94648644-94648666 GCTGAGAGAGGACCTGGGAGAGG - Intergenic
1112921232 13:104615176-104615198 GTTGTGAGAGGGCCAATCAGAGG - Intergenic
1114555908 14:23562245-23562267 CTTGAGAGATGGCCTGTCACTGG - Intronic
1114847638 14:26343176-26343198 GGTGTGAGAGGGCTCGTGAGTGG - Intergenic
1115219276 14:31043385-31043407 TTTGAGAGAGAGACTGAGAGGGG + Intronic
1116979371 14:51151742-51151764 GGTGAGAGAGGGCATCTGACGGG - Intergenic
1118180654 14:63489291-63489313 GTTGAGTGAGGGTATGTGAGAGG - Intronic
1118743866 14:68760200-68760222 GGTCAGAGAGGACCTGGGAGTGG - Intergenic
1120848474 14:89147344-89147366 GCTCAGAGTGGGCCTGGGAGGGG + Intronic
1121022360 14:90588073-90588095 GTACAGGGAGCGCCTGTGAGAGG - Intronic
1122307029 14:100772877-100772899 GCTGAGAGAGGGGCTGTGGCTGG + Intergenic
1122594157 14:102877717-102877739 GTTGAGGGAGGGCCTGTGGAAGG - Intronic
1122594176 14:102877824-102877846 GTTGAGGGAGGGCCTGCGGAAGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1125758397 15:42081365-42081387 GTGGAGAGTGGGCATGTGTGTGG - Intronic
1125907812 15:43409566-43409588 GTTGAGAAGAGGCCTGGGAGGGG - Intronic
1126325576 15:47473361-47473383 CTTGAGAGAGGGTCTGTGGCTGG + Intronic
1126336581 15:47591607-47591629 AGTGAGAGAGGGGCTATGAGAGG + Intronic
1126450674 15:48805044-48805066 GGTGAGGGAGGGTCTGTGGGAGG - Intronic
1129012657 15:72436739-72436761 GGTGAGAGAGGGAGTGAGAGAGG - Intergenic
1129371268 15:75097105-75097127 GTGGAGAGAGGGGATGTGATTGG + Intronic
1129661997 15:77558091-77558113 GTGGACAGAGGGGCTGTGAATGG + Intergenic
1129942190 15:79507963-79507985 TAGGAGAGAGGGCTTGTGAGTGG - Intergenic
1132783058 16:1639023-1639045 GCTGAGAGAGGGCAGATGAGAGG - Intronic
1133638176 16:7690214-7690236 GTTAAGAGAGTGCCAGTGATAGG - Intronic
1133696821 16:8272458-8272480 TTTGAGAGAGAGACTGTGACAGG - Intergenic
1133782431 16:8949964-8949986 GTTTAGACAGAGCCTGTGAATGG - Intronic
1135087447 16:19486754-19486776 TTGGAGACAGGGCCTTTGAGAGG - Intronic
1135161000 16:20096328-20096350 GTTGACAGAGGGCAGGTGGGAGG + Intergenic
1135684057 16:24483622-24483644 GTGGAGAAAGGGCCTTTGGGAGG - Intergenic
1135947478 16:26877608-26877630 GCTGAGAGAGGGTCTGAGAAAGG - Intergenic
1135957040 16:26964490-26964512 GTTGAGGGAGGGACTTTGTGGGG - Intergenic
1137650898 16:50119452-50119474 GTTGAGATAGGGGCTGGGTGTGG + Intergenic
1139359908 16:66391111-66391133 GGAGGGAGAGGTCCTGTGAGGGG + Intronic
1139442075 16:66973431-66973453 TTTGAGAGAGCTCCTCTGAGGGG - Exonic
1140463078 16:75157190-75157212 CTTGAGAAAGGGTTTGTGAGAGG + Intronic
1140901231 16:79369934-79369956 GTTGGGAGAGGCCCTCTGTGGGG - Intergenic
1141257729 16:82418408-82418430 GGTGAGATTGGGCCTATGAGTGG + Intergenic
1141589161 16:85056297-85056319 GTTGAGAGGGGGCCTCGGAAAGG - Intronic
1141829896 16:86504365-86504387 GTTCCCAGTGGGCCTGTGAGAGG - Intergenic
1142377304 16:89712510-89712532 GTAGAGAGAGGGTCTGGGGGGGG + Exonic
1142481088 17:218667-218689 GTATAGAGAAGGCCTGGGAGAGG - Intronic
1143018718 17:3905172-3905194 TCTGAGACAGGCCCTGTGAGGGG + Intronic
1145266823 17:21383567-21383589 GTGGAAATAGGGCCTGGGAGGGG + Intronic
1147155999 17:38544756-38544778 GCTGAGAGAAGGCCGGTGGGAGG + Intronic
1147456976 17:40543909-40543931 GTTGACAGAAAGCCTGTGAGGGG + Intergenic
1148232309 17:45944210-45944232 GTTCAGAGAGGGCAAGTGACTGG + Intronic
1148446594 17:47741624-47741646 GGAGAGGGAGGGCCTGTGAGTGG + Intronic
1148465814 17:47864722-47864744 GCCCAGAGAGGGCCTGTTAGAGG - Intergenic
1148758103 17:49985171-49985193 GCTGAGAGAGGGACTAGGAGAGG + Intergenic
1150075755 17:62190722-62190744 GTTGGGAGTGGGACTGTGTGTGG + Intergenic
1151175602 17:72285378-72285400 CTGCAGAGAGGGCCTGGGAGCGG + Intergenic
1152511784 17:80794905-80794927 GTGGAGAGTGTGGCTGTGAGGGG + Intronic
1154383614 18:13873788-13873810 GTGGAGAGAGAGACGGTGAGAGG + Intergenic
1155994224 18:32312943-32312965 GTTGAGAGAGGAGTTGTTAGAGG + Intronic
1156465371 18:37345349-37345371 GTGGAGAGAGGGGCAGGGAGAGG + Intronic
1157426182 18:47586226-47586248 ATGGATAGGGGGCCTGTGAGGGG - Intergenic
1158452310 18:57578198-57578220 GTGGGGAGAGGGGCTGGGAGGGG + Intronic
1161606553 19:5218317-5218339 GTTCAGAGGGGGCCAATGAGGGG + Intronic
1162553353 19:11370995-11371017 TTTGAGAAAAGGCCTGAGAGAGG - Intergenic
1162962299 19:14135616-14135638 GTTGAGAGAGGTCCTGAAAAGGG + Intronic
1164707697 19:30332521-30332543 TTTGAGACAGGGCCTGGCAGAGG - Intronic
1165435053 19:35790874-35790896 GTGGAGAGGGGCACTGTGAGTGG - Intergenic
1165733833 19:38163558-38163580 GGTCAGAGAGGGCCTTTGAGGGG + Intronic
1165936523 19:39392264-39392286 GGTGAGAGCGGGCCTCTGGGAGG + Intronic
1166254483 19:41592491-41592513 AATGAGAGAAGGGCTGTGAGGGG - Intronic
1168078960 19:53995334-53995356 ATTGAGAGATGTCCTCTGAGGGG - Intronic
1168115510 19:54219847-54219869 GGTGAGTGAGGGGCTCTGAGTGG - Intronic
1168121308 19:54253996-54254018 GGTGAGTGAGGGGCTCTGAGTGG - Exonic
1168124821 19:54277528-54277550 GGTGAGTGAGGGGCTCTGAGTGG - Exonic
1168181469 19:54665180-54665202 GGTGAGTGAGGGGCTCTGAGTGG + Exonic
927409522 2:22808260-22808282 GTTATGAGAGGGCCTATAAGAGG + Intergenic
927613187 2:24563093-24563115 GATGAGAGTTGGCCAGTGAGTGG + Intronic
928254662 2:29711632-29711654 GTTGTGGGAGGGCCTCTGAAGGG + Intronic
929345486 2:40878652-40878674 ATTGAGGCAGGGCCTGTAAGAGG + Intergenic
929568721 2:43006546-43006568 GTTGAGAGTGGGCTGGGGAGTGG - Intergenic
929969885 2:46564981-46565003 GCAGAGATAGGGCCAGTGAGTGG + Intronic
930519924 2:52452776-52452798 GGTGAGTGAGGGACTGTGAGGGG - Intergenic
933060496 2:77731072-77731094 TTTGAATGAGGGCCTGTGGGTGG + Intergenic
933289208 2:80419174-80419196 GATGAGAGAAGGCCTTTGATGGG + Intronic
933610888 2:84434009-84434031 GGTGAGAGAGGGAATGAGAGAGG - Intronic
935376840 2:102408764-102408786 GTTAACAGGGGGCCTGGGAGTGG - Intergenic
937337118 2:121068953-121068975 GATGAGAGAGGGCCCTAGAGAGG - Intergenic
938823716 2:134983615-134983637 GTGGAGGGAGGGACTGTGGGGGG + Intronic
938903063 2:135814922-135814944 TTGGAGATAGGGCCTTTGAGGGG + Intronic
942069648 2:172304668-172304690 GTTGGGTGAGGGGCTGTGGGAGG + Intergenic
942122203 2:172789076-172789098 GTTGCCTGAGGGCCTCTGAGAGG - Intronic
942490490 2:176484890-176484912 TTTGAGAGAGTGCCAGTGACTGG - Intergenic
943880830 2:193141757-193141779 GGTGAGAAAGAGCATGTGAGAGG - Intergenic
944741418 2:202616491-202616513 GATGAGAGAGCTCCTGTTAGTGG - Intergenic
945180240 2:207084231-207084253 GTGAAGAGAGGGCCTGGCAGTGG + Intronic
946106099 2:217371166-217371188 TTGGAGACAGGGCCTTTGAGAGG + Intronic
946492699 2:220165414-220165436 GTTGAGAGTGAGCATGTAAGAGG - Intergenic
947232548 2:227902635-227902657 GATGAGTGAGGGGCTGTGATTGG + Intronic
947531112 2:230909138-230909160 AGTGAGAGACGGCCTGGGAGCGG - Exonic
947876468 2:233471043-233471065 GGGGACAGAGGGGCTGTGAGTGG - Exonic
948284536 2:236773503-236773525 GTCCAGAGAGAGCCTGTGAAAGG - Intergenic
948466308 2:238153358-238153380 GCTGAGAGAGGGCCTTGGCGGGG + Intergenic
1170366419 20:15603010-15603032 TGTGAGTGAGGGCATGTGAGGGG + Intronic
1170557692 20:17528647-17528669 CCTGGGAGAGGGCCTGTGGGTGG - Intronic
1171206935 20:23288629-23288651 GTGGCCAGAGGGCCTGTGAGGGG - Intergenic
1171398300 20:24854639-24854661 GTTGATGCAGGGCCTCTGAGAGG - Intergenic
1172424226 20:34844665-34844687 GTTGAGAGTGGGAGTGGGAGAGG - Intergenic
1173027169 20:39319113-39319135 GTGGAGGGAGGGCCCGGGAGAGG - Intergenic
1174130980 20:48343159-48343181 CTGGAGTGAGGGCCTGTCAGGGG + Intergenic
1176589233 21:8626164-8626186 GTTGAAATAGGACCTGTGATTGG + Intergenic
1177722903 21:24929847-24929869 ATAGAGAAAGGGACTGTGAGAGG - Intergenic
1178299190 21:31437593-31437615 TTGGAGAAAGGGCCTGTGGGAGG + Intronic
1178941807 21:36912895-36912917 GTTCTGAGAGGTCCTTTGAGTGG - Intronic
1179128270 21:38611573-38611595 CTGGAGTGAGGGCCTGTGGGAGG - Intronic
1180047866 21:45318131-45318153 CTTGGGAGAAGGCTTGTGAGGGG + Intergenic
1180272061 22:10603161-10603183 GTTGAAATAGGACCTGTGATTGG + Intergenic
1181064118 22:20297668-20297690 GGTCAGAGAGGGCCTGCCAGGGG + Intergenic
1181094677 22:20496912-20496934 GTTTTGAGAGGGACTGTGAAGGG + Intronic
1181097996 22:20519311-20519333 GTTAATAGAGGCCCTGTGATTGG + Intronic
1181970187 22:26684025-26684047 GGTCAGAGAGGGCCTCTCAGAGG + Intergenic
1182485302 22:30635568-30635590 GATGGGGGAGGGGCTGTGAGCGG + Intergenic
1183138717 22:35915777-35915799 GTTTAGGGTGGGCCTGGGAGAGG - Intronic
949138077 3:595597-595619 GTTGAAACAGGACCTGTGATTGG - Intergenic
950374140 3:12556672-12556694 GTTGAGGCAGGGCCTGAGAAGGG + Intronic
952336184 3:32404983-32405005 GTTGAGAGAGGGCCTGTGAGGGG + Intronic
955085586 3:55699381-55699403 GTCCGGAGAGGGCCTGTGATTGG + Exonic
955308851 3:57863597-57863619 GGTGAGAGAGGGTCTGGGAGAGG + Intronic
959047693 3:101492545-101492567 GTTGAGTGAGGTCATGTGGGTGG + Intronic
959517869 3:107290175-107290197 GGAGAGAGAGAGCATGTGAGAGG - Intergenic
959531528 3:107439527-107439549 GCTGAGAGAGGGCTGGGGAGAGG + Intergenic
961585103 3:127915622-127915644 GTTGAGGCAGGGCTTGTGACTGG - Intronic
961788047 3:129359227-129359249 CTTCAGAGATGGGCTGTGAGGGG + Intergenic
962257441 3:133882182-133882204 GCTGAGAGAGGGCCTGTGAGGGG - Intronic
965206801 3:165729542-165729564 AGTGAGAGAGGACCTGAGAGTGG + Intergenic
966287615 3:178315967-178315989 GTTGTGGAAGAGCCTGTGAGAGG + Intergenic
966737184 3:183196231-183196253 GTAGAGAGAGGGCCTCTCGGAGG - Intronic
966769141 3:183488534-183488556 ACTGAGGCAGGGCCTGTGAGTGG - Exonic
966985100 3:185172846-185172868 GTGGAGAGAGGGGCACTGAGAGG - Intergenic
967571672 3:191036501-191036523 GCTGTAAGAGGGCCTGTGAGAGG + Intergenic
968407598 4:354273-354295 CATGAGAGAGGGTCTGTGGGGGG - Intronic
970260821 4:14222703-14222725 GTTCAGAGAAGGCCTCTTAGAGG + Intergenic
970538687 4:17055854-17055876 GTTGTCAGAGGGCCTGTGGGAGG - Intergenic
971337636 4:25738779-25738801 GTTGTGAGAGGGACTGTGTGAGG - Intergenic
976066713 4:81196073-81196095 GCTATGAGAGGGCCTGTGAGAGG + Intronic
980646650 4:135651829-135651851 CTGGAGAGAGGGCCTGTAATGGG - Intergenic
981144368 4:141307965-141307987 TTTGAGAAAGGGAGTGTGAGTGG - Intergenic
982442931 4:155457890-155457912 GCTGAGAGAGCTCCTGTTAGTGG + Intergenic
985563905 5:605664-605686 TGTGAGAGGGGGGCTGTGAGAGG + Intergenic
987370428 5:17187838-17187860 GGTGGCACAGGGCCTGTGAGCGG + Intronic
988782315 5:34533459-34533481 GTTTAGAGAGAGCCTTTGGGAGG + Intergenic
990291828 5:54359912-54359934 GAAGAGAGAGGGCCAGTGTGGGG + Intergenic
991654878 5:68894010-68894032 GGTGGGAGAGGGCCAGTGACGGG - Intergenic
993003087 5:82402575-82402597 GTTGAGAGTGGGCCAGTGCGTGG + Intergenic
995214043 5:109574253-109574275 GTGGAGAGAGGGCAAGAGAGAGG + Intergenic
995737814 5:115321398-115321420 GTTGAGAGAGGTCATGTAACTGG + Intergenic
996522758 5:124445675-124445697 CTTGAGGGAGGGTCTGTAAGGGG - Intergenic
996887782 5:128378972-128378994 TTTGAGAGAAGGCCAGTCAGTGG + Intronic
998294393 5:140953051-140953073 TTGGAGATGGGGCCTGTGAGAGG - Intronic
999061425 5:148639521-148639543 GTTGAGAGAAGACCTGTCTGAGG - Intronic
999158292 5:149474203-149474225 GCTGGGAGAGGCACTGTGAGGGG - Intergenic
999321351 5:150617191-150617213 GTTTAGAGAGGTCCTGTGGCTGG + Intronic
999986575 5:157011128-157011150 GGTGAGAGAGGGCATCTGATAGG - Intergenic
1000043362 5:157501580-157501602 GTTGAGGAATGGCCTGAGAGTGG - Intronic
1000862600 5:166474548-166474570 GGTGAGAAAGGGCATGAGAGAGG - Intergenic
1002167375 5:177356766-177356788 TTGGAGACAGGGCCTTTGAGAGG + Intergenic
1005807628 6:29489476-29489498 ATTCAGAGAGGTCCAGTGAGAGG - Intergenic
1006080085 6:31560041-31560063 GGTGAGAAAGATCCTGTGAGAGG + Intergenic
1006133883 6:31884247-31884269 GTGGGGAGGGGGCCTGTGGGTGG + Intronic
1006797383 6:36740425-36740447 GGTCAGAGAGGGCCTCTCAGAGG - Intergenic
1007107776 6:39295418-39295440 GTTGAGAGAGGTTTTGTGATTGG + Intergenic
1007432993 6:41787137-41787159 GCTCAGAGAGGGGATGTGAGTGG + Exonic
1008632972 6:53381686-53381708 GGTGGGAGAGGGCCTGGGAGAGG - Intergenic
1008771301 6:54982017-54982039 GTGGAGAGAGGGACTAGGAGAGG - Intergenic
1009309221 6:62128304-62128326 GTTGTGAGAGTTCCTGTGATTGG + Intronic
1009711057 6:67321364-67321386 ATTGAAAGAAGGCCTGTGTGGGG - Intergenic
1010813692 6:80329639-80329661 ATTGAGAGAAGGCCTATGAAAGG - Intronic
1010915240 6:81608799-81608821 ATTGCGAGAGGGCCTTTAAGAGG - Intronic
1011865217 6:91816843-91816865 TTTCAGGGAGGGTCTGTGAGTGG + Intergenic
1012442152 6:99270626-99270648 GTTGAGGGAGGGGCTGAGTGTGG - Intergenic
1012950202 6:105510110-105510132 GCTGAGAGAGGGCCACAGAGTGG + Intergenic
1015185588 6:130412279-130412301 ACACAGAGAGGGCCTGTGAGTGG - Intronic
1015727669 6:136316229-136316251 TTTGAGATGGGGCCTTTGAGAGG + Intergenic
1016131293 6:140475090-140475112 GTTAAGAGAGGGCTTGTGAAAGG - Intergenic
1018584004 6:165335697-165335719 TTTGAGAAAGGGCATGTGTGTGG - Intronic
1019409252 7:899496-899518 GGTCAGAGAGGGCCCGTGACCGG + Intronic
1019601333 7:1885276-1885298 GTGGGCAGAGGGCATGTGAGAGG - Intronic
1020272307 7:6604570-6604592 GTGGACAGAGGGTCAGTGAGTGG + Intronic
1020453660 7:8347575-8347597 GGAGAGAGAGGGCTTGTGAAGGG - Intergenic
1020836844 7:13164340-13164362 GTTGGTAGAGGGAATGTGAGAGG + Intergenic
1022173629 7:27852548-27852570 GTAGAAAGAGGACCTGAGAGAGG - Intronic
1023603303 7:41902428-41902450 GCTGTGAGAGGCCCTGTGATGGG - Intergenic
1024644078 7:51356731-51356753 ACTGAGAGAGGGCATGAGAGAGG + Intergenic
1025854567 7:65266136-65266158 GTTTACACAGGGCCTGGGAGAGG - Intergenic
1030236336 7:107267189-107267211 GTTGAGAAAGGGGCTTTGTGTGG - Intronic
1030309988 7:108059382-108059404 GTTGGGAGAAGGACTGTAAGGGG - Intronic
1030883436 7:114910415-114910437 GTGGGGAGAGGGACTGGGAGAGG + Intergenic
1032838739 7:135697403-135697425 GGTTAGAAAGGGCCTGAGAGAGG - Intronic
1033057430 7:138071554-138071576 CTTGAGATGGGGCCTTTGAGAGG + Intronic
1033141812 7:138834004-138834026 GCTGAGAGTGGGCCTGGGAAAGG - Intronic
1033529163 7:142245652-142245674 GCTTAGAGAGGGCATGCGAGAGG - Intergenic
1034968174 7:155404151-155404173 GTAGAGAGGGGGCCACTGAGGGG - Intergenic
1036088081 8:5635545-5635567 GTTGTGGGAGGGACTGTGGGAGG - Intergenic
1036672315 8:10799652-10799674 GTTTAGAGAGGGACAGTAAGTGG - Intronic
1036702896 8:11024893-11024915 GTTGAGACAGCACCTGTGACTGG + Intronic
1038412482 8:27368947-27368969 AGTGAGAGAGGTCCTGAGAGGGG - Intronic
1039469979 8:37807332-37807354 GTTGAAACAGGGCCTGTGCACGG + Intronic
1039578336 8:38643598-38643620 GAAGAGAGAGAGCATGTGAGAGG + Intergenic
1040819724 8:51542414-51542436 TTGGAGATAGGGCCTTTGAGAGG + Intronic
1041141824 8:54828306-54828328 TTGGAGATGGGGCCTGTGAGAGG + Intergenic
1041491280 8:58436589-58436611 GTTGGGGGTGGGCCTGTGGGAGG + Intronic
1041746045 8:61210493-61210515 GTCATGAGAGGGCCTGTGAGAGG + Intronic
1042331735 8:67587663-67587685 GCTGAGAGAGCTCCTGTTAGTGG + Intronic
1043398650 8:79862444-79862466 GGTGAGAGAGGGCATCTGATAGG + Intergenic
1044187958 8:89279075-89279097 GTAGAGAGAGTGTCAGTGAGGGG - Intergenic
1044546483 8:93466040-93466062 GGTGAGAGAGGCTCTGAGAGAGG - Intergenic
1045773189 8:105769528-105769550 GATGGGAGAGGGCTTGGGAGGGG + Intronic
1047207141 8:122811642-122811664 GTTGAGAAATGGTCCGTGAGTGG + Intronic
1048027377 8:130599059-130599081 TTGGAGATAGGGCCTGTAAGGGG + Intergenic
1048295855 8:133212854-133212876 CTGGAGAGAGGGCCTGCGGGGGG - Exonic
1048410388 8:134166647-134166669 TTGGAGACAGGGCCTTTGAGAGG + Intergenic
1050204703 9:3184121-3184143 GTTGAGAGAAGGATTGTGCGAGG + Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1052128875 9:24815596-24815618 GTTGAGAGAGGGCTTCTTGGAGG + Intergenic
1052357159 9:27516971-27516993 GCTGAGAGATAGCCTGTGGGAGG - Intronic
1053157990 9:35793208-35793230 GTGGACAGAGCACCTGTGAGAGG + Intronic
1056139104 9:83657218-83657240 GTTAAGAGAGGTCCTGAAAGCGG - Intergenic
1056178693 9:84060980-84061002 ATTGAGATAGGGCCTTTAAGAGG - Intergenic
1056399883 9:86216280-86216302 ATTAAGAGAGGGCCAGAGAGGGG + Intergenic
1056470683 9:86902670-86902692 GGTGGGAGAGAGCCTGTGTGTGG - Intergenic
1058823330 9:108753043-108753065 GTTGAGAGAGGGGGGGTGATTGG - Intergenic
1059139555 9:111839653-111839675 TTAGAGAGAGGGACTGTGATGGG - Intergenic
1059456473 9:114403157-114403179 GCTGAGAAAGGGCCTTTCAGGGG + Intronic
1059465398 9:114466245-114466267 GGTGAGGGAGGGCCTGAGGGAGG - Exonic
1060062975 9:120477558-120477580 GGTGAGAGAGGCCCTGTGCCTGG + Intronic
1061007058 9:127934380-127934402 ATTGACGGAGGGCCTGTAAGTGG + Intergenic
1061303726 9:129720919-129720941 GTGGCGAGTGTGCCTGTGAGTGG + Intronic
1062357398 9:136171291-136171313 GACGAGAGAGGGCCTGTCTGGGG - Intergenic
1062525173 9:136975324-136975346 GCTGAGTGAGGACCAGTGAGTGG - Intergenic
1203619237 Un_KI270749v1:104747-104769 GTTGAAATAGGACCTGTGATTGG + Intergenic
1187656563 X:21481750-21481772 GTTGTGAGAGGGCCTGTGTAGGG + Intronic
1192216464 X:69162817-69162839 GTTGAGCGACCGCCAGTGAGAGG - Exonic
1194373868 X:93109249-93109271 GGTGAGAGAGGGAGTGGGAGGGG + Intergenic
1197527286 X:127578253-127578275 GGTGGGAGAGGGGGTGTGAGGGG - Intergenic
1200681897 Y:6223311-6223333 GGTGAGAGAGGGAGTGGGAGGGG + Intergenic
1202388026 Y:24343545-24343567 GTGGGGAGAGGGCGTGTGTGTGG + Intergenic
1202482761 Y:25326583-25326605 GTGGGGAGAGGGCGTGTGTGTGG - Intergenic