ID: 952337211

View in Genome Browser
Species Human (GRCh38)
Location 3:32414313-32414335
Sequence AACGCAGTGCTGAAATACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952337211_952337212 -7 Left 952337211 3:32414313-32414335 CCGCTGTATTTCAGCACTGCGTT 0: 1
1: 0
2: 0
3: 9
4: 113
Right 952337212 3:32414329-32414351 CTGCGTTCACAGCTTCTGTTTGG 0: 1
1: 0
2: 1
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952337211 Original CRISPR AACGCAGTGCTGAAATACAG CGG (reversed) Intronic
900362008 1:2293681-2293703 AACGCAGTGCCCAAGAACAGGGG - Intronic
900473877 1:2867381-2867403 AAAGCAAAACTGAAATACAGGGG + Intergenic
901830861 1:11891617-11891639 AACTCAGTGCTGCCAGACAGGGG + Intergenic
906536494 1:46553673-46553695 AAGACAGTGTTGAAATTCAGGGG - Intergenic
907722581 1:56985874-56985896 AACTCAGCTCTGAAAAACAGAGG - Intergenic
912358664 1:109076350-109076372 AACACAGTGCTTAGAAACAGTGG - Intergenic
912516186 1:110217900-110217922 CAGGCAGTGCTGGAAGACAGTGG - Intronic
915250976 1:154588250-154588272 GGAGCAGTGCTGAAAAACAGGGG + Exonic
917535369 1:175870717-175870739 GACGCAGTGATCAAATCCAGTGG - Intergenic
918959081 1:191247523-191247545 AACTCAGTTCTGAAATCAAGTGG + Intergenic
920280218 1:204837630-204837652 ACGGGAGTGCTGAAATACACTGG + Intronic
920856999 1:209670983-209671005 AAGTCAGTGCTGAGATAGAGAGG - Intergenic
924093409 1:240525514-240525536 AACAGAGTGCTGGAGTACAGTGG + Intronic
924098728 1:240581936-240581958 AAGGCAATTCTGTAATACAGTGG + Intronic
924278182 1:242409480-242409502 CAGGCAAGGCTGAAATACAGAGG + Intronic
1064545865 10:16449344-16449366 AGCTCAGGTCTGAAATACAGTGG - Intronic
1066439475 10:35424555-35424577 AAGGCAATGCAGAAATGCAGGGG - Intronic
1069700473 10:70421156-70421178 AACGCAGTTCTGGAAAATAGAGG - Intronic
1069906659 10:71736163-71736185 AAAGCACTGTGGAAATACAGGGG - Intronic
1071983781 10:91030520-91030542 AACCCAGTGCTGTGATTCAGTGG - Intergenic
1076473644 10:130737429-130737451 CAAGCAGAGCTGAAACACAGAGG - Intergenic
1078599518 11:12717833-12717855 AAGGCAGAGGTGAAAAACAGTGG - Intronic
1078870114 11:15335624-15335646 AAGGCAGAGCTGAGATTCAGAGG - Intergenic
1083438548 11:62660359-62660381 AATGAAGTGCTCAAATACTGTGG + Intronic
1084456790 11:69272549-69272571 AACACTGAGATGAAATACAGGGG + Intergenic
1084642288 11:70433116-70433138 AAGGCAGAGCTGAGCTACAGAGG + Exonic
1087540728 11:99515485-99515507 AACGCAGGCATGAAATACAATGG - Intronic
1088013399 11:105031095-105031117 CAGGCAGTTCTGAAATGCAGTGG - Intronic
1088331110 11:108652896-108652918 AACAAAATGATGAAATACAGAGG + Intergenic
1088688150 11:112302354-112302376 AAGGCAGTGCTGAGCTCCAGTGG - Intergenic
1098925506 12:76345550-76345572 AACACAGAGCTGAGACACAGAGG + Exonic
1099767281 12:87003669-87003691 AAAACACTGCTGAAATAAAGTGG - Intergenic
1100878035 12:98983760-98983782 AAAGCAGTGTTGAAATCCAGTGG + Intronic
1104070396 12:125339739-125339761 AACGCAGTGCAAGAAGACAGAGG + Intronic
1115684917 14:35786596-35786618 GACGGAGTGCTGGAATGCAGTGG - Intronic
1121305502 14:92904055-92904077 TCCTCAGTGCTGAAATACGGGGG - Intergenic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1128209274 15:65882778-65882800 AAAGCTGTACTGAAATTCAGAGG - Intronic
1130637815 15:85641881-85641903 AACACACTGCTGAAATCCGGTGG - Intronic
1136636209 16:31524908-31524930 AAAGCACTGCTGATTTACAGAGG - Intergenic
1137466467 16:48714321-48714343 AACACAGGGCTGTAACACAGTGG + Intergenic
1142589916 17:998874-998896 AAAGAAGTGCTGAAAGACATGGG + Exonic
1146094851 17:29919528-29919550 AACTCAGTGCTGAGAAACAAAGG + Intronic
1147345031 17:39785460-39785482 CAGGAAATGCTGAAATACAGAGG - Intronic
1149145333 17:53484227-53484249 AACTCAGTGGTGATATACTGAGG - Intergenic
1150797525 17:68250102-68250124 AAATCAGAGCTGAAATATAGAGG + Intronic
1155775923 18:29761055-29761077 AACTCAGTGGTGAAATACTTTGG + Intergenic
1159485652 18:69053152-69053174 AATGCAGTGCTATAATAGAGAGG + Intronic
1167197970 19:48043860-48043882 AAGGCATTGCTGAGAAACAGCGG - Exonic
1168392473 19:56021635-56021657 AACGAAGTGCTGATAGACACTGG - Intronic
926869508 2:17397800-17397822 GACTCAGTGATGAAATACAGGGG + Intergenic
929747797 2:44676967-44676989 AACATAATGCTAAAATACAGTGG - Intronic
931854194 2:66284429-66284451 AGGGCAGGGCTGAAATTCAGTGG + Intergenic
934811731 2:97284710-97284732 AAAGCAGTGCTTCACTACAGTGG + Intergenic
934825960 2:97423230-97423252 AAAGCAGTGCTTCACTACAGTGG - Intergenic
936527810 2:113253648-113253670 GACTCAGTGCTGAAATATAAAGG - Intronic
946519698 2:220451463-220451485 AACCCAGGAGTGAAATACAGAGG + Intergenic
946700713 2:222410545-222410567 AACGCATTGCCCAAATAAAGTGG + Intergenic
948593374 2:239064976-239064998 AGCGCCGTGCTTAACTACAGGGG + Intronic
1169234711 20:3921595-3921617 AAGGCACAGCTGAAATACAGAGG - Intronic
1173232907 20:41215397-41215419 ACTGCAGTGCTGAAATATAGTGG - Intronic
1177828009 21:26105862-26105884 ACCCCAGTGCTGCAACACAGTGG - Intronic
1180122192 21:45761122-45761144 AACACTGTGCTAAAAGACAGTGG - Intronic
952337211 3:32414313-32414335 AACGCAGTGCTGAAATACAGCGG - Intronic
956162589 3:66370901-66370923 TACACAGTGCAGAAATACAAGGG + Intronic
958031404 3:88115286-88115308 AACTCACAGTTGAAATACAGCGG - Intronic
959139518 3:102469071-102469093 AACGCAGTGCAAGAAGACAGTGG - Exonic
959526254 3:107380758-107380780 AAGTCAGTGCTGATATACAGAGG - Intergenic
964214157 3:154260702-154260724 AACCCAGTGTTCAAATTCAGGGG + Intergenic
965359469 3:167720180-167720202 AAAGCAGTGCTAAAATGCAGAGG + Exonic
965820643 3:172681050-172681072 AACTCAGTGGCGAAATAGAGGGG + Intronic
967553945 3:190832526-190832548 AATTCAGTGCTAAAATAAAGAGG + Intergenic
968091742 3:195902282-195902304 AGGGCAATGCTAAAATACAGGGG + Intronic
970157157 4:13153058-13153080 CACGCAAGTCTGAAATACAGCGG + Intergenic
973203763 4:47535913-47535935 AAAGCAATGCTGAACAACAGTGG + Exonic
977103092 4:92843651-92843673 AACCAAGTACTGAAATACATTGG - Intronic
980833910 4:138166436-138166458 AAGGCCGTGCTGAAAGCCAGAGG - Exonic
980836578 4:138201276-138201298 AATGCAGTGATCAAATACAAAGG - Intronic
982104333 4:151998449-151998471 ACCCCGGTGCTGAAAAACAGAGG + Intergenic
983611586 4:169651823-169651845 TACACAGTTCTGAAATACAGAGG + Intronic
984237709 4:177180991-177181013 AACTCACTGTTGAAATAAAGGGG - Intergenic
985364586 4:189214750-189214772 AATACAGTGATGAAATGCAGTGG + Intergenic
986578906 5:9243389-9243411 AGCTCATTGCTGGAATACAGTGG - Intronic
986834042 5:11614693-11614715 AGGGCAGTGATGAACTACAGTGG + Intronic
986922671 5:12706737-12706759 AAGGAAGGGCTGAAATACTGAGG + Intergenic
991303443 5:65151092-65151114 AACTCAGTGCTGAAAGACTGTGG - Exonic
991640630 5:68748119-68748141 AACTCAGTTCTTAAATACTGAGG - Intergenic
991925701 5:71703163-71703185 AGCGCAGTCCTGGCATACAGGGG + Intergenic
992366575 5:76097716-76097738 AATGTAGTGCTAAAATATAGAGG - Intronic
997863309 5:137439194-137439216 GACACAGTGCTGAAGTACACAGG + Intronic
997900467 5:137759136-137759158 GACAAAGTGATGAAATACAGAGG - Intergenic
1001371494 5:171208617-171208639 AAGTCAGTGCTGTTATACAGTGG + Intronic
1001576310 5:172766361-172766383 CACGCAGTGGAAAAATACAGCGG - Intergenic
1001889393 5:175326685-175326707 AAACCAGTGCTAAAATACTGAGG + Intergenic
1003820090 6:9886408-9886430 AACACTGTGCTGAAAGGCAGTGG - Intronic
1006479357 6:34279497-34279519 AACGCAGTGGAGAAAGCCAGAGG - Intergenic
1010002402 6:70960580-70960602 AACTGAATGCTGAAATGCAGTGG - Intergenic
1010548875 6:77194750-77194772 AACGAAGTGCTTATATTCAGTGG + Intergenic
1017454743 6:154591345-154591367 AACACAGGCCTGACATACAGTGG - Intergenic
1019688906 7:2398737-2398759 AATGCAGTGAAGAAAGACAGGGG + Intergenic
1022709620 7:32838518-32838540 AACACTGTTCTGGAATACAGTGG - Intergenic
1022914262 7:34931603-34931625 AACACTGTTCTGGAATACAGTGG + Exonic
1030350846 7:108484511-108484533 ATTGTAGTGCTGAGATACAGTGG - Intronic
1033397198 7:140986399-140986421 AAGGAAGTGCTCAAAGACAGAGG + Intergenic
1034176983 7:149107771-149107793 AAAGCAGTTCTGAAATATAATGG - Intronic
1034881230 7:154764113-154764135 AAAGCATTGCTGGGATACAGAGG + Intronic
1039249500 8:35646482-35646504 AACCCAGTCCTGAAATACCCAGG + Intronic
1040537976 8:48326191-48326213 AACGCAGCCATGAAACACAGGGG - Intergenic
1043736897 8:83759664-83759686 AATGAAGAGATGAAATACAGAGG - Intergenic
1045239109 8:100383100-100383122 TAGGCAGTGCTGAAATATACGGG + Intronic
1048147475 8:131859686-131859708 AACACAGTGCTGAATAAGAGGGG + Intergenic
1048198497 8:132352204-132352226 CAAGCAGTGCTGTAAGACAGTGG + Intronic
1050036890 9:1445645-1445667 AACTCAGAGCTGAGAAACAGGGG - Intergenic
1051816556 9:21114043-21114065 CACGCCGTGTTGAAAAACAGAGG + Intergenic
1059872826 9:118596896-118596918 AACTCAGTACTGAATTCCAGAGG - Intergenic
1060335452 9:122717719-122717741 AACACAGGGCTGAAAGTCAGGGG - Intergenic
1060436399 9:123596706-123596728 ACCAGAGTGCTGAAACACAGTGG + Intronic
1060599822 9:124869980-124870002 ACCCCAGGGCTGAAATACGGCGG - Intronic
1061363867 9:130160282-130160304 AATACAGTGCTGAAATTCACAGG - Intergenic
1062257146 9:135632030-135632052 AACGCAGTGTTGAAATGCAAAGG - Intronic
1193435256 X:81467501-81467523 AAGTCAGTGAAGAAATACAGTGG - Intergenic
1198506834 X:137309358-137309380 AACGAAGTGGTGTCATACAGAGG - Intergenic
1198631404 X:138642827-138642849 AATGCAGTGCTTAAATAAAAGGG + Intronic