ID: 952337826

View in Genome Browser
Species Human (GRCh38)
Location 3:32420413-32420435
Sequence AAAGTGAAGCCCAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952337822_952337826 0 Left 952337822 3:32420390-32420412 CCAGCCTAACAGGTTATTTTTAA 0: 1
1: 0
2: 10
3: 80
4: 738
Right 952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG 0: 1
1: 0
2: 4
3: 20
4: 252
952337821_952337826 7 Left 952337821 3:32420383-32420405 CCAGGTTCCAGCCTAACAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 106
Right 952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG 0: 1
1: 0
2: 4
3: 20
4: 252
952337823_952337826 -4 Left 952337823 3:32420394-32420416 CCTAACAGGTTATTTTTAAAAAG 0: 1
1: 0
2: 10
3: 118
4: 939
Right 952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG 0: 1
1: 0
2: 4
3: 20
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952337826 Original CRISPR AAAGTGAAGCCCAATGAGGT GGG Intronic
900396862 1:2456678-2456700 AAACTGAGGCCCAAGGAGGGCGG - Intronic
900789549 1:4670697-4670719 AAACTGGAGACCAATGAGGCTGG - Intronic
902672148 1:17982162-17982184 TAAGGTAAGGCCAATGAGGTGGG - Intergenic
904404305 1:30275931-30275953 AAACTGAGGCCCAGGGAGGTTGG + Intergenic
904841163 1:33372847-33372869 AGAGTGAAGCTCAATAAGGCAGG + Intronic
904865776 1:33577813-33577835 AAAGTAGAACCCAATGGGGTTGG + Intronic
905961666 1:42047793-42047815 AAAGAGAAGCACAGAGAGGTTGG + Intergenic
906255883 1:44349790-44349812 AAAGTGAAGCCCAGAGAGGAAGG + Intronic
906544631 1:46612415-46612437 AAAGAAAAGCCCTCTGAGGTGGG + Intronic
907908417 1:58806220-58806242 AAACTGAAGCTCAGGGAGGTGGG - Intergenic
908828600 1:68157182-68157204 AAACTGAGGCCAAATGAGGCAGG - Intronic
909715561 1:78702534-78702556 AGTGTGGAGCCCAGTGAGGTTGG - Intergenic
910357243 1:86373860-86373882 AATGTGAACTCCCATGAGGTAGG + Intronic
910721733 1:90294223-90294245 CAAATGAGGCTCAATGAGGTTGG - Intergenic
910751310 1:90634134-90634156 CAAGTGCAGCCCAATGGGGTGGG - Intergenic
911243381 1:95489980-95490002 AAAGAGAAGCCAAAAGAAGTTGG - Intergenic
911743858 1:101417533-101417555 TAATTAAAGCCAAATGAGGTGGG + Intergenic
911947717 1:104134167-104134189 AAAATGAAGCCAAAGGAAGTGGG - Intergenic
912526213 1:110285010-110285032 GACGTGAAGCCCAATGAGAGAGG - Intergenic
912627528 1:111218163-111218185 AGAGAGGAGCCCAATCAGGTAGG - Intronic
912867142 1:113267499-113267521 TAAGTGAAGCCCGATGGGCTAGG - Intergenic
915791208 1:158673429-158673451 GAGGTGAAGCCCTATGATGTAGG + Intronic
916681998 1:167113401-167113423 AAAGTGAAGCCACATCAGGGTGG + Intronic
916852609 1:168718948-168718970 AAAACAAAGCTCAATGAGGTTGG + Intronic
917864597 1:179181491-179181513 AAACTGAAGCTCAGCGAGGTTGG - Intronic
918103697 1:181398476-181398498 AAACTGAGGCCCAGAGAGGTTGG + Intergenic
920395507 1:205642742-205642764 AAACTGAGGCCCAATGAGGAAGG - Intergenic
921089956 1:211832762-211832784 CAAGAAAAGTCCAATGAGGTTGG - Intergenic
923305121 1:232681604-232681626 GAAGGGGAGCCCATTGAGGTAGG + Intergenic
1063726949 10:8647755-8647777 AACATGGAGCCCAATTAGGTGGG + Intergenic
1064865981 10:19880696-19880718 AAAGTGAAGACAGATGATGTTGG - Intronic
1065325031 10:24543345-24543367 AACGTGAACCCTAATGAGGATGG + Exonic
1069667372 10:70171782-70171804 AAAATGAAGAACAAGGAGGTGGG + Intergenic
1071545239 10:86523850-86523872 AATGTGCAGCCCAATCAGCTGGG - Intergenic
1072016548 10:91352728-91352750 ACAATGGAGCCCAGTGAGGTGGG - Intergenic
1072392905 10:95007083-95007105 AAGGTGAAGCCCAATGTCTTAGG - Intergenic
1073985188 10:109200154-109200176 AAAGTGAAGAACAAAGAGGAAGG + Intergenic
1074511180 10:114113753-114113775 AAACTGAAGCTCAATGAGGTGGG + Intergenic
1074951622 10:118342391-118342413 AAAGGGAAGCCCCAGGAGGCCGG - Intergenic
1076219424 10:128721312-128721334 AAGGTCAAGTCTAATGAGGTGGG - Intergenic
1078083579 11:8220613-8220635 ACAGTGAAGCCCGTTGGGGTGGG - Intergenic
1078554954 11:12317039-12317061 AAAGAGAAACTCTATGAGGTTGG - Intronic
1079268611 11:18960281-18960303 AAAATGAATCCCACTGATGTGGG - Intergenic
1079772565 11:24480885-24480907 AAAATGAAGCACAGGGAGGTAGG - Intergenic
1079986021 11:27201698-27201720 AAAGTCAAGGCCAAGGAGGAGGG - Intergenic
1083615322 11:64023346-64023368 AAACTGAGGCCCCAGGAGGTGGG - Intronic
1084043921 11:66558184-66558206 ACAGTCCAGCCCCATGAGGTAGG - Intronic
1084118055 11:67053327-67053349 AAACTGAGGCCCAAAGAGGTTGG - Intergenic
1084900556 11:72306991-72307013 AAACTGAGGCACAAAGAGGTGGG + Intronic
1085325008 11:75599852-75599874 AAAGGGAAGCTCAAAGAGGAGGG - Intronic
1085394250 11:76198801-76198823 AACATGAAGCCCAGAGAGGTTGG - Intronic
1085804222 11:79619724-79619746 AAACTGAGGCCCAGTGAGGTTGG + Intergenic
1087655501 11:100917926-100917948 AAAGAGAAGCTGAATGATGTGGG - Intronic
1096023358 12:48340283-48340305 AAAGTGAAGCCCCCAGAGTTAGG - Exonic
1097832866 12:64244031-64244053 AGAGAGAAGACCAATGTGGTGGG + Intergenic
1097900026 12:64863316-64863338 AAAAGGAAGCCCAGAGAGGTGGG + Intronic
1098058263 12:66532542-66532564 CAAGTGCAGCATAATGAGGTAGG - Intronic
1098235664 12:68415806-68415828 ACACTGAAGCATAATGAGGTAGG - Intergenic
1099278431 12:80608779-80608801 AAAGTGAAGCCAATTGAGTGGGG + Intronic
1102044330 12:109820480-109820502 AAAGTGAAGATCAGAGAGGTTGG - Intronic
1103031981 12:117623070-117623092 AAAATGAGGCTCAAAGAGGTGGG - Intronic
1103051828 12:117786799-117786821 AGAGTGAAACTCACTGAGGTCGG + Intronic
1104226930 12:126844265-126844287 AAAATAGAGCCCAATGAGCTGGG + Intergenic
1107061530 13:36164652-36164674 AAAAAGAAGGCCAATGGGGTTGG - Intergenic
1107665565 13:42686384-42686406 AATGTGCAGACCAAAGAGGTTGG - Intergenic
1108566471 13:51703803-51703825 AAACTGAGGCCCAATGAGGTTGG + Intronic
1110380474 13:74844673-74844695 AAACTGAAGCTCAAAGATGTAGG - Intergenic
1114262791 14:21050598-21050620 AAAGTAGTGCCCAATGAGCTTGG + Intronic
1114668664 14:24397597-24397619 AAACTGAAGCACAATAAGGCAGG + Intergenic
1116008471 14:39323194-39323216 TAAGTGAAGCAAAATGAGGGTGG - Intronic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1116336600 14:43665534-43665556 AATGTGGAGCCCAAAGAGTTTGG + Intergenic
1116623198 14:47232558-47232580 AAGGTGAACCTCATTGAGGTTGG - Intronic
1118790048 14:69082646-69082668 AAACTGAAGCCCATGGAGGGGGG - Intronic
1119151860 14:72367827-72367849 AAACTGAGGCCCAAAGAGGTTGG - Intronic
1119574469 14:75706195-75706217 AAAGTGCAGACCAATCAGGTGGG - Intronic
1120994832 14:90409139-90409161 AAAGTGATGCCAAACCAGGTCGG - Intergenic
1121898299 14:97669514-97669536 AAACTGAAACACAAAGAGGTTGG - Intergenic
1123682733 15:22774217-22774239 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123762703 15:23444987-23445009 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1124334484 15:28846740-28846762 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
1124573952 15:30891258-30891280 CCAGTGAAGCCCAGTGAAGTGGG + Intergenic
1126811938 15:52415654-52415676 AAATTTAAGCCAACTGAGGTCGG + Intronic
1127041659 15:54983850-54983872 AAACTGAAGGCCAGTGAGGCTGG - Intergenic
1128646486 15:69382304-69382326 AATGTGAAGTTCAAGGAGGTGGG + Intronic
1129170413 15:73804156-73804178 AAAGTGAGGCTCAAGAAGGTTGG - Intergenic
1129463452 15:75711363-75711385 CAGTTGAAGCCCAAGGAGGTGGG + Intronic
1129721435 15:77880039-77880061 CAGTTGAAGCCCAAGGAGGTGGG - Intergenic
1131412278 15:92219852-92219874 AAACTGAAACACAAAGAGGTTGG + Intergenic
1133176745 16:4021227-4021249 ACATTCAAGCCCAATGCGGTTGG - Intronic
1133985456 16:10664961-10664983 AAACTGAAGCACAGAGAGGTAGG + Intronic
1134108458 16:11499917-11499939 AAACCGAGGCCCAAAGAGGTAGG - Intronic
1134796381 16:17040871-17040893 AATGTGAAGCCCAGAGACGTTGG + Intergenic
1138297693 16:55900932-55900954 AAACTGAAGCACAAAGAGGAAGG + Intronic
1138298033 16:55903506-55903528 AAACTGAAGACCAGAGAGGTTGG - Intronic
1138588444 16:57986118-57986140 AATGTGCAGCCCACTGGGGTGGG + Intronic
1140288945 16:73632329-73632351 AAACTTAAGCCCAAAGAGATAGG + Intergenic
1140657010 16:77151442-77151464 AAGGTGAAGTCCACTGAGATGGG - Intergenic
1141064059 16:80899804-80899826 ACAGTGTAACCCACTGAGGTAGG - Intergenic
1142703337 17:1678016-1678038 AAAGTTAAGTCCAGTGAGGCTGG + Intronic
1143576234 17:7795012-7795034 AAAGTGAGGCCAAGTGTGGTGGG - Intronic
1146502361 17:33374943-33374965 AAACAGAAGCCCAGGGAGGTTGG + Intronic
1147920505 17:43913756-43913778 TAGGTGAACCCCAATGAGGAGGG - Intergenic
1149501073 17:57152920-57152942 AAAGTGCAGAGCAATGAGGGAGG + Intergenic
1150883316 17:69056734-69056756 AAGGTGAAGCCTAATTAGATAGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152425556 17:80216784-80216806 AAACTGAGGCACAAGGAGGTAGG + Intronic
1154030327 18:10747949-10747971 AAAGTGAAGTGCCCTGAGGTGGG - Intronic
1155244912 18:23898237-23898259 AAATGGAAGCCCAAAGAAGTCGG - Intronic
1157516545 18:48315560-48315582 AAACTGAGGCCCAATGTGGGAGG - Intronic
1157594485 18:48855924-48855946 AAAGTGAAGCCCAATGAGTGTGG + Intronic
1158590670 18:58776182-58776204 AATGTGATCCCCAATGTGGTAGG + Intergenic
1158706826 18:59800030-59800052 AAAGTGAGACCCAGTGAGGTTGG - Intergenic
1161517032 19:4702312-4702334 AAACTGAAGCCCAGAGAGTTGGG - Intronic
1163167950 19:15510414-15510436 AGATTGCAGCCCCATGAGGTGGG + Intronic
1164418341 19:28065138-28065160 AGAGAGAAGCTCTATGAGGTTGG - Intergenic
1164546813 19:29172796-29172818 AAAGTGAAGCCCAGAGAGAGGGG + Intergenic
1165263916 19:34644923-34644945 AAACTGAAGCACAACGAGCTTGG + Intronic
1166548414 19:43648764-43648786 AAACTGAGGCCCAGAGAGGTCGG + Exonic
1167514096 19:49912946-49912968 AAAGTGAAGCCCAGAGTGGCTGG + Intronic
1167621265 19:50562308-50562330 AAACTGAGGCCCAGAGAGGTGGG - Intronic
1168588891 19:57616510-57616532 AAACAGTAGCCCTATGAGGTGGG + Intronic
925507899 2:4589309-4589331 TAAGTGTAGTCAAATGAGGTAGG - Intergenic
925595722 2:5553570-5553592 AGAGTCCAGCCCAAGGAGGTGGG + Intergenic
926602883 2:14865143-14865165 AAATGGAAGCTCAGTGAGGTAGG - Intergenic
927929217 2:27033354-27033376 AAACTGAGGCCCAGTGAAGTTGG + Intronic
928545930 2:32329198-32329220 AAAGTGAAGCTGACAGAGGTTGG - Intergenic
929165411 2:38876322-38876344 AAACTGAGGCCCAGGGAGGTTGG - Intronic
930757459 2:54991499-54991521 AAACTGAAGGCCAGAGAGGTTGG - Intronic
931246121 2:60494110-60494132 AAAGTGAAGCCCCATGGGTGAGG + Intronic
931911181 2:66901902-66901924 AAAGTGAGGCCCTAAGAGGTCGG - Intergenic
932102007 2:68909423-68909445 AAAGTGAAGCCCTTGGAAGTGGG - Intergenic
932364394 2:71139204-71139226 AAAGTGAAGTGCCATGAGATTGG - Intronic
933767218 2:85718503-85718525 GAAGAGAAGCCCACAGAGGTAGG - Intergenic
935375969 2:102397860-102397882 AAACTGAAGCACCAAGAGGTTGG - Exonic
937216365 2:120316091-120316113 AAACTGAGGCCCTGTGAGGTGGG + Intergenic
937227036 2:120375915-120375937 AAACTGAAGCCAACCGAGGTGGG - Intergenic
937776212 2:125779024-125779046 ACAGAGAAGACCTATGAGGTAGG + Intergenic
938318510 2:130346232-130346254 AACGTGGAGCTCACTGAGGTCGG + Exonic
939918807 2:148082980-148083002 AAACTGGGGCCCAAAGAGGTTGG + Intronic
940681509 2:156791291-156791313 AAAGTAGTGACCAATGAGGTGGG + Intergenic
942941599 2:181625114-181625136 AAAAAGCAGCCCAATGGGGTAGG + Intronic
943367621 2:186981006-186981028 AAGGTTAAGCCCAGTGAGGGAGG - Intergenic
943623115 2:190171303-190171325 AAAATGAAGCCAAAAGAGGTAGG + Intronic
1168972530 20:1940389-1940411 AAAGTGAGGCCCCAGGAGGAGGG - Intronic
1170394100 20:15907409-15907431 AGAGTACAGCCCAATGAGGATGG + Intronic
1171108702 20:22460530-22460552 AAAGTGAGGACCAGTGAGTTGGG - Intergenic
1171171043 20:23015653-23015675 AAAGTGTGCCCCAGTGAGGTAGG - Intergenic
1172290594 20:33773398-33773420 AAAGTAAGGCCCAATGAGCCAGG + Intronic
1172294945 20:33802908-33802930 AAACTGAGGCCCAAAGAAGTAGG - Intergenic
1172617819 20:36300762-36300784 AAACTGAGACCCAGTGAGGTTGG + Intergenic
1172642052 20:36446495-36446517 AAATTGAGGCCCAGAGAGGTAGG + Intronic
1173304617 20:41836347-41836369 ATCGTGAAGCCCAGTGTGGTGGG - Intergenic
1175308573 20:57995127-57995149 AAGGTGAGGCACAAAGAGGTTGG - Intergenic
1176100975 20:63364416-63364438 AAAGGGAAAGCCAGTGAGGTTGG - Intronic
1178095839 21:29214560-29214582 AAAGTGAAGCCCAAAGGTCTAGG - Intronic
1178608599 21:34060145-34060167 AAAATGATGGCCAATGAGATTGG + Intergenic
1178621385 21:34179910-34179932 AAAATGAAACACAATGGGGTCGG - Intergenic
1179528347 21:41999492-41999514 AAACTGAGGCTCAAAGAGGTTGG - Intronic
1179546922 21:42118794-42118816 AATTTTAAGCCCCATGAGGTAGG + Intronic
1180140925 21:45893014-45893036 ACAGGGAAGCCCCATGAGGAGGG + Intronic
1182824694 22:33254628-33254650 AAATTGAACCACAGTGAGGTTGG - Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183245956 22:36693554-36693576 AAAGGGAAGCCCAGAAAGGTAGG - Intronic
1184183959 22:42851440-42851462 AAAATGTAGCCCCATGAGGGGGG + Intronic
1184331750 22:43832146-43832168 AAGGTGTAGCCCAAGCAGGTTGG - Intronic
950135958 3:10581093-10581115 AAATTGAAGCCCAAAGATGATGG + Intronic
950783934 3:15417009-15417031 AAAATGATGAACAATGAGGTAGG + Intronic
951336290 3:21426267-21426289 ATAGTGAAGCCCACACAGGTGGG + Intronic
952125539 3:30295803-30295825 AAAGGGAAGCCCAAACATGTAGG - Intergenic
952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG + Intronic
952791452 3:37203839-37203861 AAATTGAATCTCAGTGAGGTGGG + Intergenic
955803341 3:62708472-62708494 AAAGTGAAACACCAAGAGGTTGG + Intronic
956027958 3:65003765-65003787 AAAGTAAAAGCCAGTGAGGTGGG + Intergenic
957497689 3:81011427-81011449 AAGGTGCAGCCTACTGAGGTAGG - Intergenic
958882772 3:99691645-99691667 AGAATGAAGCCCCATGAGGGTGG - Intronic
960037637 3:113117884-113117906 GAAGTGAATCCCTATGAGGCTGG - Intergenic
960043206 3:113171065-113171087 AAAGTGAAGAACAATGTGGTGGG + Intergenic
960949821 3:122992127-122992149 AAAATGAAACACAATGAGGGTGG - Intronic
961697169 3:128713374-128713396 AAAGGCAAGCCAAATCAGGTAGG - Intergenic
961800175 3:129441493-129441515 AAACTGAAGCCCAGAGAGGGTGG + Intronic
961916792 3:130384207-130384229 AGAATGAAGCCTAATGTGGTTGG + Intronic
962355090 3:134686827-134686849 AAACTGAGGCCCAAAGAGATGGG + Intronic
963274584 3:143317386-143317408 AAAGTGAGGGGCAATGAGGCAGG - Intronic
963479710 3:145855860-145855882 AAATTGAATCCCACAGAGGTTGG + Intergenic
965142124 3:164851412-164851434 AAAGTGAATGCAAATGGGGTAGG + Intergenic
967818589 3:193819296-193819318 AAAGAGAAGCCGAGTGAGGCTGG - Intergenic
968265104 3:197356676-197356698 AAAGTGAAGAACACAGAGGTGGG + Intergenic
969275220 4:6130150-6130172 AAAGTCCTGCCCAATGAAGTGGG + Intronic
970098871 4:12497516-12497538 AAAGATGAGCCCAATGAGGGAGG - Intergenic
970696059 4:18678399-18678421 AATGTCAAGCCCTAAGAGGTCGG - Intergenic
974388972 4:61239976-61239998 TAAGACAATCCCAATGAGGTAGG - Intronic
976165012 4:82245208-82245230 ATAGGGAAGACCAATGAGTTTGG - Intergenic
976295542 4:83467702-83467724 AATGTGAAGATCAATGAAGTAGG - Intronic
976727099 4:88225435-88225457 AGAGTGAAGCATGATGAGGTTGG + Intronic
976780424 4:88752264-88752286 AAACTGAAACCCCAAGAGGTGGG + Intronic
977855835 4:101890912-101890934 AAAGAGAAGTCAAAGGAGGTAGG - Intronic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
983271283 4:165564863-165564885 GAAGTGCAGCCCAATGCAGTAGG - Intergenic
986393339 5:7304753-7304775 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
986444871 5:7812598-7812620 TAACTGAAACCCAATGAGGTAGG + Intronic
987149655 5:15025873-15025895 AAATTGAAGGCAAATGAGGTTGG - Intergenic
988513918 5:31888960-31888982 AAACTGAAGCCGACGGAGGTTGG - Intronic
992709195 5:79431979-79432001 AAAATGAAGCCAAAAGAGGTTGG - Intronic
992763086 5:79969013-79969035 AAGGCTAAGCCCAATGAGGTAGG - Intergenic
993868178 5:93219411-93219433 AAACTGAAGCACAGAGAGGTAGG + Intergenic
994415584 5:99466270-99466292 AATATGAAGCACAATGAAGTAGG - Intergenic
995684475 5:114757303-114757325 AAAGTGAAGCTCATTGGGGAAGG + Intergenic
997252102 5:132397174-132397196 TAAGTGACGGTCAATGAGGTGGG + Intergenic
998229935 5:140354630-140354652 ATAGTGAAGCCCTCTGAGGTAGG - Intergenic
998371036 5:141661686-141661708 ATAGAGATGCCCAATGAGGGTGG + Exonic
999002114 5:147935392-147935414 AAAGTCAGGCACCATGAGGTTGG - Intergenic
999345021 5:150810227-150810249 ATATTGAAGCCCAAGCAGGTAGG - Intergenic
999673607 5:153978013-153978035 AAACTGAGGCCCAAGGAGGCAGG + Intergenic
999884533 5:155906391-155906413 GAAATGAAGCTCAATGAGGAAGG + Intronic
1000337157 5:160250244-160250266 AAATGGAAGCCCAAAGAGGGAGG + Intergenic
1001527976 5:172442170-172442192 AAGGTAAGGCCCAAGGAGGTTGG + Intronic
1001772635 5:174307700-174307722 AAACTGAGGCTCAAAGAGGTGGG + Intergenic
1001925313 5:175631691-175631713 CAAATGAAGCACAAAGAGGTGGG - Intergenic
1003081697 6:3026499-3026521 AAAGTGAGGCCCGAAGAGGTGGG - Intergenic
1008609952 6:53176491-53176513 AAAGTGAAGGCCAAGGCTGTAGG + Intergenic
1010887812 6:81265182-81265204 AAGGTGGAGCCCAAGTAGGTAGG - Intergenic
1011290619 6:85772922-85772944 AATGTGTAGCCCAAAGAGTTTGG - Intergenic
1011525692 6:88262252-88262274 AAACTGAGGCTCAATGAGTTTGG + Intergenic
1011958283 6:93052704-93052726 AAATTGAAGCTCCATGAGATTGG + Intergenic
1013307033 6:108858772-108858794 AAAGTGAAAGCCACTGAGGAGGG - Intronic
1014145651 6:117995345-117995367 AGAGTTAAGTTCAATGAGGTAGG + Intronic
1019485526 7:1287604-1287626 AAACTGAGGCCCAGGGAGGTCGG - Intergenic
1020929831 7:14378991-14379013 AAAGTAAAGCATAATGAGATTGG + Intronic
1021186808 7:17574562-17574584 TAAGTGAAGCCAAATGAGTTAGG - Intergenic
1022606115 7:31815768-31815790 ATCCTGCAGCCCAATGAGGTGGG + Intronic
1024520560 7:50302258-50302280 AAGGTGTAGCCCACTGAGGCAGG - Intergenic
1027231957 7:76277956-76277978 AAAGTGAACACATATGAGGTGGG - Intronic
1029067555 7:97866982-97867004 AAAGTTTAGGCCAAAGAGGTGGG - Intronic
1030488075 7:110196489-110196511 AAAGAAAAGCCCAAGGAGGGTGG + Intergenic
1030740557 7:113104085-113104107 ATACTGAAGCCCAAAGAGGGAGG + Intergenic
1031912731 7:127534604-127534626 AAAGAGACCCTCAATGAGGTCGG + Intergenic
1033547748 7:142417093-142417115 AAAGAGAAGCCCAAAGAGCAAGG - Intergenic
1034511926 7:151542665-151542687 ACTGTGATGCCCAGTGAGGTTGG + Intergenic
1035405995 7:158597704-158597726 AAGGTGAAGATCAATGAGATTGG + Intergenic
1036575410 8:10023276-10023298 AAAATGCAGCCCAATGGAGTTGG - Intergenic
1037223292 8:16552679-16552701 AAAGAGAAACCCAATGAGATAGG + Intronic
1037634384 8:20688207-20688229 AAAATGAGTCCCAAGGAGGTGGG - Intergenic
1037932684 8:22891650-22891672 TTAGTGAAGCCCACTTAGGTGGG + Intronic
1038385541 8:27140931-27140953 AAATTGAAGCCCCATGTGGAGGG + Intergenic
1038450362 8:27635328-27635350 AAACTGAGGCCCAAGCAGGTAGG + Intronic
1039513319 8:38109093-38109115 AAAATAAAGCCCAGTTAGGTGGG + Intronic
1039674683 8:39648819-39648841 AGAATGAAGCCAAATGAGTTAGG - Intronic
1041037992 8:53814964-53814986 AAAGTGAACCCAAATTAGCTGGG + Intronic
1042505158 8:69551692-69551714 AAAGTGAAGCCCAGACAAGTAGG - Intronic
1047240751 8:123085949-123085971 AAACGGAAGCCCAGAGAGGTTGG - Intronic
1047421476 8:124711378-124711400 AAACTGATGCCCAGAGAGGTTGG + Intronic
1047455899 8:125011063-125011085 AAATTGAAGCTCAGAGAGGTAGG + Intronic
1048254591 8:132896205-132896227 AAACTGAAGCTCAGAGAGGTTGG + Intronic
1048959826 8:139567233-139567255 AATGTGATCCCCAATGTGGTGGG + Intergenic
1049782294 8:144434559-144434581 AAAGTCAAACCCAAGGAGGAGGG - Intronic
1050156289 9:2669707-2669729 AAAGTGAAACTCATTGAGATTGG + Intergenic
1051466389 9:17382859-17382881 AAAGATAAGGCTAATGAGGTAGG - Intronic
1059658961 9:116382476-116382498 ACAGTGAAGACCAAAAAGGTAGG + Exonic
1059688248 9:116658483-116658505 ACAGTGAATCTCCATGAGGTAGG + Intronic
1059809898 9:117844516-117844538 AAAGAGAAGCCCAATAACCTGGG + Intergenic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1061362720 9:130153916-130153938 CAAATGAAGCCCAGGGAGGTAGG + Intergenic
1061856395 9:133443993-133444015 AAACTGAAGCCCACAGAGGAGGG - Intronic
1186969147 X:14821373-14821395 AAAGTGAAGCCCCATGCTGAGGG + Intergenic
1187428757 X:19203052-19203074 TAAGTGAAGCCCGATGGGATGGG + Intergenic
1191239554 X:58173094-58173116 ATTTTGAAGCCCAATGAGTTAGG + Intergenic
1193136984 X:77983315-77983337 AAACTGAAGCCCTCAGAGGTAGG + Intronic
1194511594 X:94802845-94802867 AAAGTAAATCTCAATGAGTTAGG + Intergenic
1196017823 X:110958206-110958228 AAAGTGATGCTCAATGAGGTCGG + Intronic
1196047643 X:111273088-111273110 AAACTGAAGACCAATGAGCATGG - Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1197242305 X:124133090-124133112 GAAGTGAAGCCAAATGAAGCAGG - Intronic
1197637654 X:128933145-128933167 AAAGTAAGGCCCAAAGAGGTAGG - Intergenic
1197998900 X:132411504-132411526 AATGTGAAGGCCAAAGGGGTGGG + Intronic
1199473496 X:148220937-148220959 AAAATGAGGCTCAATGAGATTGG + Intergenic
1199922397 X:152421597-152421619 AAAGGCAAGCCCCATGGGGTGGG + Intronic