ID: 952339086

View in Genome Browser
Species Human (GRCh38)
Location 3:32430342-32430364
Sequence AGGCATAAGCAGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952339086_952339092 1 Left 952339086 3:32430342-32430364 CCATCCCCATTCTGCTTATGCCT 0: 1
1: 0
2: 1
3: 31
4: 295
Right 952339092 3:32430366-32430388 TATAAAATCACATGTGTTCAGGG 0: 1
1: 0
2: 0
3: 33
4: 365
952339086_952339091 0 Left 952339086 3:32430342-32430364 CCATCCCCATTCTGCTTATGCCT 0: 1
1: 0
2: 1
3: 31
4: 295
Right 952339091 3:32430365-32430387 TTATAAAATCACATGTGTTCAGG 0: 1
1: 0
2: 1
3: 26
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952339086 Original CRISPR AGGCATAAGCAGAATGGGGA TGG (reversed) Intronic
902873880 1:19329557-19329579 AGGAAGAAGCAGAATGGTTAAGG + Intergenic
904470277 1:30731780-30731802 AGCAGTAAGCAGAATGGGAAGGG - Intergenic
905380473 1:37558132-37558154 GGGGATGAGCAGATTGGGGAAGG - Intronic
906139411 1:43524855-43524877 AGGTGTAAAGAGAATGGGGAGGG + Intergenic
906175616 1:43769443-43769465 AGGAAGTAGCAGGATGGGGAGGG + Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
910828692 1:91437267-91437289 TGGTATAAGAAGAATGGGTAGGG - Intergenic
910922219 1:92360430-92360452 TGGCAAAAGCAGAAAGGAGAGGG + Intronic
912708088 1:111929679-111929701 AGGCACAAGCAGGATGGGAGAGG - Intronic
913088881 1:115462771-115462793 AGGCATGAGAAAAATGGAGAAGG - Intergenic
913686478 1:121236718-121236740 AGGATTAAGCAGAATGGGGTTGG + Intronic
914038329 1:144024358-144024380 AGGATTAAGCAGAATGGGGTTGG + Intergenic
914151126 1:145043550-145043572 AGGATTAAGCAGAATGGGGTTGG - Intronic
914447903 1:147765660-147765682 AGGCAGGAGCAGATTGTGGAGGG + Intronic
915043206 1:152985551-152985573 ATTCATAAGCAGAATGGAGTAGG - Intergenic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
916305742 1:163329589-163329611 GAGCAAAAGCACAATGGGGAAGG + Intronic
916512177 1:165482186-165482208 AGTCCTAAGAAGAACGGGGAGGG + Intergenic
916854754 1:168738120-168738142 AGGCACCAGCAGAATATGGAAGG + Intergenic
918663464 1:187118086-187118108 CGGCATAAGCAGAATATGAAGGG + Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919777266 1:201202425-201202447 AGGAATAAGCAGAGAGGTGAGGG - Intronic
920393475 1:205626369-205626391 AGTCTAAAGCAGAATGGGAAAGG - Intronic
920473801 1:206255272-206255294 AGGATTAAACAGAATGGGGTGGG + Intronic
921628885 1:217409776-217409798 GGGTATAACCAGAGTGGGGATGG - Intergenic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
922985398 1:229862369-229862391 AGGCAAAGGCAGAGTGGGAAGGG + Intergenic
924024260 1:239816487-239816509 AGGCACAGGCAGAAGAGGGAGGG + Intronic
924466443 1:244303101-244303123 TGACATAAGCAGGATGGAGAGGG + Intergenic
924683043 1:246257869-246257891 AGGCAGAAGCAGGAGAGGGAAGG - Intronic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1066276201 10:33871058-33871080 AGGCATATAGAGAAAGGGGAAGG - Intergenic
1069135803 10:64763753-64763775 AGGCATCTGCATTATGGGGATGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070807791 10:79280683-79280705 AGTCATCAGAAGAATGGGGTGGG - Intronic
1070988356 10:80708228-80708250 TGGGATAAGCGGAATGGGGAAGG + Intergenic
1071276827 10:84063323-84063345 AGGCAGAGGCAAGATGGGGATGG - Intergenic
1071837980 10:89438750-89438772 AGCCATAAACAGAACGGAGACGG + Exonic
1072504618 10:96052749-96052771 AGGCATCAGCAGAAAAAGGAGGG - Intronic
1073122507 10:101131388-101131410 AGGCTAAAGTAGAAGGGGGAGGG - Exonic
1074233580 10:111562099-111562121 GGGCAAAAGCAGGCTGGGGAAGG + Intergenic
1074437772 10:113448850-113448872 AGCCATAAGCATTTTGGGGAAGG + Intergenic
1074500320 10:114017839-114017861 AGGCATAAGGAGAATGTGAAAGG - Intergenic
1074505169 10:114063348-114063370 AGGCAAAAGCTGGATTGGGAAGG + Intergenic
1075182903 10:120227938-120227960 GGGCATAAACAGGATGGTGAAGG + Intergenic
1075658617 10:124177789-124177811 AGGGGAAAGCAGAATGGAGAGGG - Intergenic
1076343383 10:129765025-129765047 AGGCTCCAGAAGAATGGGGAAGG - Intronic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1078781327 11:14441869-14441891 AGGTCTAGGCAGAATAGGGAAGG + Intergenic
1079124647 11:17709838-17709860 AGGGATAAGCAGATTTTGGAGGG + Intergenic
1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG + Intronic
1083626389 11:64074083-64074105 AGGCAAGGCCAGAATGGGGAGGG - Intronic
1085449498 11:76623409-76623431 AGGCACTCCCAGAATGGGGAGGG - Intergenic
1085793836 11:79519035-79519057 AGAGATAAGCAGATTGGTGATGG + Intergenic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086944128 11:92828469-92828491 AAGCATAACCAGAAAGGGGTGGG - Intronic
1089351517 11:117824129-117824151 AGCCAGATGCAGAAAGGGGAGGG - Intronic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091779294 12:3203940-3203962 AGGAAAGAGCAGAATGGGAAGGG + Intronic
1091836356 12:3588820-3588842 AGGCATCTTCAGAATGGGGAAGG + Intronic
1091906997 12:4197125-4197147 TGGCTTAACCAGAATGGGTAGGG + Intergenic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092755417 12:11758651-11758673 AGGTATTAGAAGAGTGGGGAAGG - Intronic
1092780466 12:11981661-11981683 AGGCATTATCAGAATGGGTCAGG + Intergenic
1094702362 12:32882008-32882030 GGGAATATGCAGAAAGGGGAAGG + Intronic
1096112546 12:49038037-49038059 AGGCATCAGCAGCAGGGGGAGGG + Exonic
1096385421 12:51192003-51192025 AGGCCTAGGGAGAATGGGGGAGG - Intronic
1097063853 12:56305892-56305914 AGGAATAAATAGCATGGGGAAGG - Intronic
1097107252 12:56633100-56633122 AGTCATGAAGAGAATGGGGAGGG + Intronic
1097188471 12:57208375-57208397 GGGCAGAGGCAGCATGGGGAGGG - Intronic
1099997531 12:89795427-89795449 AGCCCAAAGCAGAATGGAGAAGG - Intergenic
1100020015 12:90057734-90057756 AGGCAAAATCAGAATGGCGTAGG + Intergenic
1100175866 12:92030196-92030218 AGGCATAAGTGGAATAGGGGTGG - Intronic
1100226249 12:92559176-92559198 AGGCATAAACAGCATTGGGTGGG - Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1101107603 12:101455624-101455646 TGGAATAAGCAGATTGGGAAAGG - Intergenic
1102079941 12:110089815-110089837 AGGCATAAGAGAAATGGGGGTGG - Intergenic
1102213024 12:111140674-111140696 AGGCAAAATCAGAATAGGGGTGG + Intronic
1102730632 12:115105902-115105924 AGACATAACCAGGAAGGGGAGGG - Intergenic
1102955308 12:117054897-117054919 AGGCCCCAGCAGCATGGGGAGGG + Intronic
1103149720 12:118626568-118626590 TGGCATAGGCAAAATTGGGAGGG + Intergenic
1103462902 12:121119247-121119269 AGGCATAAGAGAAATGGGGGTGG + Intergenic
1104521786 12:129482193-129482215 ACGCATAAGCACAGTGGAGATGG - Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107566351 13:41609277-41609299 AGGCATATGCAGAATGAGGTCGG - Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1112742643 13:102492616-102492638 AGGCAGCAGCAGCATTGGGAGGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1116414811 14:44667278-44667300 AGGCTTAGGGAGATTGGGGATGG + Intergenic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1116849886 14:49897811-49897833 AGCCATAATCTGAATGGTGATGG + Intergenic
1117217629 14:53568227-53568249 AGGGATAAGCAAGATGGGTATGG + Intergenic
1119195855 14:72716110-72716132 AGGCAACAGCAGACTGGGGAAGG + Intronic
1119593592 14:75913282-75913304 AGGAATAGGCATATTGGGGAGGG - Intronic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121882289 14:97511678-97511700 AGGCATAATAAGGGTGGGGAGGG - Intergenic
1124891100 15:33733793-33733815 AGGGATAATGATAATGGGGAAGG + Intronic
1125716557 15:41822943-41822965 AGGCTTGAGGAGGATGGGGATGG - Exonic
1125874807 15:43134197-43134219 AGGAAGAGGCAGCATGGGGAGGG - Intronic
1125925483 15:43559509-43559531 ATGCATGAACAGGATGGGGATGG + Intronic
1125938625 15:43659060-43659082 ATGCATAATCAGGAAGGGGATGG + Intronic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1127268146 15:57377254-57377276 CGGCATAAGCAGAGTCGGGAGGG - Intronic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1127857028 15:62961419-62961441 AGGATTGAGCAGAACGGGGAAGG + Intergenic
1128502186 15:68234284-68234306 AGAGATAAGCAGAATGTGGGTGG + Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129467691 15:75733090-75733112 GGGCATCAGCAAAATGGGGCCGG - Intergenic
1129893170 15:79085328-79085350 TGGCCTAAGCAGGATGAGGAAGG + Intronic
1130871796 15:87977793-87977815 AGGCATTTGCAGAATCGGGCTGG + Intronic
1131408104 15:92183275-92183297 AGACAGAAGTAGTATGGGGAGGG - Intergenic
1131553102 15:93374750-93374772 AGGCAGAGGCAGGATGGGGTTGG + Intergenic
1132242196 15:100266500-100266522 GGGCTTAAGCAGAAGAGGGATGG - Intronic
1135587747 16:23683828-23683850 AGCCATAAGCAGAATGTGAAGGG - Intronic
1137573573 16:49583037-49583059 AGGCAGGAACAGAAAGGGGAAGG - Intronic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1138529568 16:57627837-57627859 AGGAATGACCAGAAGGGGGATGG + Intronic
1139282822 16:65784810-65784832 AGGCAGAAGCAGAGTGGAAAGGG + Intergenic
1141064022 16:80899584-80899606 AGACATGAGGAAAATGGGGAAGG - Intergenic
1142769376 17:2085662-2085684 AGCCACGAGCAGAATGGGGAGGG + Intronic
1144799351 17:17914379-17914401 AGGCCTAGGAAGAATGGGGGTGG - Intronic
1146299435 17:31676700-31676722 AGGTATGAGCAGAAAGGGGCAGG + Intergenic
1148725389 17:49786072-49786094 AGGTATATTTAGAATGGGGAAGG - Intronic
1150316590 17:64174377-64174399 ACTAGTAAGCAGAATGGGGAGGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1152314299 17:79571389-79571411 AGGCATAGGCAGAAGGGAGAGGG - Intergenic
1153225786 18:2898605-2898627 AGACATGAGCAGAAAGGGGTGGG - Intronic
1153729763 18:7999027-7999049 AGGAATAAGCAGATTGGAAAAGG - Intronic
1154053295 18:10983974-10983996 AGGAATAAGAAGAATGGAGCAGG + Intronic
1154338667 18:13485518-13485540 AGCCACAAGCAGCATGAGGATGG - Intronic
1155057576 18:22198359-22198381 AAGCATAAGCAGGCTGGGCACGG - Intronic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1163117573 19:15197665-15197687 AGGCAACAGCTGCATGGGGATGG + Intronic
1164714087 19:30378975-30378997 AGGCATAAGGAGTGTGGGGAGGG + Intronic
1164753180 19:30670948-30670970 AGGGATGGGCAGAATGGGGTGGG - Intronic
1165304185 19:34993564-34993586 AGACAAAAGTGGAATGGGGAGGG + Intergenic
1165423994 19:35735746-35735768 AGGCAAAAGAAGAATGGGTTTGG - Intronic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166233803 19:41441671-41441693 AGGCAAGAGATGAATGGGGATGG + Intergenic
1166591153 19:44000483-44000505 AGGCAAAAGCAGTAGGAGGAGGG + Intergenic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
925322875 2:2990399-2990421 AGGCAGTAACAGAATGGGAAGGG + Intergenic
925615394 2:5740487-5740509 AGCCAGAGGCAGAATGGGTAAGG - Intergenic
926040334 2:9667608-9667630 AGGCAGAAAAGGAATGGGGACGG + Intergenic
926759932 2:16269452-16269474 GGGCAAAAGTAAAATGGGGAAGG - Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
927114328 2:19886261-19886283 AGGCATTGGCAGAATGTGGAGGG - Intergenic
927684666 2:25161977-25161999 AGGCAGAAGCATGAAGGGGATGG - Intronic
927840630 2:26440705-26440727 AGGAACAAGATGAATGGGGACGG - Intronic
928240801 2:29584050-29584072 AGGCAAAAGCCAAATGGGGTAGG + Intronic
928272727 2:29871495-29871517 AGGCACAAGCAGCATGGAAAAGG + Intronic
929500988 2:42491956-42491978 AGGAATAAGCAGACTAAGGATGG - Intronic
932089029 2:68788446-68788468 AGGGATGATCAGACTGGGGAAGG + Intronic
932148143 2:69342885-69342907 AAGCATTAGGGGAATGGGGACGG - Intronic
932890184 2:75588172-75588194 AGGCACAAGCAGATTTGTGAAGG + Intergenic
934050014 2:88201987-88202009 AGGCATCTGCAGGAAGGGGACGG + Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
937085253 2:119167405-119167427 AGGCATGAGCAGGGAGGGGAGGG - Intergenic
938712826 2:133990311-133990333 TGGCATAAGCATCATGGGCAGGG + Intergenic
941562439 2:167064659-167064681 AGGCACAAGGAGAATGGAAAGGG - Intronic
942891758 2:180998444-180998466 TGGGATAAGGAGAGTGGGGAAGG + Intronic
946328901 2:218999039-218999061 AGGCATACGCTGGATAGGGAGGG - Intergenic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
946749726 2:222881848-222881870 AGGCATAAGTAGGAGGGGAAAGG - Intronic
1169030546 20:2403543-2403565 GGGCATGAGCAGCATGGGTAAGG - Intronic
1169641604 20:7758425-7758447 AGGGGTAGGGAGAATGGGGAGGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172254063 20:33501478-33501500 AGGGAAATGCAGAATGGTGAGGG + Intronic
1174515338 20:51087804-51087826 AGGGACCAGCAGCATGGGGATGG - Intergenic
1175274425 20:57758294-57758316 TGGCATTAGCAGGATGTGGATGG + Intergenic
1176025884 20:62985501-62985523 TGGCATAAGATGATTGGGGAGGG - Intergenic
1177397666 21:20558327-20558349 CTGCATAACCAGAATGGAGATGG - Intergenic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1178572668 21:33754712-33754734 ACACATAAGCAGAGTGGGAATGG - Intronic
1179489711 21:41733459-41733481 AGGCATATCCAGAGTGGGGCTGG - Intergenic
1180142916 21:45903161-45903183 AGGCATATGGAGACTGGGGAAGG + Intronic
1180754670 22:18152700-18152722 AGGTCTAAGGAGGATGGGGAGGG - Intronic
1182609749 22:31537294-31537316 AGGCAGAAGCAGAATGCAGTGGG - Intronic
1182784900 22:32899237-32899259 AGGCATCAGAAAAGTGGGGAAGG - Intronic
1182880247 22:33726834-33726856 AGGCATGATCCGAGTGGGGAGGG - Intronic
1203290488 22_KI270735v1_random:32498-32520 AGGGATGAACAAAATGGGGAAGG + Intergenic
949167466 3:959517-959539 ATATATAAACAGAATGGGGATGG + Intergenic
949758327 3:7439483-7439505 AGACAGAAGCAGCATGGGCAGGG - Intronic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
955005533 3:54965314-54965336 AGGCTTGAGAAGAATGGGAACGG - Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
959395138 3:105827603-105827625 AGCCAAAGGCAGAAAGGGGAGGG + Intronic
959693586 3:109225111-109225133 ATGCCTAGGCAGAAAGGGGAGGG - Intergenic
959971765 3:112417533-112417555 AGACATAAGCAGCAAGAGGAGGG + Intergenic
961511560 3:127406870-127406892 AGGCATGTGAAGAGTGGGGAGGG + Intergenic
961536322 3:127573153-127573175 AGGCCAAAGCACCATGGGGATGG + Exonic
963018043 3:140844519-140844541 AGGCATAATCAGGAAGGGAAGGG + Intergenic
963097315 3:141557701-141557723 AGGTGTAAGAAAAATGGGGAGGG + Intronic
964470106 3:157043528-157043550 AGGCATAGGCAGCATGGAGCAGG + Intronic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
964630965 3:158809888-158809910 AGGCATAAGCACCATGGTAAGGG - Intronic
964857528 3:161162823-161162845 AGGCAGAAGCATGATGGGTAGGG + Intronic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
966405468 3:179592990-179593012 AAACGTAGGCAGAATGGGGAAGG - Intronic
968294767 3:197567477-197567499 AGGCAAAAGCAGGACAGGGAGGG - Intronic
970765824 4:19547757-19547779 AGGCATAAGTAGAAAGAAGATGG + Intergenic
970798616 4:19945672-19945694 AGGCATAAGCAGGCAGGAGAGGG + Intergenic
971251264 4:24975321-24975343 AGACAAAAGGAGAAGGGGGAAGG + Intronic
971917117 4:32885621-32885643 AGGGATTATAAGAATGGGGAAGG - Intergenic
973785885 4:54332301-54332323 AGGCATGAGAAGGAAGGGGAGGG + Intergenic
974794737 4:66733920-66733942 AGGCTTCAGCAAAATGTGGATGG + Intergenic
974980405 4:68949346-68949368 AGGCCTAAGAAGAAGTGGGATGG + Intronic
976381275 4:84402012-84402034 AAGGTTAAGCAGAATGGGGCTGG + Intergenic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
978393596 4:108253889-108253911 AGGCTTTATCAGATTGGGGAGGG - Intergenic
979154126 4:117360821-117360843 AGACATAAGCAGAGTGGAGAGGG - Intergenic
982787792 4:159556712-159556734 AGGCATAAGAAGAATGAATAGGG + Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984386238 4:179061951-179061973 AGACATAAGCAGAAAGTGAAGGG + Intergenic
985040030 4:185880888-185880910 AGGCATAAGCAGGATGAAAATGG + Intronic
985494710 5:198012-198034 GGGCAGAAGGAGAAAGGGGATGG - Exonic
986150532 5:5125854-5125876 AGTAATAAGCTTAATGGGGAAGG + Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
988776623 5:34482847-34482869 AGGGTTAAGGAGAAAGGGGAAGG + Intergenic
989774020 5:45181118-45181140 AGACATAAGCAGGACAGGGAGGG - Intergenic
991461308 5:66862044-66862066 AGGCATGAACAGAATGGCCAGGG - Intronic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994822730 5:104675141-104675163 GGGCATAGGCAGCATGGGGCTGG + Intergenic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
996140067 5:119895979-119896001 AGGCAAAAGAAGTCTGGGGAAGG - Intergenic
998848687 5:146334627-146334649 AGGCAGTAGTAGCATGGGGAAGG - Intronic
1001771824 5:174302582-174302604 AAGCTTAAGCAGAATGCTGAGGG - Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002393862 5:178938327-178938349 AAGCGTAAGCAGACTGGTGATGG + Intergenic
1002473243 5:179450086-179450108 AGGCAGAAGGAGCAAGGGGAGGG + Intergenic
1002480978 5:179500567-179500589 AGGCAGAAGGAGCAAGGGGAGGG - Intergenic
1007054855 6:38872624-38872646 AGGCGCAAACAGAATGCGGAAGG + Exonic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1009782879 6:68293066-68293088 AGGAAGAGGAAGAATGGGGAGGG + Intergenic
1011187007 6:84688757-84688779 AGGGATAAGCAGAACGGAGAAGG + Intronic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011494978 6:87928586-87928608 AGGCAAAAGGACGATGGGGAGGG + Intergenic
1012502521 6:99904722-99904744 AGGCAAAAGGAGTATGGCGATGG + Intergenic
1013324995 6:109036139-109036161 AGGAGTCATCAGAATGGGGAGGG + Intronic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1018374499 6:163198392-163198414 ATGCATAAGCAGTATGGAGATGG - Intronic
1018818073 6:167350816-167350838 AGGCATAAGCAGAAGAGGAAAGG + Intronic
1019230072 6:170553071-170553093 AGGCTTCAGCAGATGGGGGAAGG + Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1021311357 7:19101714-19101736 AGGCAGGAGAAGAATGGGGGTGG + Intronic
1022198865 7:28096131-28096153 AGGGATAAGCAGAACTGAGAGGG + Intronic
1022303989 7:29129110-29129132 AGGCTTAAGGAGAATCAGGATGG + Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022785302 7:33632105-33632127 TGGCATAAGGAGAACGGGGTAGG + Intergenic
1023126169 7:36956362-36956384 AGGCATATGCAGAATTTGAAGGG - Intronic
1023998521 7:45176653-45176675 AGGCATGAGGAGGAAGGGGAGGG + Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026748291 7:73029714-73029736 AGGCACAAACTGAATGCGGAAGG + Intergenic
1026751939 7:73057859-73057881 AGGCACAAACTGAATGCGGAAGG + Intergenic
1026755588 7:73085986-73086008 AGGCACAAACTGAATGCGGAAGG + Intergenic
1027034493 7:74915026-74915048 AGGCATAAACTGAATGCGGAAGG + Intergenic
1027091812 7:75307406-75307428 AGGCACAAACTGAATGCGGAAGG - Intergenic
1027095455 7:75335373-75335395 AGGCACAAACTGAATGCGGAAGG - Intergenic
1027323886 7:77032309-77032331 AGGCACAAACTGAATGCGGAAGG + Intergenic
1028603482 7:92628992-92629014 AGGATTAAGGAGAGTGGGGAGGG + Intronic
1029033986 7:97499343-97499365 AGGGAAAACCAGATTGGGGAGGG + Intergenic
1029395562 7:100306101-100306123 AGGCACAAACTGAATGTGGAAGG - Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG + Intergenic
1033443697 7:141402408-141402430 AGGAATGAGCAGCAGGGGGAGGG - Intronic
1033534396 7:142298687-142298709 AGCCATAAGTAGAAAGAGGAAGG + Intergenic
1034318369 7:150155795-150155817 AGGAATGAGCAGAGAGGGGAGGG - Intergenic
1034359146 7:150478714-150478736 AGGAATAAGCAGGCTGGGGCTGG + Exonic
1034774382 7:153811437-153811459 AGGAATGAGCAGAGAGGGGAGGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1037292523 8:17366439-17366461 CAGCATCAGCAGAATGGGAAGGG + Intronic
1039328716 8:36513404-36513426 AGGTCTAAACAGAATAGGGAAGG - Intergenic
1040525931 8:48225359-48225381 AGGCATCTGAAAAATGGGGAAGG - Intergenic
1041003973 8:53481508-53481530 AAGGATGAGCAGCATGGGGATGG - Intergenic
1041512425 8:58666610-58666632 AGGCAGAAGCAGGTTGGGAATGG + Intergenic
1044708964 8:95036947-95036969 ATGCTCCAGCAGAATGGGGAAGG - Intronic
1045902875 8:107306167-107306189 AGACACTAGCAGAATGTGGAAGG + Intronic
1046178796 8:110614869-110614891 ATCCTTAAGAAGAATGGGGATGG + Intergenic
1046766321 8:118074064-118074086 AGGCAAAACCGGAATGGGGGTGG + Intronic
1050538467 9:6649984-6650006 AGCCAAAAGCAGATTGAGGAGGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051351888 9:16205064-16205086 AGGACTAAGCACACTGGGGACGG + Intronic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1052819951 9:33130595-33130617 AGGCATAAGCCAAATGGGAGTGG + Intronic
1053091488 9:35281925-35281947 GGGAATAAGAAGAGTGGGGAAGG + Intronic
1053341293 9:37336472-37336494 TGGAATAAGCAGAGTTGGGATGG + Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1058832918 9:108835398-108835420 AAGCATAGGCAGAATGGGCATGG + Intergenic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061805622 9:133136222-133136244 AGGCAAAAACAGAACAGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1187487351 X:19717031-19717053 AGGGATATGCAGAATGGCAATGG + Intronic
1187600588 X:20825018-20825040 TGGAATTAGCAGAATTGGGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188913443 X:35879711-35879733 AGGGATCAGAAGACTGGGGATGG - Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1193520568 X:82524239-82524261 AGCCATATGCGGAATGGGGAAGG + Intergenic
1196098321 X:111823268-111823290 AGGCCCAGGCAGAATGGGGGAGG + Intronic
1196331610 X:114476797-114476819 AGGGAAAAATAGAATGGGGATGG + Intergenic
1196410954 X:115417997-115418019 AGGAATAAACTGAATGGGTATGG - Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197742319 X:129904819-129904841 GGGCAAAAGCAAAATGGGAATGG + Intergenic
1198082496 X:133252627-133252649 AGGCCCAAGCAAGATGGGGAAGG + Intergenic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic