ID: 952342412

View in Genome Browser
Species Human (GRCh38)
Location 3:32457275-32457297
Sequence AAGCAAACCCTACTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952342407_952342412 24 Left 952342407 3:32457228-32457250 CCAAAGGGGGAAGGAGATGAGAA 0: 1
1: 0
2: 2
3: 30
4: 392
Right 952342412 3:32457275-32457297 AAGCAAACCCTACTTCTCACTGG 0: 1
1: 0
2: 0
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952342412 Original CRISPR AAGCAAACCCTACTTCTCAC TGG Intronic
902049488 1:13550936-13550958 AAGCAAACACAAATTCTCTCCGG + Intergenic
902281386 1:15377285-15377307 AATCAAACCCTACTTCCCTGAGG + Intronic
906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG + Intronic
909898322 1:81102134-81102156 AAGGCAACCCTGCTTCTCTCAGG - Intergenic
911102207 1:94103892-94103914 AAAGAAACCCTGCTTCCCACAGG - Intronic
911561184 1:99407396-99407418 AAGCAATGCCTACTCCTCAATGG - Intergenic
915848646 1:159297321-159297343 AGGCAAAACCTTGTTCTCACAGG - Intronic
916392646 1:164347612-164347634 AAACAAAACCTACTACTCATTGG + Intergenic
917138467 1:171810725-171810747 AAGGAAACCCTTTTTCTAACTGG - Intronic
923694717 1:236236464-236236486 AAGCAAACCGGACTACTCAAAGG + Intronic
923761296 1:236847478-236847500 AAGTAAAGCCTTCTACTCACTGG + Intronic
1064926730 10:20577793-20577815 AAGCAAACCCTTCCCCTCAAAGG - Intergenic
1066994638 10:42552557-42552579 AATCCAACCTTACTTATCACAGG + Intergenic
1068816734 10:61324019-61324041 AATCAAATCCTATTTGTCACTGG + Intergenic
1068895241 10:62191571-62191593 AAGCAATCCCTACCTGCCACTGG - Intronic
1071165688 10:82803745-82803767 AAGACAACAATACTTCTCACAGG + Intronic
1071479080 10:86049559-86049581 AGGCAAAGGCTGCTTCTCACTGG + Intronic
1076168010 10:128297730-128297752 AAGCAAACCTCACCTTTCACTGG - Intergenic
1077660607 11:4065278-4065300 AAGCAACCACTCCTGCTCACTGG - Intronic
1077701640 11:4447490-4447512 TAGCATATCCTACTTCCCACTGG - Intergenic
1079151619 11:17904879-17904901 CATCAAAGCCTAATTCTCACAGG + Intronic
1079268278 11:18956919-18956941 AAGCAAACCCTGAGCCTCACAGG - Intergenic
1080407920 11:31996408-31996430 AATCACACGCTACTTCTCTCTGG - Intronic
1080677897 11:34444766-34444788 AAGCCAACCTTACTCCTCCCAGG + Intronic
1082074088 11:47962813-47962835 AACCAAATCCTAATTCTCAAAGG - Intergenic
1085719306 11:78899036-78899058 AAACAGACCCCACTTCTCAGTGG - Intronic
1086348309 11:85920463-85920485 AAGCAAATACCACTTCTCTCAGG + Intergenic
1087825417 11:102759480-102759502 AATCCAACCCTACTTCTAACTGG + Intergenic
1090777153 11:129975647-129975669 AGGCAAACCCTGCCTCCCACTGG + Intronic
1093076744 12:14766716-14766738 AAGCAAATGCTAATTCTCTCTGG + Intergenic
1095596411 12:43964017-43964039 AAGCAAATCCAACATCTCAGTGG + Intronic
1102377121 12:112431513-112431535 AAAAAAACCCTGCTTCTCAGGGG - Intronic
1104618430 12:130290719-130290741 TAGCAAAGCCTACCTCCCACTGG + Intergenic
1106927149 13:34624816-34624838 AAGCAAAAACTGCTTCTCAAAGG + Intergenic
1107733589 13:43373179-43373201 AAGCATATCCTACTTCTCGGTGG + Intronic
1108149394 13:47516899-47516921 AGGCAAACCCCACTTCCCAAAGG - Intergenic
1108301838 13:49085384-49085406 AAGCAAAGCCCTCTTCTCTCAGG + Intronic
1109155881 13:58908425-58908447 AAACAAATTCTACTTCTCAATGG + Intergenic
1109378653 13:61527935-61527957 AAACAAACCCTAAATCTCAGTGG + Intergenic
1110043765 13:70801124-70801146 AGGGAATCCCTACTTCTCAATGG + Intergenic
1111029061 13:82572016-82572038 AAGCAAACCCTCTTTCTGCCTGG - Intergenic
1112217309 13:97446501-97446523 AAACAGATCCTACTTCTCAATGG - Intronic
1113307937 13:109098301-109098323 AAACAAAACTTACTTCTCATTGG - Intronic
1115706469 14:36004093-36004115 AAGCAAACCTCATTTCTTACAGG + Intergenic
1117008694 14:51448468-51448490 CAGCAAACACTATTTATCACCGG - Intergenic
1127254224 15:57275235-57275257 CAGAAAAGCCTACTTCTCCCCGG + Intronic
1131589580 15:93733840-93733862 ATGTAAACCCTACTTCATACAGG - Intergenic
1133619613 16:7513746-7513768 AAGCAGCCCCTTCTCCTCACTGG - Intronic
1134014340 16:10878206-10878228 AAGCAAACCATACATTTCAGGGG - Intronic
1137298945 16:47127398-47127420 AAGTGCACCCTACTACTCACAGG - Intronic
1140063009 16:71587750-71587772 AAATAAACTCTACGTCTCACTGG - Intergenic
1142535062 17:609135-609157 AAGCAACCCCTACCTGTTACTGG + Intronic
1142765960 17:2064547-2064569 AAGCAAAGCCCACTATTCACTGG + Intronic
1147964576 17:44187249-44187271 TAGCCGACCCTACTCCTCACTGG + Intronic
1150283160 17:63940966-63940988 AAGCAGCCCCTCCTTCTCAGGGG + Exonic
1155372381 18:25115326-25115348 AAGCAAATCCTACTGCTGAAAGG + Intronic
1156795023 18:41034397-41034419 AAGCAAACAAAACTCCTCACAGG - Intergenic
1157564936 18:48673509-48673531 AAACAAACCCCACATCTCAGTGG + Intronic
1162613681 19:11777648-11777670 CAGCAAAGCCCACTCCTCACAGG - Exonic
1166988170 19:46674741-46674763 AAGCTAACCCCAGTTCTCTCGGG - Intronic
925710182 2:6731536-6731558 AAGAAACCCCTTCTTCTCACAGG + Intergenic
928615481 2:33034670-33034692 AAGCAAACCCAACTTCCAAATGG - Intronic
929692766 2:44088026-44088048 AAGCACACACTATTTCTTACGGG + Intergenic
937015133 2:118598257-118598279 AATCTATCCCTACTTCACACTGG + Intergenic
938641143 2:133281735-133281757 AAGCAACCCCTAGATCTCAGTGG + Intronic
942744938 2:179221270-179221292 AAGCAACTCATACATCTCACTGG - Intronic
943054792 2:182962798-182962820 AATCAAACCCTATTGCTCCCAGG + Intronic
943154521 2:184157140-184157162 AAGAGAACCCAAATTCTCACTGG - Intergenic
944233275 2:197417208-197417230 AAGAAAACCCTATTTTTCAGTGG - Intronic
945729480 2:213515902-213515924 GAGCAATTCCTACTTCACACCGG - Intronic
1170805963 20:19632099-19632121 AAGCAAACCTTTCTTCTCTCAGG + Intronic
1172197623 20:33102930-33102952 AGGCAATCCCTGCTTCTCACAGG + Intronic
1173670688 20:44796643-44796665 AAGCACACCCTTCTTCTCTAGGG - Intronic
1177327813 21:19615045-19615067 AAGCAAACCCCATTTCTCTAAGG + Intergenic
1178756305 21:35353382-35353404 AAGCAAAGCAAACTTCTTACTGG - Intronic
1183278549 22:36918476-36918498 AAGCCATGCCTAGTTCTCACTGG - Intronic
1184647200 22:45902829-45902851 AACCAAACCCTCCATGTCACGGG - Intergenic
1184667204 22:45995333-45995355 AAACTCACCCTACTTCTCATGGG - Intergenic
949511754 3:4772533-4772555 AAGCAAAGCCAGCTTCTCAGGGG - Intronic
949995122 3:9610632-9610654 CAGCAAAGCCTCCTTCCCACAGG + Intergenic
950014398 3:9745597-9745619 GGGCAAACCCTCCTTCTCTCGGG + Exonic
950680817 3:14583898-14583920 AAGGAGACCCTCCTTTTCACAGG - Intergenic
950872546 3:16242215-16242237 AAGCAGACCCCACTTATCAAAGG + Intergenic
951568816 3:24040551-24040573 AAGCAAACACAAATCCTCACTGG - Intergenic
951702127 3:25507284-25507306 AGGCAAACCCATCTTCTCCCTGG + Intronic
951742466 3:25939559-25939581 AAGCAATCCATCCTTCTCAAAGG + Intergenic
952342412 3:32457275-32457297 AAGCAAACCCTACTTCTCACTGG + Intronic
952410043 3:33040308-33040330 AAGCAAATGCTAATTCTCTCTGG + Intronic
952868378 3:37874117-37874139 AAGCAAACTCTTCTAGTCACTGG - Intronic
955161084 3:56466562-56466584 AGGCAAACTCTACTACTCCCCGG + Intronic
957054095 3:75431200-75431222 CAGCAAACCCTGGTTCACACTGG - Intergenic
960155616 3:114294745-114294767 CAGGAAACCCTGCTTCTCCCAGG - Intronic
960241964 3:115354453-115354475 TAGCAAAGCTTACTTCTCAAGGG - Intergenic
960360867 3:116709595-116709617 AAGGAAACACTAATTCTCAGAGG - Intronic
961948930 3:130725919-130725941 AAGTAAAGCCTATTTCACACTGG + Intronic
966030875 3:175346522-175346544 AGTCAAACCCTAATTTTCACTGG - Intronic
966036889 3:175428688-175428710 AAGCCAACTTTAATTCTCACTGG + Intronic
966125629 3:176572972-176572994 AAGCAAACAATGCTTCTGACTGG + Intergenic
967545121 3:190716637-190716659 AAGCAAAACATCCTGCTCACTGG - Intergenic
968283610 3:197495254-197495276 ATGCAAACCCTACCCCTCCCGGG + Intergenic
970560775 4:17280213-17280235 AAGCAAAACCGAATTCTCCCTGG - Intergenic
971539781 4:27801359-27801381 AAGCAGACCCCACCTCACACTGG - Intergenic
972606057 4:40614931-40614953 TTGTAAAACCTACTTCTCACGGG + Intronic
973839689 4:54848451-54848473 AAGCAACCACTACATCTCAGTGG - Intergenic
974021001 4:56692388-56692410 AAGCACAACCAACTGCTCACTGG + Intergenic
974341538 4:60619737-60619759 CAGGAAACCCTACTTATGACAGG + Intergenic
976216988 4:82724796-82724818 TAGCAAGCCCCACTGCTCACAGG - Intronic
977061569 4:92264338-92264360 AAGTTAATCCCACTTCTCACTGG + Intergenic
980169731 4:129274753-129274775 AAACAAACCCTATTTCTTATAGG - Intergenic
980816233 4:137950092-137950114 AAACCAATCCTAGTTCTCACTGG - Intergenic
982127367 4:152196117-152196139 CAGCAGACCCTACTGCTCACGGG - Intergenic
985219673 4:187690871-187690893 AAGCAAACCTTGCTTCTGCCAGG - Intergenic
987784955 5:22487717-22487739 AAGCAAAACCTACTTACCTCAGG + Intronic
994722388 5:103395301-103395323 AAGCAAAGTTTAATTCTCACTGG + Intergenic
998555546 5:143119681-143119703 AAGCAAATCCTCTTTCTAACTGG + Intronic
1001703082 5:173721552-173721574 AAGCAAACCAAACTTGTCCCTGG + Intergenic
1006360562 6:33584814-33584836 AAGCAGACACTCCTTCTCCCTGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1011053613 6:83181832-83181854 AATGGAACACTACTTCTCACAGG - Exonic
1018825810 6:167407311-167407333 AAGTAGACCCCACTTCTCTCTGG - Intergenic
1019708571 7:2507992-2508014 AAGCAGACCCTACCTGTCTCTGG + Intergenic
1022071581 7:26921290-26921312 ATGGAAACCCTGCTTCTTACAGG - Intronic
1023434026 7:40123557-40123579 AGCCAAACCCAACTTCACACAGG + Intergenic
1024864229 7:53885937-53885959 AGGCAAACCCATCTTCTCAGAGG - Intergenic
1026141627 7:67711852-67711874 AACCAAACCCTACACTTCACTGG - Intergenic
1028606609 7:92662570-92662592 AAGAAAACATTAATTCTCACGGG + Intronic
1037220214 8:16509968-16509990 AAGCAGATCCTTCTTCTCCCAGG + Intronic
1041969258 8:63718431-63718453 AAGCAATCCCAAAATCTCACTGG - Intergenic
1043045123 8:75313661-75313683 AAGCAGAACCTACATCTCAGAGG + Intergenic
1046036752 8:108852123-108852145 AAGGTAAGCCTCCTTCTCACAGG - Intergenic
1047765315 8:127985639-127985661 AAACAGACACTGCTTCTCACAGG - Intergenic
1047834360 8:128672184-128672206 AAACAAACTCTACGTCTAACAGG + Intergenic
1047968767 8:130067086-130067108 AAGCAAACTCAACTTATCCCAGG + Intronic
1048046418 8:130777401-130777423 AATCAAACCCCACATCTCACAGG + Intergenic
1049264869 8:141662494-141662516 AAGAAGACCCTTCTTCCCACTGG - Intergenic
1050848425 9:10253783-10253805 AGGCAAACTCTAATTTTCACAGG + Intronic
1051920588 9:22259292-22259314 TAGCAACCTCTACTTCTCAGAGG - Intergenic
1053288313 9:36864158-36864180 AAGCAAGCCCTTTTCCTCACAGG + Intronic
1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG + Intergenic
1194751636 X:97691671-97691693 AACCCAACCTTATTTCTCACTGG - Intergenic
1197625979 X:128803027-128803049 AAACAATTCCAACTTCTCACTGG - Intergenic
1201428659 Y:13883299-13883321 AAGCAAACACTCCTCCTCTCAGG + Intergenic