ID: 952342563

View in Genome Browser
Species Human (GRCh38)
Location 3:32458145-32458167
Sequence CTGCTCCTCCCTGGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 16, 3: 84, 4: 544}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952342563_952342573 14 Left 952342563 3:32458145-32458167 CCTGCTGCCCCAGGGAGGAGCAG 0: 1
1: 0
2: 16
3: 84
4: 544
Right 952342573 3:32458182-32458204 GGGCTGCTTCATGCTACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 131
952342563_952342572 13 Left 952342563 3:32458145-32458167 CCTGCTGCCCCAGGGAGGAGCAG 0: 1
1: 0
2: 16
3: 84
4: 544
Right 952342572 3:32458181-32458203 GGGGCTGCTTCATGCTACCTGGG 0: 1
1: 0
2: 1
3: 21
4: 177
952342563_952342574 15 Left 952342563 3:32458145-32458167 CCTGCTGCCCCAGGGAGGAGCAG 0: 1
1: 0
2: 16
3: 84
4: 544
Right 952342574 3:32458183-32458205 GGCTGCTTCATGCTACCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
952342563_952342571 12 Left 952342563 3:32458145-32458167 CCTGCTGCCCCAGGGAGGAGCAG 0: 1
1: 0
2: 16
3: 84
4: 544
Right 952342571 3:32458180-32458202 AGGGGCTGCTTCATGCTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 109
952342563_952342568 -8 Left 952342563 3:32458145-32458167 CCTGCTGCCCCAGGGAGGAGCAG 0: 1
1: 0
2: 16
3: 84
4: 544
Right 952342568 3:32458160-32458182 AGGAGCAGCTGCGGAAATGAAGG 0: 1
1: 0
2: 1
3: 21
4: 247
952342563_952342569 -7 Left 952342563 3:32458145-32458167 CCTGCTGCCCCAGGGAGGAGCAG 0: 1
1: 0
2: 16
3: 84
4: 544
Right 952342569 3:32458161-32458183 GGAGCAGCTGCGGAAATGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 199
952342563_952342570 -6 Left 952342563 3:32458145-32458167 CCTGCTGCCCCAGGGAGGAGCAG 0: 1
1: 0
2: 16
3: 84
4: 544
Right 952342570 3:32458162-32458184 GAGCAGCTGCGGAAATGAAGGGG 0: 1
1: 0
2: 1
3: 21
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952342563 Original CRISPR CTGCTCCTCCCTGGGGCAGC AGG (reversed) Intronic