ID: 952342565

View in Genome Browser
Species Human (GRCh38)
Location 3:32458152-32458174
Sequence TCCGCAGCTGCTCCTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952342565_952342572 6 Left 952342565 3:32458152-32458174 CCCCAGGGAGGAGCAGCTGCGGA 0: 1
1: 0
2: 6
3: 37
4: 323
Right 952342572 3:32458181-32458203 GGGGCTGCTTCATGCTACCTGGG 0: 1
1: 0
2: 1
3: 21
4: 177
952342565_952342571 5 Left 952342565 3:32458152-32458174 CCCCAGGGAGGAGCAGCTGCGGA 0: 1
1: 0
2: 6
3: 37
4: 323
Right 952342571 3:32458180-32458202 AGGGGCTGCTTCATGCTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 109
952342565_952342574 8 Left 952342565 3:32458152-32458174 CCCCAGGGAGGAGCAGCTGCGGA 0: 1
1: 0
2: 6
3: 37
4: 323
Right 952342574 3:32458183-32458205 GGCTGCTTCATGCTACCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
952342565_952342573 7 Left 952342565 3:32458152-32458174 CCCCAGGGAGGAGCAGCTGCGGA 0: 1
1: 0
2: 6
3: 37
4: 323
Right 952342573 3:32458182-32458204 GGGCTGCTTCATGCTACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952342565 Original CRISPR TCCGCAGCTGCTCCTCCCTG GGG (reversed) Intronic
900188140 1:1342469-1342491 TCCACAGCTGGTCCTGGCTGAGG - Exonic
900341927 1:2193700-2193722 ACGGCTGCTGCTCCACCCTGGGG + Exonic
900365272 1:2309669-2309691 CCCCCACCTCCTCCTCCCTGTGG + Exonic
900809436 1:4790190-4790212 GCAGCAGCTGCTGCTCCCAGGGG + Exonic
901093363 1:6658771-6658793 ACCTCAGCTGCTTCTCCCTTGGG + Intronic
901229346 1:7633361-7633383 TCTGCAGCTCTTCCTCTCTGAGG - Intronic
901462393 1:9399531-9399553 TCTGCAGCAGCACCTCCCTGGGG - Intergenic
901816115 1:11794447-11794469 TCTTCAGCAGCTCCTCCTTGGGG + Exonic
902225182 1:14992236-14992258 TCCTCCCCTGCTTCTCCCTGAGG - Intronic
902449307 1:16486502-16486524 CCCGCAGCTGCTCCTCCAGCTGG + Intergenic
902468701 1:16633217-16633239 CCCGCAGCTGCTCCTCCAGCTGG + Intergenic
902505441 1:16936775-16936797 CCCGCAGCTGCTCCTCCAGCTGG - Exonic
905446079 1:38029236-38029258 TGGGCAGCAGCTCCTCCCAGAGG + Intergenic
906796004 1:48696894-48696916 TCCGTGGCCCCTCCTCCCTGAGG + Intronic
907272432 1:53298769-53298791 TCCACAGCTCCGCCTCCCTTGGG + Intronic
910723651 1:90314888-90314910 TCCGCAGATTCTCCTCCCTGTGG + Intergenic
911057470 1:93720998-93721020 TCCGCAGGTGCTTCTGGCTGAGG + Intronic
911729363 1:101277025-101277047 TCAGCAACTGCTCCTCCTTAAGG - Intergenic
912413524 1:109493491-109493513 TCAGCAGCTGCTCAGCCCTGAGG - Intergenic
912557550 1:110527189-110527211 TATCCAGCTGCTGCTCCCTGAGG + Intergenic
914255314 1:145957747-145957769 GCCGCCGCTGCTCCTGTCTGGGG - Exonic
915476469 1:156155571-156155593 CCAGGAGATGCTCCTCCCTGAGG + Intronic
915559153 1:156676499-156676521 CCCGCAGCCGCTCCTGCCAGCGG + Exonic
915565031 1:156708293-156708315 TCCGTGCCTGCTGCTCCCTGGGG - Intergenic
916080064 1:161226721-161226743 TGGGCACCTGATCCTCCCTGAGG - Intronic
916091085 1:161308450-161308472 TCTACAGTTGCCCCTCCCTGGGG - Intronic
917442578 1:175080253-175080275 TCCTCAGCTACTACCCCCTGGGG + Exonic
918311013 1:183285305-183285327 TCCTTAGCTGCTCCTCCCACTGG + Intronic
919774742 1:201187211-201187233 TCCCCAGCTTCTCCTCATTGAGG + Intergenic
920365899 1:205448273-205448295 TGCGCAGCTGCACCTCCCATGGG - Intronic
920372123 1:205485611-205485633 TCCGCAGGTCCCCCTTCCTGGGG - Intergenic
921100356 1:211923552-211923574 TGCTCAGCTGCTCTTCTCTGGGG + Intergenic
921141352 1:212310026-212310048 TCCAAAGCTGCACCTCTCTGAGG - Intronic
921155649 1:212436273-212436295 ACAGCATCTGCTCCTGCCTGAGG - Intronic
923231001 1:231986216-231986238 TCCCCAGCTTCTCCTGTCTGGGG + Intronic
923470720 1:234288267-234288289 TTCGCAGCTGCTCCTGGCTTGGG - Intronic
1062988383 10:1791127-1791149 TCAGCAGCTTGTCCTGCCTGAGG - Intergenic
1063692412 10:8299129-8299151 TTAGCGGCTGCCCCTCCCTGGGG + Intergenic
1064143861 10:12812112-12812134 TCCTCAGCTGTTCCTCCCGTGGG - Intronic
1066369644 10:34809611-34809633 TCTGCAGCTGCTCCACCCCCTGG - Intronic
1069635745 10:69923796-69923818 TCGACACCTGCTTCTCCCTGGGG - Exonic
1069957608 10:72061516-72061538 TCGGCAGCTGCTTCTCTCCGGGG + Exonic
1070494664 10:77010585-77010607 TCCTAAGCTGCCCCACCCTGAGG + Intronic
1070546730 10:77458349-77458371 TGGGCAGGTCCTCCTCCCTGAGG + Intronic
1070693558 10:78545028-78545050 TCAGCAGCTGCCCCGCCCCGGGG - Intergenic
1071598312 10:86943598-86943620 ACTGCAACTCCTCCTCCCTGCGG + Exonic
1072553386 10:96495808-96495830 TCCCCAGCTGCTCCTGCCTGGGG + Intronic
1072682751 10:97518340-97518362 TCCCTAGCTGCCCCTCCCCGAGG + Intronic
1073288956 10:102403970-102403992 TCCGCACCTGCTCCTCCTAGCGG + Exonic
1074060690 10:109962820-109962842 ACCTCAACTGCTTCTCCCTGGGG + Intergenic
1074533985 10:114315623-114315645 CCCGCATCTGCGCCTTCCTGTGG - Exonic
1075019885 10:118944059-118944081 TGGGCAGCTCCACCTCCCTGGGG + Intergenic
1075144648 10:119872750-119872772 ACCGCAGCCGCCGCTCCCTGAGG - Exonic
1075871130 10:125773511-125773533 ACCCCAGCTGCTGCTCCCTAGGG + Intronic
1076680709 10:132169863-132169885 TTCGCACCTCCTCCTCGCTGCGG - Exonic
1076815025 10:132910338-132910360 GGCTCAGCTGCTCCTTCCTGCGG - Intronic
1076882961 10:133248399-133248421 TCCACAGCTGGGGCTCCCTGAGG + Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1076921659 10:133457528-133457550 TCCGCAGCGGCTGCGACCTGCGG + Intergenic
1077177509 11:1197417-1197439 TCCGCAGCGGCTCCACCCAGGGG - Intronic
1077297426 11:1832640-1832662 GCTGCACCTGCACCTCCCTGGGG + Intronic
1077393547 11:2310519-2310541 TCCCCATCTGCCCCTCCCAGTGG + Intronic
1077422675 11:2460370-2460392 TGGGCACCTGCTCCTCCCTTGGG - Intronic
1077425600 11:2474550-2474572 TCCACCGCTGCCCCTCCCTAAGG - Intronic
1078098279 11:8313585-8313607 CCTGCAGCTGCTCTTCCGTGTGG - Intergenic
1080792031 11:35529966-35529988 TCCTCTGCTGTTTCTCCCTGTGG - Intronic
1081598595 11:44476340-44476362 TCCTCACTTGCTCCTCCCTTGGG - Intergenic
1081615901 11:44591097-44591119 TCAGCACCTTCTCCTCCCTCGGG + Intronic
1082959380 11:58904398-58904420 TGTGCAGATGCTCCTCCCTAAGG + Intergenic
1082966117 11:58967603-58967625 TGTGCAGATGCTCCTCCCTAAGG + Intronic
1082974927 11:59061916-59061938 TGTGCAGATGCTCCTCCCTGAGG + Intergenic
1082979353 11:59105650-59105672 TGTGCAGATGCTCCTCCCTGAGG + Intergenic
1083571353 11:63763717-63763739 TCCGCCGCTGCTCCCGGCTGCGG + Exonic
1083940107 11:65891158-65891180 CCCGCAGCAGCTCCTCCTGGCGG - Exonic
1084432283 11:69117746-69117768 TCCTCAGATGGTCTTCCCTGTGG - Intergenic
1084485046 11:69443363-69443385 TCCCCTGCTCCTCCTCCCTCGGG + Intergenic
1085296180 11:75433067-75433089 TCCGCAGCTGCTGCTCTCACAGG + Intergenic
1085514319 11:77103477-77103499 TCCTCCTCTGCTTCTCCCTGGGG + Intronic
1087926160 11:103921049-103921071 TCCTCAGTTGCCCCTCCATGTGG + Intronic
1088911065 11:114192947-114192969 TCCACAGCTGCTCATCCCTCGGG - Intronic
1089296003 11:117468678-117468700 TGGGCAGCTGGTCCTTCCTGGGG - Intronic
1089367336 11:117929077-117929099 CCAGCAGCTTCTCCTCCCAGGGG + Intronic
1089556333 11:119317497-119317519 TCCGCTACTGCTCCTCCCCCAGG - Intronic
1090472271 11:126990656-126990678 TCCGCAGTTGCCCCTCACTCAGG + Intronic
1090585479 11:128207467-128207489 TCCCAAGCTGCTCACCCCTGTGG - Intergenic
1091410757 12:237640-237662 TCCGCACTTCCTCCTCCCTGTGG - Intronic
1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG + Intronic
1092205837 12:6613820-6613842 TCCCCCGCTGCTCCCCCCTCTGG + Intergenic
1094738598 12:33262624-33262646 CCAGCAGCTGCCCCTTCCTGTGG - Intergenic
1094834376 12:34315418-34315440 TTCCCAGCAGCTCCTGCCTGGGG - Intergenic
1095626417 12:44319484-44319506 TGCCCACCTTCTCCTCCCTGGGG + Intronic
1096529789 12:52235310-52235332 TCCGCAGCTCCGCCTCCAGGCGG - Exonic
1097044348 12:56176326-56176348 TCCACAGCTTCCCCTCTCTGGGG - Intronic
1100156431 12:91805015-91805037 TCCTCAGCTGGTCCAGCCTGGGG + Intergenic
1101210433 12:102530084-102530106 TTAGCTGCTTCTCCTCCCTGGGG - Intergenic
1102554636 12:113718978-113719000 CCTGGGGCTGCTCCTCCCTGGGG + Intergenic
1103984017 12:124755231-124755253 TCCCCATCTGCCCTTCCCTGGGG + Intergenic
1104169379 12:126265317-126265339 GCAGCAGATGCTCCTGCCTGGGG + Intergenic
1104860775 12:131922312-131922334 TCCCCTGCCGCCCCTCCCTGTGG + Exonic
1104983045 12:132582518-132582540 TCCCCGGCGACTCCTCCCTGCGG + Intronic
1105645346 13:22312115-22312137 TCCCCAGCTGCTTCTGGCTGGGG + Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1105735684 13:23267898-23267920 TTTGAAGCTTCTCCTCCCTGTGG - Intronic
1108178508 13:47818762-47818784 TCCACAGATGCTACTTCCTGGGG - Intergenic
1108510236 13:51148909-51148931 CAGGCAGCTGCTCCTTCCTGGGG + Intergenic
1110725373 13:78816838-78816860 CCTGCAGCTGGGCCTCCCTGTGG - Intergenic
1117714040 14:58562750-58562772 CCCCCAGCTGCTCCTCTCTGAGG - Intergenic
1118708861 14:68503384-68503406 TCAGCTGTTTCTCCTCCCTGAGG - Intronic
1119757810 14:77131080-77131102 TCTGCCCCTGCTCCTCCCTGGGG - Intronic
1122613425 14:103001110-103001132 TCCACAGCTGTCCCACCCTGTGG + Intronic
1122929911 14:104928412-104928434 TCAGGAGCAGCTGCTCCCTGTGG + Intronic
1123215712 14:106807523-106807545 TCCGCACCTGCTCTTCCCTGGGG + Intergenic
1124648407 15:31456882-31456904 TCCTCTGCTCCTCCTCCCTATGG + Intergenic
1124654584 15:31498068-31498090 TCCACAGCTCCTCTTCCCTTTGG - Intronic
1131513205 15:93060970-93060992 TCTCCAGCTGCTCCTCTCTTTGG + Intronic
1132091878 15:98953941-98953963 TCCACAGCCGCTCCTGGCTGAGG + Intronic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG + Exonic
1132621709 16:870947-870969 ACCCCAGCTGCTGCTCCCTAAGG + Intronic
1132631306 16:918977-918999 TCGGCACCTGCTCCTCCCACGGG + Intronic
1132904992 16:2277952-2277974 TCGGCAGCGGCTACTCCCTGCGG - Exonic
1132924994 16:2424672-2424694 TCAGCAGTGGCTACTCCCTGCGG + Intergenic
1133072206 16:3254199-3254221 TCCGCAGATGCCCCTCCATCCGG + Exonic
1133230823 16:4365733-4365755 ACCCCAGCTGCTCCTCCCCAGGG + Intronic
1134090149 16:11387195-11387217 GCAGCAGCTTCTCCTCCATGAGG + Exonic
1136144820 16:28310320-28310342 TCCACAGCTGCTCCTGCAAGTGG + Intronic
1136364338 16:29802435-29802457 TCCGCAACTGCTCCTCCAAATGG + Intronic
1138267595 16:55671158-55671180 TCCCCAGTTGCTGCTCCCTAAGG - Intronic
1139430281 16:66907455-66907477 TCTGGAGCTGCCCCTCTCTGAGG - Intergenic
1139472369 16:67185042-67185064 CCCGCAGCTGCTGCTGGCTGAGG - Exonic
1139655115 16:68382745-68382767 TCCCCAGCTGCCCCTCCTGGAGG - Intronic
1139734134 16:68972874-68972896 TCTGCTGCTGCTCCTCCTGGTGG - Intronic
1140450387 16:75065906-75065928 GCCGCTGCTGCTCCTCTCTCAGG + Intronic
1140484545 16:75283242-75283264 TCCTGAGCTGCTCTTCCCTTGGG + Intergenic
1141110624 16:81268116-81268138 ACCTCACCTTCTCCTCCCTGTGG - Exonic
1141236863 16:82226670-82226692 TCCCCAGGTGCTTCTCCCAGTGG + Intergenic
1141972569 16:87493148-87493170 TCCGCGGCCACGCCTCCCTGGGG + Intergenic
1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG + Intronic
1142172885 16:88632095-88632117 TCCACAGCCGGTCCTCCCGGGGG - Intergenic
1142230857 16:88899671-88899693 CCCCCACCTGCTCTTCCCTGGGG - Intronic
1142750190 17:1982852-1982874 TCAGCCGCTGCCCCTCCCTGAGG - Intronic
1143164386 17:4890645-4890667 GCAGCAGCAGCTCCTGCCTGGGG + Exonic
1143931593 17:10434817-10434839 ACCAAAGCTGCACCTCCCTGAGG - Intergenic
1144339064 17:14297804-14297826 TCCGCAGCTGCTCCAGCCTGCGG - Intergenic
1144340051 17:14303045-14303067 TCCGCAGCTGCTGGTCTTTGGGG + Intronic
1144512238 17:15887019-15887041 CCCGCAGCATTTCCTCCCTGAGG - Intergenic
1146689985 17:34866660-34866682 TCCGCAGCAGCTGATCCCTGTGG - Intergenic
1147458720 17:40554819-40554841 GCCGGAGCTGCTCCTGGCTGAGG + Exonic
1147906906 17:43829515-43829537 TGCGCTGCTGCTCATCCCTGTGG - Intronic
1148148727 17:45383527-45383549 TCCTCAACTGCTCCTCCCTCAGG - Intergenic
1148793910 17:50188241-50188263 TCCTCAGCTGCTTCCCACTGTGG + Intronic
1151828411 17:76536298-76536320 TCTCCAGCTTCTTCTCCCTGTGG - Intronic
1151852075 17:76696895-76696917 TACGCAGCTGATTCTTCCTGAGG + Intronic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152230918 17:79113664-79113686 TCAGCAGCTGCTGCTCACTCGGG + Intronic
1152408895 17:80112173-80112195 TCCGCTTTTCCTCCTCCCTGAGG - Intergenic
1152701447 17:81821853-81821875 TCCCCTGCTCCTCCTCCCCGGGG + Intergenic
1156366216 18:36429699-36429721 TGCGGAGCTGCTCCTCCTTCTGG - Intronic
1156834684 18:41538409-41538431 TCCACAGCAGCTATTCCCTGTGG + Intergenic
1157712335 18:49858526-49858548 GCCCCAGCAGCCCCTCCCTGGGG - Intronic
1158052585 18:53241398-53241420 TCCACAGGTGCTGCTCCGTGGGG - Intronic
1158412618 18:57221436-57221458 TCAGCAGATGCTCATCCCAGGGG + Intergenic
1158914141 18:62103409-62103431 TCCTCAGCTGCTCCTGGCTGAGG + Intronic
1158945588 18:62444524-62444546 CCAGAAGCTGCTTCTCCCTGGGG - Intergenic
1159144990 18:64442594-64442616 CAAGAAGCTGCTCCTCCCTGGGG + Intergenic
1160225773 18:77009667-77009689 CCTGCAGCTGCTTTTCCCTGGGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160983398 19:1826934-1826956 TCCGCAGGCACTCCTCCATGGGG + Exonic
1161290874 19:3492692-3492714 TCCACATCACCTCCTCCCTGAGG - Intronic
1161340713 19:3740546-3740568 TGGCCAGCTGCTCCGCCCTGGGG - Exonic
1161473441 19:4472578-4472600 CCCGCAGCGGCCCCGCCCTGGGG + Intronic
1161569995 19:5025308-5025330 TCTACAGCTGCTCCTGGCTGGGG - Intronic
1161570182 19:5026233-5026255 TCTACAGCTGCTCCTGGCTGGGG - Intronic
1161769132 19:6221991-6222013 TCACCAGCTGCTCCTCCCACTGG - Intronic
1162790275 19:13059257-13059279 CCAGCCGCTGCTGCTCCCTGTGG + Intronic
1163034587 19:14563523-14563545 TCCACAGCTCCTCCCACCTGGGG - Intronic
1163529949 19:17843184-17843206 GCCTCAGCTGATGCTCCCTGTGG - Intronic
1163851988 19:19669297-19669319 TCCCCAGTTCCTCCTCCCTTAGG + Intronic
1164391658 19:27828146-27828168 ACCTCAGATGATCCTCCCTGTGG + Intergenic
1164590615 19:29504958-29504980 TCTGCAGCTGCTTCTCTCTGTGG + Intergenic
1165699465 19:37926429-37926451 TCCGCGGGTGCCCCTCCCTCTGG - Intronic
1166043808 19:40217997-40218019 GGCGCCGCTGCTCCTCGCTGAGG + Exonic
1166524337 19:43501790-43501812 CCCGCAGCTGCTCCTCCTCCCGG + Exonic
1167166646 19:47803503-47803525 CCTGCAGCTGTTGCTCCCTGAGG + Exonic
1167175191 19:47860261-47860283 CCTGCAGCTGTTGCTCCCTGAGG - Intergenic
1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG + Exonic
1167596909 19:50432716-50432738 GCCCCAGCCCCTCCTCCCTGGGG + Intergenic
1167738306 19:51310683-51310705 TCCCCAGCCCCTCCTCCCTCAGG - Intergenic
1168408297 19:56121730-56121752 TCTGCCGCTGCACCTCCCAGTGG + Intergenic
1168597062 19:57685816-57685838 TCCCCAGCTGCCACTCACTGGGG - Intronic
925036602 2:692131-692153 TCCTCAGCGGCTGCTCCCTTGGG + Intergenic
926144021 2:10385906-10385928 TCCGGAGCCTCTCCTCTCTGGGG + Intronic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
927183579 2:20466526-20466548 TCAGCAGCTGGTCCTCCCCTAGG - Intergenic
927937138 2:27082426-27082448 GCCGCAGCAGCTCCTCACTGGGG - Exonic
928051163 2:27996764-27996786 TCTGCAGCTGCTCCTACCCTGGG - Intronic
928264624 2:29801021-29801043 TCAGGACCTGTTCCTCCCTGAGG - Intronic
931695122 2:64865444-64865466 TCCACAGCCGCTCCTCCCGCTGG - Intergenic
932100783 2:68897336-68897358 ACCGCACCTGGCCCTCCCTGTGG + Intergenic
932718482 2:74120574-74120596 TCCTCAGCCGCTCCTCCTTCCGG - Intergenic
932775990 2:74528791-74528813 TCCTCTGCTGCTATTCCCTGAGG - Exonic
933847196 2:86336229-86336251 TCCACAGCTGTTCCTGACTGCGG - Intronic
934607792 2:95710675-95710697 TCTGGACCTGCTCCTCCCTTTGG - Intergenic
934686382 2:96325140-96325162 TCCGCTGCTCGGCCTCCCTGGGG - Intergenic
934925352 2:98378308-98378330 TCAACAGCTGCTCCATCCTGAGG + Intronic
936519195 2:113201226-113201248 TCCCCAGCTGCTCCTCCCACAGG - Exonic
936541138 2:113352555-113352577 TCTGGACCTGCTCCTCCCTTTGG - Intergenic
937026157 2:118699490-118699512 TGGTCAGATGCTCCTCCCTGGGG + Intergenic
937994392 2:127681603-127681625 CCCGGAGCAGCACCTCCCTGGGG - Intronic
938248798 2:129798215-129798237 TCGGGAGCTGCTCCTGCCTTTGG - Intergenic
938256188 2:129861720-129861742 GCAGCAGCTGCTACTCACTGGGG - Intergenic
938263061 2:129908938-129908960 CCCGCAGCTGGCCCTCCCCGAGG - Intergenic
938383700 2:130850382-130850404 TAGGCAGCTGCTGCTGCCTGTGG + Intronic
939950095 2:148460567-148460589 TCTCCAGCTGCTCCTGCCTCAGG + Intronic
940341568 2:152587139-152587161 TCTTCAGATGCTCCTTCCTGGGG - Intronic
942641926 2:178069676-178069698 TCAGCAGCTGATGCTTCCTGTGG - Intronic
946845173 2:223852471-223852493 TCAGTTGCTGCTCCTCCCAGGGG - Intergenic
947496399 2:230640610-230640632 TCAGCAGGTGGTGCTCCCTGGGG - Intergenic
947667959 2:231918928-231918950 TGCCCAGCGACTCCTCCCTGTGG + Intergenic
948328869 2:237149768-237149790 TACCCGGCTGCTCCTCACTGTGG + Intergenic
948775378 2:240285508-240285530 CCTGAAGCTGCTCTTCCCTGGGG - Intergenic
948817547 2:240520345-240520367 CCCGCCGCGGCTCCTACCTGCGG + Exonic
949026956 2:241770778-241770800 GCTGCGGCTGCTCTTCCCTGGGG + Intergenic
1171089848 20:22274223-22274245 TGGCCAGCTGCTCTTCCCTGTGG - Intergenic
1171333016 20:24357927-24357949 TCCTCAGCTCCCCTTCCCTGAGG + Intergenic
1173070849 20:39763546-39763568 TCTGCATTTGCTCCACCCTGAGG - Intergenic
1174114210 20:48215757-48215779 CCCCCAGCTGCTCCTTCCCGAGG + Intergenic
1174161509 20:48554170-48554192 ACAGCAGCTGCCCCTCCCAGTGG - Intergenic
1174518125 20:51108973-51108995 CCCACAGCTGCTCCTCCTCGGGG + Intergenic
1176108094 20:63399006-63399028 TGGGCACCCGCTCCTCCCTGTGG - Intergenic
1177249210 21:18570331-18570353 GCAGCAGCAGTTCCTCCCTGCGG - Intergenic
1179025453 21:37675534-37675556 ATCGCAGCAGCTCCTCCCAGGGG - Intronic
1179840838 21:44072251-44072273 TCGGCTGCTGCTGTTCCCTGCGG + Intronic
1182442743 22:30373701-30373723 TCTGCAGCTGCTCCTCCACGCGG - Exonic
1183186895 22:36296985-36297007 GTCGCTGCTTCTCCTCCCTGCGG + Exonic
1183356860 22:37364326-37364348 TCCGGAGCCCCTCATCCCTGAGG - Intergenic
1184690071 22:46113533-46113555 GCAGCAGCTGCCCCTTCCTGGGG + Intronic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185337274 22:50276280-50276302 TCCACAGCGCCCCCTCCCTGCGG - Intronic
1185347316 22:50316285-50316307 TCGGCAGCAGCTTCTCCTTGGGG - Intronic
1185392302 22:50569182-50569204 TGGGCAGATGCTGCTCCCTGAGG - Exonic
950261256 3:11544579-11544601 ACCCCAGCTGCTCCCGCCTGGGG + Intronic
950895830 3:16449967-16449989 TCCCCTGCTGCGCCTCCCTGGGG - Intronic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
952511819 3:34065863-34065885 TCTGGGGCTGCTCCTCCATGGGG + Intergenic
953027311 3:39152715-39152737 TCCTCAGTTTCTCCTCCCCGGGG - Intronic
955182085 3:56682464-56682486 TCCCCTGCTGCCCCTCCCCGCGG - Intronic
960960093 3:123064709-123064731 TCCAGAGCTGCTCCTGCCTCAGG - Intergenic
961099141 3:124183655-124183677 TCCTCTGATGCTCCTCCCTTTGG - Intronic
963733207 3:148991934-148991956 GCCGCAGCTGCTCCGCCCGCCGG - Intronic
964336319 3:155658417-155658439 TCCGCAGCTGCTGCTTCTTGAGG - Intronic
966924004 3:184632921-184632943 TGCCCACCTGCTCCTGCCTGCGG + Intronic
967304697 3:188049319-188049341 TCCTCAGCTGCAGCGCCCTGTGG + Intergenic
967906511 3:194505528-194505550 TCCCTAGGTGATCCTCCCTGGGG + Intergenic
967962743 3:194938969-194938991 TGCCCTGCTGCTCCTCCCAGGGG - Intergenic
968441260 4:625632-625654 TCCGGGCCTGCTCCTCACTGAGG - Exonic
968462525 4:732446-732468 TCCCCTTCTCCTCCTCCCTGCGG - Intronic
968471736 4:785758-785780 GCGGCTGCTGCTTCTCCCTGGGG - Exonic
968646735 4:1744778-1744800 TGCGCATCTGCTCCTTCCTCAGG - Exonic
968670413 4:1847487-1847509 CCAGCAGTTGTTCCTCCCTGGGG - Intronic
969475179 4:7418298-7418320 TCCGCAGCACTTCCTCCCTATGG - Intronic
969569734 4:8001427-8001449 ACGGCAGCGGCTGCTCCCTGGGG + Intronic
969590903 4:8121450-8121472 TCCTCAGATGCTCCTCGCTCTGG - Intronic
969696658 4:8738777-8738799 TCCACAGCTGCTCCTCTCTGGGG - Intergenic
970100425 4:12515085-12515107 TCAGCAGCTCCCCCTCACTGTGG - Intergenic
970448224 4:16141545-16141567 ACCTCACCTGTTCCTCCCTGTGG - Intergenic
970609754 4:17714193-17714215 TCTGCAGCAGCTCTTCGCTGTGG - Intronic
973982006 4:56315050-56315072 ACCGCAGCTCCTCCACCTTGCGG - Exonic
975027883 4:69575440-69575462 TCCGGAGCTGTTCATCCCTCTGG + Intergenic
976297247 4:83484863-83484885 GCCGCCGCGCCTCCTCCCTGCGG - Intronic
977979705 4:103307345-103307367 GCCTCAGCTGCTCCTCACCGTGG - Intergenic
984776409 4:183484781-183484803 CCCGCAGCTTCTCTTCCCAGAGG - Intergenic
986279734 5:6313714-6313736 TCCTCTGATGCTCCTTCCTGGGG + Intergenic
993020728 5:82587147-82587169 TCCACAGCTGCTTCTGCATGAGG - Intergenic
995243437 5:109911239-109911261 TCCTCAGCTCCTCCTTTCTGGGG + Intergenic
997102829 5:130987664-130987686 TCCACCCCTCCTCCTCCCTGGGG + Intergenic
1000245464 5:159445429-159445451 TCACCAGTTGCCCCTCCCTGGGG + Intergenic
1001435760 5:171698108-171698130 TCCCCAGCTCCTCCTCCTTCAGG - Intergenic
1001944947 5:175770971-175770993 TCAGCAGCTGCTCCTTCTTCTGG + Intergenic
1002081955 5:176742697-176742719 ACCCCCACTGCTCCTCCCTGGGG - Intergenic
1002472805 5:179447239-179447261 TGCGCAGCCGCTGCTCCCTCCGG + Intergenic
1002481417 5:179503423-179503445 TGCGCAGCCGCTGCTCCCTCCGG - Intergenic
1004326144 6:14675632-14675654 TCAGCAGCTGGTCCTCACTTTGG + Intergenic
1005041219 6:21602148-21602170 CCCGCTGCAGCTTCTCCCTGAGG - Intergenic
1006231419 6:32590341-32590363 CCCGGAGCTGCTGCTCCTTGAGG - Intergenic
1006716199 6:36122285-36122307 TGCACAGCTTCTCCTGCCTGAGG + Intergenic
1006735389 6:36269465-36269487 TCCCCAGCTGCTCCTCCTTGGGG + Intronic
1006851543 6:37102405-37102427 ACATCAGCTGCTCCTCCCTGGGG - Intergenic
1007159073 6:39774418-39774440 TCCGCAGCAGCTCCACCCACTGG + Intergenic
1007445534 6:41902743-41902765 ACAGCAGCTGGACCTCCCTGAGG - Intergenic
1007751162 6:44072866-44072888 TGCACAGCTCCTACTCCCTGGGG - Intergenic
1015086011 6:129292955-129292977 TCCGCGGCTGCTCCTCCTGTTGG - Intronic
1015741507 6:136459739-136459761 TCCGCATTTTCTCCTCCCCGTGG - Intronic
1017633360 6:156421137-156421159 TCCACAGCAACTCCTTCCTGAGG + Intergenic
1017913406 6:158814244-158814266 ACCACAGCTGTTCCTCCCTGTGG + Intronic
1018690070 6:166337491-166337513 TCGCCAGCTGCTCCTGCTTGGGG + Intronic
1019188871 6:170238503-170238525 TTTGCAGCTGCTCCTGACTGAGG - Intergenic
1019410564 7:904856-904878 GCCTCAGCTGCCCCACCCTGGGG + Intronic
1019430067 7:994971-994993 TCGGCAAGTGCTCCTCACTGTGG - Intergenic
1019597567 7:1865247-1865269 TCCACAGTGGCTCCTCCTTGGGG + Intronic
1021241056 7:18201548-18201570 TGCTCAGCTAGTCCTCCCTGAGG - Intronic
1022430670 7:30316780-30316802 TCTGCAACTGATCCTGCCTGTGG + Intronic
1022691880 7:32664059-32664081 GCCTCAGCTGCTTCTGCCTGTGG - Intergenic
1022919542 7:34998600-34998622 GCCTCAGCTGCTTCTGCCTGTGG - Intronic
1023855783 7:44182910-44182932 TCTGCAGCTGCTGCTCACTGCGG - Intronic
1024309207 7:47953691-47953713 CCCACAGCAGCTCCTACCTGGGG - Intronic
1024574812 7:50754956-50754978 TCCTCACCTGCTCTTCCCTCTGG - Intronic
1025034889 7:55587846-55587868 TCTGATGCTGCTGCTCCCTGGGG - Intergenic
1026665443 7:72336778-72336800 TCCGCACCGCCCCCTCCCTGCGG - Intronic
1026903252 7:74048511-74048533 GCCGCTGCTGCTGCTGCCTGGGG - Exonic
1029159299 7:98540537-98540559 TCCGCAGCTACTCTGGCCTGGGG + Intergenic
1029547319 7:101217211-101217233 GCCGCTGCTGCTGCCCCCTGCGG - Exonic
1031993136 7:128210840-128210862 CTGGCAGCTGCTCCTCGCTGTGG - Intergenic
1032087369 7:128891149-128891171 CCCTCGGCTGCTCCTCCCTGGGG - Intronic
1033845618 7:145428221-145428243 TCCTCAGCTGTACCTACCTGGGG - Intergenic
1034491571 7:151395814-151395836 CCCGCAGCTGCTCCCCACTCAGG + Exonic
1034634076 7:152553655-152553677 ATGGCAGGTGCTCCTCCCTGTGG + Intergenic
1035266003 7:157690617-157690639 CCCGCAGCTGCTGCGCCCCGAGG - Intronic
1035343058 7:158176884-158176906 TCCACACCTGCTCCTCCAGGTGG + Intronic
1037656061 8:20885176-20885198 GCAGCAGCTGCTTCTGCCTGCGG - Intergenic
1039175863 8:34805133-34805155 TCCTAAGCTGCACCTCACTGAGG - Intergenic
1039969462 8:42308856-42308878 ACCTGAGCTGCTCCTCTCTGGGG - Intronic
1040590491 8:48788177-48788199 TCCCCACCAGCTGCTCCCTGAGG - Intergenic
1042226863 8:66521094-66521116 CCCACAGCTGCTGATCCCTGGGG - Intergenic
1042672656 8:71281794-71281816 TTTGCAGCTGGTCCTGCCTGTGG + Intronic
1042712648 8:71735259-71735281 TCCGTGGCTTCTCTTCCCTGTGG - Intergenic
1044392138 8:91663612-91663634 ACAGCAGCTGTTCCTCCCTGTGG - Intergenic
1045323664 8:101101023-101101045 TCTACAGCTGTTCCTCCCTCAGG + Intergenic
1049156905 8:141072873-141072895 GCCACAGCTGCTCCTCACAGGGG - Intergenic
1049327511 8:142030932-142030954 CCCGCAGCTGGGCCACCCTGTGG + Intergenic
1049510945 8:143026378-143026400 ACCGCAGCCCCTCCTCCCTCCGG - Intergenic
1049564539 8:143331404-143331426 CCCACAGTGGCTCCTCCCTGTGG + Intronic
1049644089 8:143728377-143728399 TCCGCGGCGGCTCCTCCCGGCGG + Exonic
1051599871 9:18862055-18862077 TCAGCAGCGGCTCCTTCCTGTGG + Intronic
1055724174 9:79209990-79210012 TCCTCAGCTTATCCTCCCTGAGG + Intergenic
1056532495 9:87498846-87498868 TCCGGAGCTGCCCCTCCTCGCGG - Intronic
1056754637 9:89374035-89374057 TCCTAAGCTGGTGCTCCCTGGGG + Intronic
1056815071 9:89795191-89795213 TCCTCCTCTCCTCCTCCCTGTGG + Intergenic
1056821964 9:89848820-89848842 TCAGGAGCTGCCCCTCACTGAGG - Intergenic
1057205103 9:93167119-93167141 TCCTCAGCTGTTCCTGCCTGGGG - Intergenic
1057758078 9:97853098-97853120 GCCACAGCTGCTCCTACCTGGGG + Intergenic
1058018621 9:100066679-100066701 TAGGCTGCTTCTCCTCCCTGGGG + Intronic
1060804061 9:126563922-126563944 CCCACACCTGCTGCTCCCTGAGG - Intergenic
1060807890 9:126588910-126588932 TGTGGAGCTGCTCCTCCCTGTGG - Intergenic
1061193927 9:129097285-129097307 TCCGCAGCAGCTCCACCTTCTGG + Exonic
1061219775 9:129243455-129243477 TCGGCAGCTTGTCCTCCTTGTGG + Intergenic
1061800670 9:133112000-133112022 TCCCCAGCTGCGTCTCCCAGTGG + Intronic
1062080604 9:134621465-134621487 TCCGCACCTGCCCCTTCCCGAGG - Intergenic
1062421477 9:136484507-136484529 TCCTCTGCTGCTCCTTCCAGAGG + Exonic
1062439724 9:136564301-136564323 ACCTGGGCTGCTCCTCCCTGCGG - Intergenic
1062518985 9:136949881-136949903 GGCGCGGCTGCTCCTCCCCGTGG + Intronic
1185645234 X:1610940-1610962 TCCGCACCTGCTGTTCCCTCTGG + Intergenic
1187244327 X:17540227-17540249 TCCTCAGCAACTCCTCCCTAGGG - Intronic
1187823598 X:23313457-23313479 TCCCCAGCTGCTCTTACATGCGG + Intergenic
1189134314 X:38533040-38533062 CCCACTACTGCTCCTCCCTGGGG + Intronic
1195705308 X:107734063-107734085 TCCTTAGCTTCTCATCCCTGGGG - Intronic
1196513764 X:116546147-116546169 ACAGCAGCTGCTCCTCCCCTAGG + Intergenic
1196820123 X:119694549-119694571 TCCTCAGCTGCTCCAGCCTTGGG - Intergenic
1197455248 X:126670815-126670837 ACGGCAGCTGCTCCTCCCCCTGG - Intergenic
1199589236 X:149451094-149451116 TTCTCAGCTGCTCCAACCTGTGG - Intergenic
1199742146 X:150745623-150745645 TCCCCAGCAGCTCTGCCCTGAGG + Intronic
1200078041 X:153561559-153561581 GCCTCACCTGCTCCTCCCCGAGG - Intronic
1201856824 Y:18553651-18553673 GCTGCAGCTGCTGCTCCCAGCGG + Intronic
1201876497 Y:18766729-18766751 GCTGCAGCTGCTGCTCCCAGCGG - Intronic