ID: 952342567

View in Genome Browser
Species Human (GRCh38)
Location 3:32458154-32458176
Sequence TTTCCGCAGCTGCTCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952342567_952342573 5 Left 952342567 3:32458154-32458176 CCAGGGAGGAGCAGCTGCGGAAA 0: 1
1: 0
2: 2
3: 28
4: 276
Right 952342573 3:32458182-32458204 GGGCTGCTTCATGCTACCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 131
952342567_952342572 4 Left 952342567 3:32458154-32458176 CCAGGGAGGAGCAGCTGCGGAAA 0: 1
1: 0
2: 2
3: 28
4: 276
Right 952342572 3:32458181-32458203 GGGGCTGCTTCATGCTACCTGGG 0: 1
1: 0
2: 1
3: 21
4: 177
952342567_952342571 3 Left 952342567 3:32458154-32458176 CCAGGGAGGAGCAGCTGCGGAAA 0: 1
1: 0
2: 2
3: 28
4: 276
Right 952342571 3:32458180-32458202 AGGGGCTGCTTCATGCTACCTGG 0: 1
1: 0
2: 0
3: 12
4: 109
952342567_952342574 6 Left 952342567 3:32458154-32458176 CCAGGGAGGAGCAGCTGCGGAAA 0: 1
1: 0
2: 2
3: 28
4: 276
Right 952342574 3:32458183-32458205 GGCTGCTTCATGCTACCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952342567 Original CRISPR TTTCCGCAGCTGCTCCTCCC TGG (reversed) Intronic