ID: 952342572

View in Genome Browser
Species Human (GRCh38)
Location 3:32458181-32458203
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952342565_952342572 6 Left 952342565 3:32458152-32458174 CCCCAGGGAGGAGCAGCTGCGGA 0: 1
1: 0
2: 6
3: 37
4: 323
Right 952342572 3:32458181-32458203 GGGGCTGCTTCATGCTACCTGGG 0: 1
1: 0
2: 1
3: 21
4: 177
952342567_952342572 4 Left 952342567 3:32458154-32458176 CCAGGGAGGAGCAGCTGCGGAAA 0: 1
1: 0
2: 2
3: 28
4: 276
Right 952342572 3:32458181-32458203 GGGGCTGCTTCATGCTACCTGGG 0: 1
1: 0
2: 1
3: 21
4: 177
952342563_952342572 13 Left 952342563 3:32458145-32458167 CCTGCTGCCCCAGGGAGGAGCAG 0: 1
1: 0
2: 16
3: 84
4: 544
Right 952342572 3:32458181-32458203 GGGGCTGCTTCATGCTACCTGGG 0: 1
1: 0
2: 1
3: 21
4: 177
952342566_952342572 5 Left 952342566 3:32458153-32458175 CCCAGGGAGGAGCAGCTGCGGAA 0: 1
1: 0
2: 3
3: 32
4: 277
Right 952342572 3:32458181-32458203 GGGGCTGCTTCATGCTACCTGGG 0: 1
1: 0
2: 1
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type