ID: 952348489

View in Genome Browser
Species Human (GRCh38)
Location 3:32511261-32511283
Sequence CAAAGGCTTGACCACAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952348489_952348492 -1 Left 952348489 3:32511261-32511283 CCAACACTGTGGTCAAGCCTTTG No data
Right 952348492 3:32511283-32511305 GAATTTTTTTCATTCTGATAGGG No data
952348489_952348491 -2 Left 952348489 3:32511261-32511283 CCAACACTGTGGTCAAGCCTTTG No data
Right 952348491 3:32511282-32511304 TGAATTTTTTTCATTCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952348489 Original CRISPR CAAAGGCTTGACCACAGTGT TGG (reversed) Intergenic