ID: 952348491

View in Genome Browser
Species Human (GRCh38)
Location 3:32511282-32511304
Sequence TGAATTTTTTTCATTCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952348488_952348491 3 Left 952348488 3:32511256-32511278 CCTCTCCAACACTGTGGTCAAGC No data
Right 952348491 3:32511282-32511304 TGAATTTTTTTCATTCTGATAGG No data
952348489_952348491 -2 Left 952348489 3:32511261-32511283 CCAACACTGTGGTCAAGCCTTTG No data
Right 952348491 3:32511282-32511304 TGAATTTTTTTCATTCTGATAGG No data
952348486_952348491 9 Left 952348486 3:32511250-32511272 CCATTGCCTCTCCAACACTGTGG No data
Right 952348491 3:32511282-32511304 TGAATTTTTTTCATTCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952348491 Original CRISPR TGAATTTTTTTCATTCTGAT AGG Intergenic