ID: 952373974

View in Genome Browser
Species Human (GRCh38)
Location 3:32749862-32749884
Sequence CCATAGGTATGTGGGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 1, 2: 22, 3: 80, 4: 375}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952373974_952373987 12 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373987 3:32749897-32749919 GGAAGGAAGGAAAGGAGGGAAGG 0: 175
1: 2562
2: 8297
3: 18021
4: 34015
952373974_952373980 -9 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373980 3:32749876-32749898 TACCTATGGAAATAAAATGAAGG 0: 1
1: 0
2: 1
3: 37
4: 338
952373974_952373982 -5 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373982 3:32749880-32749902 TATGGAAATAAAATGAAGGAAGG 0: 1
1: 0
2: 1
3: 88
4: 899
952373974_952373984 4 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373984 3:32749889-32749911 AAAATGAAGGAAGGAAGGAAAGG 0: 6
1: 158
2: 1259
3: 6184
4: 14523
952373974_952373985 7 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373985 3:32749892-32749914 ATGAAGGAAGGAAGGAAAGGAGG 0: 4
1: 235
2: 4319
3: 47137
4: 43150
952373974_952373989 23 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373989 3:32749908-32749930 AAGGAGGGAAGGAGGAAGAAAGG 0: 2
1: 67
2: 959
3: 5518
4: 18474
952373974_952373986 8 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373986 3:32749893-32749915 TGAAGGAAGGAAGGAAAGGAGGG 0: 5
1: 513
2: 3333
3: 10931
4: 21482
952373974_952373988 15 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373988 3:32749900-32749922 AGGAAGGAAAGGAGGGAAGGAGG 0: 15
1: 346
2: 3450
3: 11367
4: 30412
952373974_952373983 -1 Left 952373974 3:32749862-32749884 CCTGTTCCCCCACATACCTATGG 0: 1
1: 1
2: 22
3: 80
4: 375
Right 952373983 3:32749884-32749906 GAAATAAAATGAAGGAAGGAAGG 0: 1
1: 8
2: 301
3: 1928
4: 7986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952373974 Original CRISPR CCATAGGTATGTGGGGGAAC AGG (reversed) Intronic
900761751 1:4477220-4477242 TCTTATATATGTGGGGGAACTGG + Intergenic
901322506 1:8348408-8348430 CTACAGGTTTCTGGGGGAACAGG + Intergenic
902115702 1:14119216-14119238 CCATGGGTCTGTAGGGGAGCAGG + Intergenic
902544395 1:17179787-17179809 CCGTAGGTTTTTGGGGGAACAGG + Intergenic
904097302 1:27990189-27990211 CCACAGGGATGTCGAGGAACAGG + Intronic
904398039 1:30236235-30236257 CAATAGGAATGTGTGGGAGCTGG - Intergenic
904499958 1:30908094-30908116 CCACTGGGAGGTGGGGGAACAGG + Intronic
904532541 1:31178974-31178996 CGGCAGGTATGTGGGTGAACGGG - Intergenic
904876196 1:33656431-33656453 GCATAGGTATGTGGGGCAGGAGG - Intronic
906816002 1:48879979-48880001 TCATAGGTTATTGGGGGAACAGG + Intronic
906993196 1:50761251-50761273 CCAGAGGTATAAGGAGGAACTGG + Intronic
907993005 1:59601109-59601131 CCACAGGCATGTGTGGGACCGGG - Intronic
908614244 1:65900007-65900029 CCATACGTTATTGGGGGAACAGG - Intronic
908717015 1:67081473-67081495 CCAGAGGTACATGGAGGAACTGG - Intergenic
909074185 1:71033364-71033386 AGAAAGGTATGTGTGGGAACAGG - Intronic
910899141 1:92100939-92100961 CCATAGGTTTGTGGGGGAACAGG + Intronic
912741444 1:112201725-112201747 CCAGAGGTACAAGGGGGAACTGG - Intergenic
915477643 1:156162385-156162407 CCAAAGGTATTTGGGGTAAGTGG + Intronic
916026190 1:160835676-160835698 CCATAGGTTTTTTTGGGAACAGG - Intronic
916381740 1:164219585-164219607 CCAGAGGTACATGGAGGAACTGG + Intergenic
916457903 1:164990029-164990051 CAATAGGTTTTTGGGGGAGCAGG + Intergenic
917095174 1:171392604-171392626 CCATAGGTATGCAGGGGCTCTGG - Intergenic
917771846 1:178287957-178287979 CAATAGGTTTTTGGGGGAATGGG - Intronic
919398144 1:197076078-197076100 CCATAGGCTATTGGGGGAACAGG - Intergenic
919494848 1:198251454-198251476 CCAGAGGTATAAGGAGGAACTGG - Intronic
920110236 1:203582448-203582470 CCCTAGGGAAGAGGGGGAACAGG + Intergenic
923000892 1:230005546-230005568 CCATAGGTTTTTGGGGGAACAGG + Intergenic
923459267 1:234194572-234194594 CCATAGGTTTGAGGGGGAACAGG - Intronic
1065406313 10:25369746-25369768 CCAGAGGTATAAGGAGGAACTGG - Intronic
1066784411 10:38987307-38987329 CCATAGGTTTTTTGGGGAACAGG + Intergenic
1066983637 10:42443151-42443173 CCATAGGTTTTGGGGGAAACAGG - Intergenic
1067185508 10:44023999-44024021 ACATAGGAATTTGGGGGAAAAGG - Intergenic
1067212510 10:44271868-44271890 CCAGAGGTATGAGGAGGAACTGG + Intergenic
1067371488 10:45687731-45687753 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067388295 10:45838419-45838441 CCATAGGTTTCTGGGGGAACAGG - Intronic
1067417830 10:46118864-46118886 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067445971 10:46346155-46346177 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1067503186 10:46825426-46825448 CCTTAGGTTTCTGGGGGAACAGG + Intergenic
1067591411 10:47514590-47514612 CCATAGGTTTCTGGGGGAACAGG - Intronic
1067638529 10:48022685-48022707 CCATAGGTTTCTGGGGGAACAGG - Intergenic
1067874960 10:49997647-49997669 CCATAGGTTTCTGGGGGAACAGG + Intronic
1068098893 10:52527376-52527398 CAATAGGTTTTTAGGGGAACAGG + Intergenic
1068534261 10:58223124-58223146 CAATAGGTTTTTGGGGGAATAGG - Intronic
1069355608 10:67581637-67581659 CCAGAGGTATGAGGAGGAGCTGG - Intronic
1069360787 10:67639419-67639441 CCAGAGGTATGAGGAGGAGCTGG + Intronic
1070135128 10:73687102-73687124 CCATAGGTTTCTGGGGGAACAGG - Intronic
1071488336 10:86118459-86118481 CAATAGGTTCTTGGGGGAACAGG - Intronic
1073652825 10:105379928-105379950 CCAGAGGTACATGGAGGAACTGG - Intergenic
1074383246 10:112997047-112997069 TCATTAGTTTGTGGGGGAACAGG - Intronic
1075445911 10:122512715-122512737 TCATAGGTTTTTGGGGGAACAGG + Intronic
1077240617 11:1508569-1508591 CCATAGGCCTGCGGGAGAACGGG + Intergenic
1077852354 11:6085371-6085393 TCACAGGTATGTGGGGGACATGG + Intergenic
1078069078 11:8096565-8096587 GCATAAGTTTGTGGGGGTACAGG + Intronic
1079761170 11:24331378-24331400 CCAGAGGTACATGGAGGAACTGG + Intergenic
1080202877 11:29693840-29693862 CAATAGGTTTTTGGGGAAACAGG + Intergenic
1081511509 11:43778398-43778420 CCAGAGGTATAAGGAGGAACTGG + Intronic
1081968361 11:47182987-47183009 CCCCAGGTATGTGGGGGGGCGGG - Exonic
1082112825 11:48295983-48296005 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1082155150 11:48801025-48801047 CCAGAGGTATGAGGAGGAGCTGG - Intergenic
1082772438 11:57218753-57218775 TAATAGGTTTTTGGGGGAACAGG - Intergenic
1083848533 11:65351772-65351794 CCTTAGATATGTCGGGGAGCAGG - Exonic
1084480800 11:69419004-69419026 CCATGGGTGTGTGGGGGTAGTGG - Intergenic
1085364784 11:75929682-75929704 CCATAGATTTGTGGGGGACAGGG + Intronic
1086976630 11:93140070-93140092 CCAGAGGTACATGGAGGAACTGG + Intergenic
1087001421 11:93424404-93424426 CCAGAGGTACATGGAGGAACTGG + Intronic
1087722338 11:101680992-101681014 CCAGAGGTATAAGGAGGAACTGG - Intronic
1088977564 11:114829433-114829455 CCATAGGCGTGTGGGGTAGCAGG + Intergenic
1089569230 11:119392005-119392027 CCATAGGTTTTTAGGGGAACAGG + Intergenic
1090598135 11:128341691-128341713 CCATAGGTATTTTGAGGAGCAGG + Intergenic
1091842052 12:3628322-3628344 CCAAAGGTATGTGGAGGAGGAGG + Intronic
1092506024 12:9101031-9101053 CCATAGGTTTTTGGGGGAACAGG - Intronic
1093549717 12:20393424-20393446 CCATAGTTCTGGGAGGGAACTGG - Intronic
1095151983 12:38806166-38806188 CCAGAGGCATGAGGAGGAACTGG + Intronic
1095423093 12:42046069-42046091 CCAGAGGTACATGGAGGAACTGG - Intergenic
1096433152 12:51565211-51565233 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1096827847 12:54293197-54293219 CCATAGGAGTATGGGGGATCTGG + Exonic
1096959491 12:55563900-55563922 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1097568199 12:61297318-61297340 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1097765147 12:63517966-63517988 CCATAGGTTCCTGGGGGAACAGG - Intergenic
1098603597 12:72363185-72363207 CCAGAGGTACGAGGAGGAACTGG + Intronic
1100144128 12:91656508-91656530 ACATAGGTAGGTGGTGGTACTGG + Intergenic
1100425741 12:94484288-94484310 CCAGAGGTACATGGAGGAACTGG - Intergenic
1100722048 12:97369474-97369496 CCATAGATTATTGGGGGAACAGG - Intergenic
1102245560 12:111353614-111353636 CCATAGGCAGGAGGTGGAACTGG + Intergenic
1102328753 12:112012103-112012125 GCACAGGCATGTTGGGGAACTGG - Intronic
1102434858 12:112913960-112913982 CAATAGGTTTTTGGGGGAACAGG + Intronic
1102994301 12:117336614-117336636 CAATAGGTTTTTTGGGGAACAGG - Intronic
1104948676 12:132428960-132428982 CGAAAGGTACGTGGGGAAACTGG - Intergenic
1104962912 12:132496716-132496738 CCATCAGAATGTGGGGAAACAGG - Intronic
1106070959 13:26410543-26410565 CCATCGGCATGTGGGGGAGGTGG + Intergenic
1106427325 13:29644288-29644310 CCAGAGGTACATGGAGGAACTGG - Intergenic
1107462534 13:40617947-40617969 CCTGAGGTATGTGTGGGATCTGG - Intronic
1107787908 13:43972764-43972786 CCAGAGGTATGAGGAGGAACTGG - Intergenic
1108073648 13:46656109-46656131 CCAGAGGAATGTGGGGATACGGG - Intronic
1108240582 13:48459295-48459317 AAATAGGTGTTTGGGGGAACAGG - Intronic
1108587221 13:51880920-51880942 CCATAGGTTTTTGGGGGAACAGG - Intergenic
1109270304 13:60248476-60248498 CCAGAGGTATAAGGAGGAACGGG - Intergenic
1110137323 13:72084224-72084246 CCATAGGTATGAAGAGGAGCTGG + Intergenic
1110173654 13:72531799-72531821 CCATAGGTTTTTGAGGGAACAGG - Intergenic
1110811824 13:79819633-79819655 CCAGAGGTATGAGGAGGAACTGG - Intergenic
1110814177 13:79843219-79843241 CCAGAGGTATGAGGAGGAACTGG + Intergenic
1110841994 13:80153821-80153843 CCAGAGGTACGAGGAGGAACTGG + Intergenic
1111085300 13:83368864-83368886 CCATATGAATTTGGAGGAACAGG - Intergenic
1111162242 13:84410315-84410337 TCATAGGTTTTGGGGGGAACAGG - Intergenic
1111492570 13:89001659-89001681 CCATAGTTTTTTGGGGGAACAGG + Intergenic
1111690446 13:91556946-91556968 CCACAGGTTTTGGGGGGAACAGG - Intronic
1111727611 13:92032412-92032434 CCATAGGTTTGGGGGGAAACGGG - Intronic
1112460704 13:99601438-99601460 CCATGGGTGTATGGGGGAACGGG - Intergenic
1114504915 14:23202993-23203015 CCATAGGTTTTTTGGGGAACAGG + Intronic
1114751196 14:25206806-25206828 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1114801563 14:25781442-25781464 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1115561081 14:34583475-34583497 CCATAGGTTTGTGCCAGAACGGG - Intronic
1115656998 14:35452867-35452889 CAATAGTTTTTTGGGGGAACAGG + Intergenic
1116711042 14:48368832-48368854 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1116762695 14:49033767-49033789 CCAGAGGTATGTAGGGTATCTGG + Intergenic
1117883998 14:60340570-60340592 CCAGAGGTATGAGGAGGAGCTGG + Intergenic
1118129657 14:62948572-62948594 CCAGAGGTATAAGGAGGAACTGG + Intronic
1118531442 14:66711060-66711082 CCATAGGTTATTGGGGGTACAGG + Intronic
1119006793 14:70938707-70938729 CCAGAGGTATAAGGAGGAACTGG - Intronic
1119582179 14:75795439-75795461 CAGTAGGTTTTTGGGGGAACAGG + Intronic
1120450466 14:84660192-84660214 CAATAGGCTTTTGGGGGAACAGG + Intergenic
1120958248 14:90101859-90101881 CCATAGGTTTTCGGGGGAACAGG - Intronic
1121241212 14:92431297-92431319 CCATTCGTAGGTGAGGGAACAGG + Intronic
1122946985 14:105016054-105016076 TCATAGGCAGGTGAGGGAACAGG - Intronic
1202932467 14_KI270725v1_random:51039-51061 CCAGAGGTACATGGAGGAACTGG - Intergenic
1123936616 15:25197093-25197115 CCAGAGTCATGTGGGGGAGCTGG + Intergenic
1124211643 15:27769619-27769641 CAATAGGTTTTAGGGGGAACAGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124812428 15:32954263-32954285 CCATAGGTACATGGGGGTTCAGG - Intronic
1125730015 15:41887833-41887855 GCCTAGGGATGTGGGAGAACGGG + Intronic
1125932962 15:43613074-43613096 CCAGAGGGAGGTGGGGGAGCAGG + Exonic
1125946061 15:43712536-43712558 CCAGAGGGAGGTGGGGGAGCAGG + Intergenic
1126272134 15:46832341-46832363 CCAGAGGTACGAGGAGGAACTGG + Intergenic
1127041191 15:54978723-54978745 CCATAGGTTTTTGGGAGAACAGG - Intergenic
1127195185 15:56576590-56576612 CCATAGGTTATTGGTGGAACAGG - Intergenic
1127505258 15:59591821-59591843 CCATTGGATTGTTGGGGAACAGG + Intergenic
1127836698 15:62796288-62796310 CCACAGGTACGTGGGGGTCCTGG + Exonic
1127904411 15:63365720-63365742 CCAGAGGGATGTAGGGGAAAGGG - Intronic
1130135132 15:81176155-81176177 CCATGGGAATGTGTGGGAAGTGG + Intronic
1130326550 15:82885471-82885493 CCAGAGGTACATGGAGGAACTGG - Intronic
1133595006 16:7282598-7282620 CCATAGGTTATTGGGGGAACAGG + Intronic
1133608018 16:7407078-7407100 TCATAGGTTTTTGGGGGAACGGG + Intronic
1133836019 16:9368003-9368025 CAGTAGGTTTTTGGGGGAACAGG + Intergenic
1135274833 16:21103287-21103309 CCATAGGTTTTTGGGGGAACAGG - Intronic
1135715332 16:24759962-24759984 CCATTGCTATGTGGGGGAGAGGG - Intronic
1135893254 16:26375902-26375924 TCATATGTATGTGGGTGAAAGGG + Intergenic
1136573709 16:31111154-31111176 GCATAGGGATGAAGGGGAACCGG - Exonic
1136647271 16:31632444-31632466 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1136777110 16:32877826-32877848 CCACAGGTCTGTGGGGCAAGAGG - Intergenic
1136889139 16:33955159-33955181 CCAGAGGTACATGGAGGAACTGG - Intergenic
1136893511 16:33983687-33983709 CCACAGGTCTGTGGGGCAAGAGG + Intergenic
1137083450 16:36094500-36094522 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1137221089 16:46451990-46452012 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1137395609 16:48114645-48114667 CCAGAGATGTGTGGGGGAAGGGG - Intronic
1137494236 16:48957341-48957363 CCATAGGTTTTTGGGGAAACAGG - Intergenic
1137639773 16:50018468-50018490 CAATAGGTTTTTGGGGGAACGGG - Intergenic
1140547419 16:75824537-75824559 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1141948034 16:87323624-87323646 GCATAGGTACGTGTGGGAAGGGG + Intronic
1203079525 16_KI270728v1_random:1139935-1139957 CCACAGGTCTGTGGGGCAAGAGG - Intergenic
1148966074 17:51437279-51437301 CCATAGGTTATTGGGGGAACGGG + Intergenic
1148993009 17:51682651-51682673 CCATGGGTAGGTGGGGTAAATGG - Intronic
1149399773 17:56283866-56283888 CCATAGGTTTTTGGGGGAACTGG - Intronic
1150469939 17:65428664-65428686 CTATAGGTTTTTGGGGGAACAGG - Intergenic
1150911486 17:69392253-69392275 CAATAAGTTTTTGGGGGAACAGG + Intergenic
1154341594 18:13507183-13507205 CAATAGGTTTTTTGGGGAACAGG + Intronic
1154478416 18:14790969-14790991 CCAGAGGTATAAGGAGGAACTGG - Intronic
1155427304 18:25720015-25720037 CCAGAGGTATATGGAGGAGCTGG + Intergenic
1155641337 18:28019269-28019291 CAATAGGTTTTTGGGGGAACAGG - Intronic
1156335201 18:36165331-36165353 CCAAAAGAATCTGGGGGAACAGG - Intronic
1157144463 18:45147627-45147649 CAATGGGTTTTTGGGGGAACAGG + Intergenic
1157260001 18:46169338-46169360 CTAGAGGTTTGTGGGGGAAAGGG + Intergenic
1157565132 18:48674709-48674731 CCACAAGGATGTGGGGCAACAGG + Intronic
1157810095 18:50688863-50688885 CCATAGGTTTTTGGGAGAACAGG - Intronic
1158834182 18:61313155-61313177 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1159660964 18:71095406-71095428 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1159907071 18:74103080-74103102 CCACAGGTTTTTGGGGGAACAGG - Intronic
1163786852 19:19279196-19279218 CCAGGGGTATGTGGGGCAGCGGG - Exonic
1164322329 19:24160540-24160562 CCATAGTTGTCTGGGGTAACAGG - Intergenic
1164636349 19:29794298-29794320 CCATAGGTTTTTGGGGGAATAGG - Intergenic
1164889495 19:31811120-31811142 CCATAAGTTTTTGGGGGAACAGG + Intergenic
1164928132 19:32147209-32147231 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1165988280 19:39789844-39789866 CAGTAGGTTTTTGGGGGAACAGG - Intergenic
1166264004 19:41665723-41665745 CCATAAGTTTTTGGGGGAACAGG - Intronic
925374422 2:3372793-3372815 CCAGAGGTATAAGGAGGAACTGG + Intronic
925417832 2:3684433-3684455 CAACAGGTTTTTGGGGGAACAGG + Intronic
925532666 2:4882252-4882274 CCATAGGTTTTGGGGGGAACTGG - Intergenic
925961737 2:9023513-9023535 CAATAGGTTTTTTGGGGAACAGG - Intergenic
926772560 2:16391413-16391435 CCATAGGTTTTTGGGGGAACAGG + Intergenic
927036208 2:19179413-19179435 CAATAGGTTTTTGGGGTAACCGG + Intergenic
927049119 2:19309267-19309289 CCAGAGGTATAAGGAGGAACTGG + Intergenic
927879598 2:26681284-26681306 CCTTAGGAATCTGGAGGAACTGG - Intergenic
928802297 2:35109429-35109451 CCAGAGGTATAAGGAGGAACTGG - Intergenic
930962984 2:57283891-57283913 CCAGAGGTATAAGGAGGAACTGG + Intergenic
931554203 2:63481867-63481889 CCATAGGTTTTTGGGGGAACAGG - Intronic
931788243 2:65640581-65640603 CCTGAGGTATCTTGGGGAACAGG + Intergenic
932635492 2:73384828-73384850 CCATAGGTTATTGGGGGTACAGG + Intergenic
932687528 2:73885531-73885553 CCATGAGGATGTGGGGCAACAGG + Intergenic
932985864 2:76725416-76725438 CCAGAGGTATAAGGAGGAACTGG - Intergenic
933974633 2:87498450-87498472 CCACAGGACTCTGGGGGAACGGG - Intergenic
934109635 2:88730138-88730160 CCAGAGGTACATGGAGGAACTGG + Intronic
934318632 2:91950197-91950219 CCAGAGGTATAAGGAGGAACTGG - Intergenic
934473246 2:94574689-94574711 ACACAGGTATGTTTGGGAACTGG + Intergenic
935180744 2:100689167-100689189 CCATAGGTTTTGGGGGGAACGGG - Intergenic
935720156 2:105972751-105972773 CCATGGGCAGGCGGGGGAACAGG + Intergenic
940056647 2:149520228-149520250 CCATAGGTTATTGGGGGCACAGG - Intergenic
940423167 2:153502103-153502125 TAATAGGTTTTTGGGGGAACAGG + Intergenic
940802763 2:158151514-158151536 CCATAGGTTATTGGGGGAACAGG - Intergenic
940812987 2:158266485-158266507 CCATAGTTTTTTGGGGAAACAGG + Intronic
941761806 2:169252053-169252075 CCAGAGGTACATGGAGGAACTGG + Intronic
944072686 2:195690868-195690890 CAATAGGTTTTTTGGGGAACAGG + Intronic
944502892 2:200379931-200379953 CCATAGAGATGTGGGTGACCCGG - Intronic
945515711 2:210761410-210761432 CCAGAGGTACATGGAGGAACTGG + Intergenic
945523648 2:210861219-210861241 TCATAGGTATCTGGGGGAGTTGG + Intergenic
945527215 2:210903116-210903138 CCAGAGGTACATGGAGGAACTGG - Intergenic
945579983 2:211581244-211581266 CCATAGGTTATTGGGGGAACAGG - Intronic
945733501 2:213569813-213569835 CCAGAGGTACATGGAGGAACTGG - Intronic
946462673 2:219883174-219883196 CCATAGGTTTTTTGGGGAACAGG + Intergenic
946847975 2:223877941-223877963 CCCTAGGAATTTGGGGGAAAGGG + Exonic
947996200 2:234529787-234529809 CCACAGGTGAGAGGGGGAACTGG + Intergenic
948821178 2:240547926-240547948 CCAGAGGTACAAGGGGGAACTGG + Intronic
1169188006 20:3635337-3635359 CAATAGGTTTTTGGGGGAACAGG - Intronic
1170483037 20:16787255-16787277 CAATAGGTTTTTTGGGGAACAGG + Intergenic
1170832537 20:19855459-19855481 CCAGAGGTATGAGGAGGAGCTGG - Intergenic
1172093559 20:32449775-32449797 CCAGAGGGATGCGGGGGAAGAGG + Intronic
1172809079 20:37634150-37634172 CCCTAAGTGTGTGTGGGAACAGG + Intergenic
1172862794 20:38068770-38068792 CCATAGGGATGTGATGGGACAGG - Intronic
1173277301 20:41596109-41596131 CCATAGGAATGTGGGGTGACGGG - Intronic
1173555129 20:43960555-43960577 CTATAGGGAAGTGGGGGAGCAGG - Intronic
1176886071 21:14257007-14257029 CTATAGGTTTTTGGGGGAACAGG + Intergenic
1177123425 21:17166442-17166464 CCATAGGTACAAGGAGGAACTGG + Intergenic
1180717697 22:17882990-17883012 ACATAGGCGAGTGGGGGAACAGG - Intronic
1183154058 22:36060774-36060796 CCATAGGTTTTGGAGGGAACAGG - Intergenic
1185175284 22:49322902-49322924 CCATGGGGCTGTGGGTGAACTGG + Intergenic
949430125 3:3966504-3966526 CCAGAGGTACATGGAGGAACTGG + Intronic
949666428 3:6344360-6344382 CCAGAGGTATAAGGAGGAACTGG + Intergenic
950919535 3:16680151-16680173 CCAGAGGTATAAGGAGGAACTGG + Intergenic
951487405 3:23229306-23229328 CCATAGGTTTTTTGGGGAACAGG + Intronic
952373974 3:32749862-32749884 CCATAGGTATGTGGGGGAACAGG - Intronic
955135771 3:56216556-56216578 CCAGAGGTATAAGGAGGAACTGG + Intronic
955834847 3:63043697-63043719 CCATTAGTATGTAGGTGAACTGG + Intergenic
956243038 3:67151200-67151222 CCAGAGGTAGAAGGGGGAACTGG + Intergenic
957312503 3:78539130-78539152 CTATAGGTTTTTGGGGGAACAGG - Intergenic
957327894 3:78720072-78720094 CCAGAGGTATGTGGGAGAAGAGG - Intronic
957395046 3:79625771-79625793 CCAGAGGTACAAGGGGGAACTGG + Intronic
957587624 3:82152843-82152865 CCAGAGGTACATGGAGGAACTGG - Intergenic
958011544 3:87885903-87885925 CCAGAGGTATAAAGGGGAACTGG + Intergenic
958012184 3:87894027-87894049 CCATAGGTTTTGGGGGGAACAGG + Intergenic
958014315 3:87920377-87920399 CCATAGGTTATTGGGGGAACAGG - Intergenic
958152631 3:89710116-89710138 CAATAGTTTTGTGGGGGTACAGG - Intergenic
958661355 3:97071739-97071761 CCATAGGTTTTGAGGGGAACAGG + Intronic
958861378 3:99448921-99448943 CGATAGTTTTTTGGGGGAACAGG + Intergenic
958877806 3:99635850-99635872 TCATACGTATGTGATGGAACTGG + Intergenic
959073102 3:101721771-101721793 CCATAGGGATCTGGGAGAAAGGG - Intergenic
959561441 3:107787677-107787699 CAATAGGTTTGTGAGGGAACGGG + Intronic
959691545 3:109203300-109203322 CCAGAGGTACATGGAGGAACTGG + Intergenic
960064458 3:113355196-113355218 CAATAGGTTTTTGGGGGAACAGG - Intronic
960331290 3:116363424-116363446 CCAGAGGTACATGGAGGAACTGG + Intronic
960781970 3:121329852-121329874 CAAGAGGAATGTGGGGGAACAGG - Intronic
961961763 3:130862831-130862853 CCATAGGTATGTCTTGGATCTGG - Intronic
963466083 3:145684891-145684913 CCATAGGTATGTAGGGGCTCTGG - Intergenic
963955140 3:151245182-151245204 CCAGAGGTATAAGGAGGAACTGG + Intronic
963958856 3:151285659-151285681 CAATAGGTTTTTGGGGGAACAGG - Intronic
964658844 3:159097945-159097967 CCAGAGGTACATGGAGGAACTGG - Intronic
965228604 3:166023678-166023700 CCAGAGGTATAAGGAGGAACTGG - Intergenic
965378167 3:167953296-167953318 CCATAGGTTTTTTGGGGAACAGG + Intergenic
965718037 3:171628424-171628446 CCAGAGGTATAAGGAGGAACTGG + Intronic
967664209 3:192151895-192151917 CCAGAGGTACGAGGAGGAACTGG - Intronic
969835416 4:9836276-9836298 CCATAGGTTTTTTGGGGAACAGG - Intronic
970040929 4:11796130-11796152 CCAGAGGTATAAGGAGGAACTGG + Intergenic
970120932 4:12751691-12751713 CCAGAGGTACGAGGAGGAACAGG + Intergenic
970684370 4:18549494-18549516 CCAGAGGTACGAGGAGGAACTGG - Intergenic
971686852 4:29781636-29781658 CCATAGGGATGGTGGGGCACTGG - Intergenic
972400662 4:38699495-38699517 CCATAGAGAAGTGGGGGAAAGGG + Exonic
972742877 4:41905815-41905837 CCAGAGGTACATGGAGGAACTGG + Intergenic
973782383 4:54300617-54300639 CCTTCGGTTTGTGGGGGAGCTGG + Intergenic
974829807 4:67176112-67176134 CCAGAGGTATGAGGAGGAGCTGG - Intergenic
975535071 4:75441557-75441579 CAATAGGTTTTTGGGGGAACAGG - Intergenic
975963509 4:79941145-79941167 CCAGAGGTACATGGAGGAACTGG + Intronic
975965722 4:79970330-79970352 CCAGAGGTACATGGAGGAACTGG + Intronic
976791836 4:88887262-88887284 CAATAGGTTTTTGGGGGAACAGG - Intronic
977084870 4:92581429-92581451 CCAGAAGTATGTGGGAGAAAAGG - Intronic
977161449 4:93640889-93640911 CCAGAGGTACATGGAGGAACTGG - Intronic
977485333 4:97636905-97636927 CCAGAGGTATAAGGAGGAACCGG + Intronic
978064266 4:104377095-104377117 CCAGAGGTATTAGGAGGAACTGG + Intergenic
978250602 4:106627405-106627427 CAATAGGTTTTTGGGGCAACAGG + Intergenic
978296320 4:107209250-107209272 CCAGAGGTACATGGAGGAACTGG - Intronic
978456242 4:108895736-108895758 CAATGGGTTTTTGGGGGAACAGG + Intronic
978864478 4:113491719-113491741 CCAGAGGTACGAGGAGGAACTGG - Intronic
978923973 4:114220040-114220062 CCATAGGTTATTGGGGGAACAGG + Intergenic
980026037 4:127767887-127767909 CAATAGGTTTTTTGGGGAACAGG - Intronic
980431421 4:132703287-132703309 CAATAGGTTTTTGGGGGAACAGG - Intergenic
980691030 4:136296099-136296121 CCAGAGGTACATGGAGGAACTGG - Intergenic
980865489 4:138549451-138549473 CCAGAGGTACATGGAGGAACTGG + Intergenic
981100801 4:140827080-140827102 CCATAGGTAGGTGTAGGAAATGG + Intergenic
981607488 4:146555513-146555535 CCAGAGGTATAAGGAGGAACTGG - Intergenic
982631136 4:157830805-157830827 CCATAGGTTATTGGGGGTACTGG - Intergenic
982650912 4:158086820-158086842 CCAGAGGTATAAGGAGGAACTGG - Intergenic
982930994 4:161407567-161407589 TCATAGGTCTGTGGGGGTATGGG - Intronic
983350560 4:166582471-166582493 CCATAGGTTTTTGGGGGAACAGG + Intergenic
983363655 4:166759306-166759328 CCAGAGGTACATGGAGGAACTGG + Intronic
983662522 4:170144176-170144198 CCATAGGTGTTTTTGGGAACAGG + Intergenic
987753033 5:22066176-22066198 CCATAGGTTTTTGGGGGAACAGG + Intronic
987912199 5:24162239-24162261 CAATATGTATGTGTTGGAACTGG + Intronic
988747135 5:34151266-34151288 CCAGAGGTACATGGAGGAACTGG + Intergenic
988929131 5:36018788-36018810 CAATAGGTTTATGGAGGAACAGG + Intergenic
989849983 5:46196842-46196864 CCAGAGGTATAAGGAGGAACTGG + Intergenic
990105173 5:52249297-52249319 CCAGAGGTATAAGGAGGAACTGG - Intergenic
990918190 5:60933592-60933614 CAATAGGTTTTGGGGGGAACAGG + Intronic
991419216 5:66424302-66424324 CAATAAGTTTTTGGGGGAACAGG + Intergenic
991541916 5:67739481-67739503 CCACAGGTACAAGGGGGAACTGG - Intergenic
992086533 5:73282985-73283007 CCCTAGGGTTGTGGGGGAACTGG - Intergenic
992339559 5:75808640-75808662 CCATAGGTTATTGGGGGAACAGG + Intergenic
992340477 5:75818052-75818074 TAAGTGGTATGTGGGGGAACAGG + Intergenic
992354869 5:75970737-75970759 CCAGAGGTACATGGAGGAACTGG + Intergenic
992360658 5:76034827-76034849 CCAGAGGTACATGGAGGAACTGG - Intergenic
992899169 5:81276180-81276202 CAGTAGGTTTTTGGGGGAACAGG - Intergenic
994523978 5:100880454-100880476 CCATAGGTATGTGGGTAAGAGGG + Intronic
994574162 5:101555118-101555140 CCAGAGGTACGAGGAGGAACGGG + Intergenic
994693868 5:103050167-103050189 CCAGAGGTATAAGGAGGAACTGG + Intergenic
995814474 5:116151437-116151459 CCAGAGGTACGAGGAGGAACTGG - Intronic
996128812 5:119755997-119756019 CCATAGGATTTTGGGGGAACAGG - Intergenic
996831911 5:127749691-127749713 CCATAGGTAAAAGGAGGAACTGG - Intergenic
996930618 5:128882277-128882299 CAATAGATTTTTGGGGGAACAGG + Intronic
997005976 5:129817046-129817068 CCAGAGGTATAAGGAGGAACTGG + Intergenic
997780169 5:136649596-136649618 CAATAGGTTTTTGGGGGAACAGG + Intergenic
998622968 5:143814860-143814882 CCACAGGTATTTGTGGGCACAGG - Intronic
998724649 5:144996568-144996590 CCAGAGGTACGAGGAGGAACTGG + Intergenic
999220585 5:149973552-149973574 CCATATATATGTGGGGGGAACGG - Intronic
999898807 5:156064513-156064535 CCAGAGGTACATGGAGGAACTGG - Intronic
999912980 5:156226081-156226103 CCATAGGTTACTGGGGGGACAGG + Intronic
999988562 5:157027857-157027879 CCATAGTTGTCTGGGGCAACAGG - Intergenic
1000883094 5:166719622-166719644 GCATAGGCATGTGGGTAAACAGG + Intergenic
1001176646 5:169475274-169475296 CCATAGGTTTGGTGAGGAACAGG + Intergenic
1001356240 5:171026289-171026311 CCATTTTTATGTGGGGAAACAGG + Intronic
1003252236 6:4440159-4440181 CCACAGTTTTTTGGGGGAACAGG + Intergenic
1004026969 6:11828241-11828263 ACATAGGTATTTGTGGGAAAAGG - Intergenic
1004340212 6:14801751-14801773 AGACAGGCATGTGGGGGAACTGG + Intergenic
1004389895 6:15201332-15201354 CCACTGGCTTGTGGGGGAACAGG + Intergenic
1004592610 6:17068444-17068466 CCCTAGGTTTTTGGGGGAACAGG + Intergenic
1004858650 6:19778039-19778061 CCATAGGTTTTTGGGGGAACAGG + Intergenic
1004881707 6:20014830-20014852 CTTTAGGTTTGTGGGGGGACAGG - Intergenic
1005930368 6:30479541-30479563 CAATAGGTTTTTGGGAGAACAGG - Intergenic
1006175108 6:32116814-32116836 CCCTAGGCAGGTGGGGAAACAGG + Exonic
1007182670 6:39941646-39941668 CCCTTGGTGTGTGGGAGAACAGG + Intergenic
1007927123 6:45659023-45659045 CCATATGTATGAGGGGGATGGGG + Intronic
1008235890 6:49049359-49049381 CCAAAGGTAGGTGGTGGAAAGGG - Intergenic
1008350216 6:50481057-50481079 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1008354021 6:50530132-50530154 CAATAGGTTTTTTGGGGAACAGG - Intergenic
1008406594 6:51124989-51125011 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1008431133 6:51418714-51418736 CAATAGGTTTTTGGAGGAACAGG + Intergenic
1009445492 6:63737666-63737688 CCAGAGGTATAAGGAGGAACTGG - Intronic
1009499511 6:64393194-64393216 CCATAGGTACAAGGAGGAACTGG + Intronic
1009507473 6:64503192-64503214 CCATAGATATGTGAAGAAACTGG - Intronic
1009744639 6:67797178-67797200 CCATAGGTTTTTGGTGGAACAGG - Intergenic
1010045897 6:71442812-71442834 CCATAGGTTATTGGGGGAATAGG - Intergenic
1010293128 6:74163131-74163153 CCATAGGTTGTTGGGGGTACAGG - Intergenic
1010983103 6:82391994-82392016 TCAGAGGTATGAGGAGGAACTGG - Intergenic
1011324022 6:86129462-86129484 CCTTAGGTATGTGCGGATACAGG - Intergenic
1011387015 6:86809242-86809264 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1011390320 6:86845093-86845115 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1012060770 6:94477058-94477080 CCATAGGTTATTGGGGGAACAGG - Intergenic
1012183212 6:96181454-96181476 TCATAGGTTATTGGGGGAACAGG + Intronic
1012251229 6:96983458-96983480 CCAGAGGTATATGGAGGAGCTGG - Intronic
1012347261 6:98206036-98206058 CCATTGGTATGTTGGATAACTGG + Intergenic
1012732942 6:102904943-102904965 CCAGAGAAAAGTGGGGGAACTGG - Intergenic
1013440311 6:110158134-110158156 CCAGAGGTACATGGAGGAACTGG - Intronic
1014092773 6:117423284-117423306 CCATAAGTTATTGGGGGAACAGG - Intronic
1014704496 6:124729121-124729143 CCAGAAGTATGAGGAGGAACTGG + Intronic
1015256499 6:131184290-131184312 CCTTAGATATGTCGGGGAGCAGG + Intronic
1015772469 6:136783444-136783466 ATATAGGTAGGTGGGGAAACTGG - Intronic
1015809015 6:137142701-137142723 CCATGGGTAGGTGTGGGAAAGGG - Intergenic
1016474373 6:144410431-144410453 CCATAGGTTTTGGGGGGAACAGG + Intronic
1017083367 6:150690226-150690248 CCATAAGTAATTGGGGGTACAGG + Intronic
1017302373 6:152876794-152876816 CCATAGGTTTTGGGGGGAACAGG - Intergenic
1017374425 6:153751545-153751567 CAATAGGTTTTTGAGGGAACAGG + Intergenic
1019788027 7:2991787-2991809 CCATAGGTTTTTGGGGGTACAGG + Intronic
1021354311 7:19635172-19635194 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1021620241 7:22544017-22544039 CAATAGGTTTTTGGGGGAACAGG - Intronic
1021875414 7:25044441-25044463 CCAGAGGTACATGGAGGAACTGG - Intergenic
1022264162 7:28737002-28737024 CCACAGGTCTGGGTGGGAACAGG - Intronic
1022953372 7:35359889-35359911 CCATAGGTTTCTGGGGGAACAGG + Intergenic
1024351371 7:48368323-48368345 CCATAGGTTTTTTGGGGAACAGG + Intronic
1026371386 7:69703149-69703171 TCATAGGTGTGTGCGGGAGCAGG + Intronic
1026956207 7:74377811-74377833 AAAAATGTATGTGGGGGAACTGG - Intronic
1027375837 7:77548530-77548552 CCATAGAAAGGTGGTGGAACTGG + Intronic
1027897675 7:84065833-84065855 CCAGAGGTACGAGGAGGAACTGG + Intronic
1028036459 7:85990159-85990181 CCATAGGTACAAGGAGGAACTGG - Intergenic
1028183458 7:87752453-87752475 CCAGAGGTACATGGAGGAACTGG - Intronic
1028307217 7:89280818-89280840 CCAGAGGTATAAGGAGGAACTGG + Intronic
1028636967 7:92999950-92999972 CCATAGATGTGTGGGGGAAGAGG + Intergenic
1029236493 7:99124017-99124039 CTACTGGTATGTGGTGGAACTGG + Intronic
1030572567 7:111246097-111246119 CCAGAGGTACATGGAGGAACTGG - Intronic
1030625344 7:111839842-111839864 CCATAGGTTTTTGGGGAAACAGG + Intronic
1030795176 7:113778704-113778726 CCAGAGGTACATGGAGGAACTGG - Intergenic
1033999345 7:147392373-147392395 CCATAGGTTTTTGGGGGAACAGG + Intronic
1034208146 7:149336599-149336621 CAATAGGTTTGGGGGGGAACAGG - Intergenic
1034452746 7:151146103-151146125 CCATGGGTATGTGTAGGAATAGG + Intergenic
1035168156 7:157003681-157003703 CCAAAGGTGTTTAGGGGAACTGG - Intronic
1035415765 7:158684309-158684331 CCATTGGCATGTGAGGAAACTGG - Intronic
1036133897 8:6141123-6141145 CCATAGGTTTTTTTGGGAACAGG - Intergenic
1037549744 8:19958588-19958610 CCATAGGTTATTGGGGGAACAGG + Intronic
1037989702 8:23312212-23312234 CCAGAGGTATAAGGAGGAACTGG + Intronic
1039000729 8:32977101-32977123 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1039468715 8:37800923-37800945 CCATGGGAATGTGGGGGAGATGG - Intronic
1041212546 8:55567331-55567353 CAATAGGTTTTTTGGGGAACAGG - Intergenic
1041884254 8:62789875-62789897 CCAGAGGTATAAGGAGGAACTGG + Intronic
1041885176 8:62800176-62800198 CAATAGGTTTTTTGGGGAACGGG - Intronic
1041957020 8:63567314-63567336 CCATAGGGTTGTGTGGGCACAGG + Intergenic
1042368353 8:67962498-67962520 CCAGAGGTATGTGGATGAAGGGG + Intronic
1042644374 8:70969766-70969788 CAATAGGTTTTTGAGGGAACAGG + Intergenic
1042815947 8:72878138-72878160 CCAGAGGTACATGGAGGAACTGG - Intronic
1043278805 8:78436954-78436976 CCATAGGTTTTTGGGGAAACAGG - Intergenic
1043625127 8:82247453-82247475 ACATAGGTTTTTGGGGGAGCAGG + Intergenic
1044178182 8:89156156-89156178 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1044183301 8:89221786-89221808 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1044380157 8:91524673-91524695 CCAGAGGTACATGGAGGAACTGG - Intergenic
1044383618 8:91562085-91562107 CCAGAGGTACATGGAGGAACTGG + Intergenic
1044601127 8:94006207-94006229 CCAGAGGTACAAGGGGGAACTGG - Intergenic
1045170958 8:99667357-99667379 CCACAGATATTTTGGGGAACAGG + Intronic
1045604189 8:103753515-103753537 CCAGAGGTATAAGGAGGAACTGG - Intronic
1045815905 8:106275615-106275637 CCATATTTATTTGGGGGAAAAGG + Intronic
1046812923 8:118552090-118552112 CCAGAGGTACGAGGAGGAACTGG + Intronic
1046894522 8:119458776-119458798 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1047815178 8:128455571-128455593 CCAGAGGTACATGGAGGAACTGG - Intergenic
1052051157 9:23850874-23850896 GCATAGGGAGGTGGGGGAAGAGG - Intergenic
1052078450 9:24174172-24174194 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1052091712 9:24336895-24336917 CCATAGGTTATTGGGGGTACAGG + Intergenic
1052627933 9:31001543-31001565 CCAGAGGTATGAGGAGGAGCTGG - Intergenic
1053685089 9:40513830-40513852 ACACAGGTATGTTTGGGAACTGG - Intergenic
1053935052 9:43142116-43142138 ACACAGGTATGTTTGGGAACTGG - Intergenic
1054278639 9:63111133-63111155 ACACAGGTATGTTTGGGAACTGG + Intergenic
1054298181 9:63349287-63349309 ACACAGGTATGTTTGGGAACTGG - Intergenic
1054396199 9:64653804-64653826 ACACAGGTATGTTTGGGAACTGG - Intergenic
1054430842 9:65158999-65159021 ACACAGGTATGTTTGGGAACTGG - Intergenic
1054499539 9:65862522-65862544 ACACAGGTATGTTTGGGAACTGG + Intergenic
1055302857 9:74900294-74900316 CCATAGGCTTTTTGGGGAACAGG + Intergenic
1055866918 9:80825671-80825693 CAATAGGTTTTTGGGGGAAGAGG - Intergenic
1055928700 9:81537741-81537763 CCACAGGTTTTTGGGGGAACAGG + Intergenic
1056962750 9:91141180-91141202 AGATAGATATATGGGGGAACCGG + Intergenic
1057328693 9:94091661-94091683 CCAGAGGTATAAGGAGGAACTGG - Intronic
1058396650 9:104561306-104561328 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1059240491 9:112800709-112800731 CCAGAGGTACATGGAGGAACTGG - Intronic
1060532409 9:124355609-124355631 CCAGAGCTGTGTTGGGGAACCGG - Intronic
1060882071 9:127124189-127124211 CCAGAGGAATGTGGTGGAAGTGG + Intronic
1061303825 9:129721453-129721475 CCATGGTCATGTGGGGGGACAGG + Intronic
1186427686 X:9476623-9476645 ACAGAGGTATGTAGGGGAATGGG + Intronic
1186528948 X:10276159-10276181 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1186587333 X:10889291-10889313 CCATAGGTTTTTGGGGAAACAGG + Intergenic
1186698796 X:12067306-12067328 CCATAGGAATTTCTGGGAACTGG - Intergenic
1186740265 X:12509711-12509733 CCATAGGTTATTGGGGGAACAGG - Intronic
1187134303 X:16531787-16531809 CAATAGGTTTTTGTGGGAACAGG - Intergenic
1188410126 X:29861674-29861696 CCATAGGTTTTTGGGGGAACAGG - Intronic
1189133538 X:38525585-38525607 CAATAGGCTTTTGGGGGAACAGG + Intronic
1189701964 X:43721098-43721120 CCACAGGTATGTGGGGAGATAGG + Intronic
1189962140 X:46333789-46333811 CCTTCGGTATGTGTGGGAGCTGG + Intergenic
1189992951 X:46611867-46611889 CCATAGCTAGGTGGGGGCGCTGG - Intronic
1190135361 X:47791416-47791438 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1190493095 X:51002414-51002436 CCACAGGCATGTGAGGCAACTGG - Intergenic
1190589777 X:51988073-51988095 CAATAGGTTTTTGGGGGAACAGG + Intergenic
1190685761 X:52871405-52871427 CAATAGGTTTTTGGGGGAACAGG - Intergenic
1191063509 X:56323203-56323225 CCATAGGTACAAGGAGGAACTGG + Intergenic
1191087404 X:56584099-56584121 CCAGAGGTATAAGGAGGAACTGG - Intergenic
1191100846 X:56726538-56726560 CTATAGGTTTTTTGGGGAACAGG - Intergenic
1191143844 X:57144534-57144556 CCATTGGTTTTTGGTGGAACAGG + Intergenic
1191707118 X:64105003-64105025 CAGTAGGTATATGGGGGAGCTGG - Intergenic
1191727736 X:64299157-64299179 CCAGAGGTACAAGGGGGAACTGG - Intronic
1192955178 X:76062790-76062812 CAATATGTATTTGGGGAAACAGG - Intergenic
1193877395 X:86877600-86877622 CCATAGGTTATTGGGGGTACAGG + Intergenic
1193989722 X:88291553-88291575 CCATAGGGTTTTTGGGGAACAGG - Intergenic
1195117415 X:101713656-101713678 CCAGAGGTACGAGGAGGAACTGG - Intergenic
1195342469 X:103918895-103918917 CCATAGCTCTGCAGGGGAACAGG + Intronic
1195873526 X:109513449-109513471 CCATAGGTTTTTTGGGGGACAGG - Intergenic
1196787974 X:119438046-119438068 CCAGAGGTACATGGAGGAACTGG - Intronic
1197870803 X:131060681-131060703 GCAGGGGTATGTTGGGGAACAGG - Intronic
1198306418 X:135388213-135388235 CCAGAGGTACGAGGAGGAACTGG + Intergenic
1199584645 X:149401480-149401502 CCACAGGTTTTTGAGGGAACAGG - Intergenic
1200581103 Y:4951494-4951516 CCAGAGGTACATGGAGGAACTGG - Intergenic
1200741216 Y:6855845-6855867 CCAGAGGTATAAGGAGGAACTGG + Intergenic
1201536702 Y:15056918-15056940 ACATTGGTATGTGAGAGAACAGG - Intergenic