ID: 952374670

View in Genome Browser
Species Human (GRCh38)
Location 3:32756135-32756157
Sequence AGAGTGATGAGAGGTGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952374670 Original CRISPR AGAGTGATGAGAGGTGAGTT GGG Intronic
900636492 1:3668718-3668740 AGAGTGATGAGAGCTGGGGACGG + Intronic
900708122 1:4093416-4093438 ACAGTTATGACAGGTGTGTTGGG + Intergenic
901118742 1:6872456-6872478 AGAGTGGGGAAAGGTGAATTTGG - Intronic
902435056 1:16393142-16393164 AAAGTGATGAGAGGTGGGTGTGG + Intronic
902974671 1:20080241-20080263 ACAGTGATCAGAGTTGAGCTTGG - Intronic
903755665 1:25658755-25658777 AGAATATTAAGAGGTGAGTTTGG - Intronic
903990997 1:27269454-27269476 AGAGGGATGAGAAATGAGGTTGG + Intronic
904010475 1:27387020-27387042 AGAGGGAGGAGAGGCGAGGTGGG - Intergenic
904386540 1:30146225-30146247 GGAGAGAGGAGAGGTGAATTTGG + Intergenic
904470650 1:30733929-30733951 AGAGAGATGAGGGCTGAGTATGG + Intronic
904776473 1:32911238-32911260 AGAGTGATGAGATTTGAGGAAGG - Intergenic
904854644 1:33488697-33488719 AGAGGGATGGGAGGTGAGGAAGG + Intronic
904916596 1:33974998-33975020 AGAGTGTTGTGAGGTGAACTGGG - Intronic
905138312 1:35818754-35818776 AGAGTGATAGGAGATGAGGTTGG + Intronic
905341529 1:37281710-37281732 GGAGTGATGTGATGTGACTTAGG - Intergenic
907087344 1:51687880-51687902 AGAGTGAAGAGAAGTGAGATTGG + Intronic
907482471 1:54754597-54754619 AGAGTCCTGAGAGGTGAGGGTGG - Intergenic
907678151 1:56537784-56537806 AGAGTGAGCAGAGCTGAGCTTGG + Intronic
907773637 1:57491048-57491070 AGAGAGATGTGAAGTGAGATGGG - Intronic
908039204 1:60089396-60089418 ATTTTGATGAGAGGTGTGTTTGG - Intergenic
909774465 1:79466739-79466761 AGAGTGATGAGAAATGATATGGG + Intergenic
909818580 1:80028406-80028428 AAAGTGATGAGATGTCACTTTGG + Intergenic
910549283 1:88457551-88457573 AGTGTGATGTGTGGTGTGTTTGG - Intergenic
910864423 1:91775319-91775341 AGAGTGGTGGGAGGTGCGATTGG - Intronic
911940712 1:104044097-104044119 AGGGTGATGCTAGCTGAGTTAGG + Intergenic
912795299 1:112689565-112689587 AGAGTGGGAAGAGGTGAGTGAGG - Exonic
913158120 1:116120139-116120161 AAAGTGATAGGAGGTGAGTTTGG - Intronic
913407055 1:118506025-118506047 AGACTGAGGAGAGGAGAGTGTGG + Intergenic
914984229 1:152442430-152442452 AGTTGGATGAGAGGTGAGCTGGG + Intergenic
916007708 1:160677398-160677420 AGGCTGCTCAGAGGTGAGTTTGG + Intergenic
916007729 1:160677496-160677518 AGGCTGCTCAGAGGTGAGTTCGG + Intergenic
916007747 1:160677595-160677617 AGGCTGCTCAGAGGTGAGTTTGG + Intergenic
916007757 1:160677660-160677682 AGACTGCTCAGAAGTGAGTTTGG + Intergenic
916523824 1:165590589-165590611 AGAGTGGTGGGAAATGAGTTTGG - Intergenic
916794059 1:168149627-168149649 AGGGTGAGGAGAGGAGAGGTGGG + Intergenic
917318734 1:173757147-173757169 ATAGTGTTGAAAGGTGAGTAAGG + Exonic
917964688 1:180170970-180170992 AGGGCAATGTGAGGTGAGTTTGG + Intronic
919690140 1:200521769-200521791 AAAATGATTAAAGGTGAGTTAGG + Intergenic
920452236 1:206068286-206068308 AAAGTGAGGAGAGTTGAGTTGGG + Intronic
921046641 1:211482491-211482513 AGTGGGCTGAGAGGTGAGTGCGG + Intronic
921418966 1:214923911-214923933 AGAGTGAGGCCAGGAGAGTTGGG - Intergenic
922061731 1:222099156-222099178 AGAGTGATGAGGAGTGAGACTGG + Intergenic
923143012 1:231177213-231177235 AGAGAGATGGGAGTTGAGTTGGG + Intronic
923512312 1:234663166-234663188 TGAGTGAGGTGAGGTGAGTGAGG - Intergenic
1064196835 10:13250534-13250556 AAAGTGATGAGAAGGGAGCTCGG + Intergenic
1064279682 10:13940312-13940334 AGAGTGAGGAAAGGTGAGGAGGG - Intronic
1064674267 10:17745847-17745869 AGAGAGAGAAGTGGTGAGTTAGG - Intergenic
1066024496 10:31340994-31341016 AGAGTGATTGGAGTTGAGTCTGG + Intronic
1068300230 10:55129463-55129485 AGAGAGATGAGAGGAAACTTAGG - Intronic
1068372003 10:56129286-56129308 AGGGTGATGCTAGATGAGTTAGG - Intergenic
1068842002 10:61626018-61626040 AGAGGAATAAGAAGTGAGTTTGG - Intergenic
1070369829 10:75771655-75771677 AGAGAGATGAGATTTGAGTATGG + Intronic
1070460831 10:76668192-76668214 AGAGTGCTGAGAGTTGAGGGTGG + Intergenic
1070490398 10:76970654-76970676 GGAGGGATAAGAGCTGAGTTGGG - Intronic
1072852567 10:98911615-98911637 AGAGTAATCAGAGATGAGGTAGG + Intronic
1073035297 10:100560671-100560693 GGAGACATGAAAGGTGAGTTTGG + Intergenic
1073182154 10:101590344-101590366 AGAGAGATGACAGATAAGTTGGG + Intronic
1074193468 10:111158359-111158381 AGAATGGTGAGAAGTGAGATTGG + Intergenic
1074383383 10:112998052-112998074 AGAGTGAAGGGAGATGAGGTGGG + Intronic
1075205462 10:120444046-120444068 TGAGTGATGAGTGGTGTGTGGGG + Intergenic
1076398191 10:130157122-130157144 AGATAGATGAGAGGGGATTTAGG + Intronic
1077671706 11:4163846-4163868 AGAGTGATTTGAGATGAGCTAGG - Intergenic
1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG + Intronic
1078603252 11:12751848-12751870 AGAGTGCTCAGAGGTGGTTTTGG - Intronic
1079051167 11:17161030-17161052 AGAGTTGGCAGAGGTGAGTTTGG + Intronic
1079110248 11:17601394-17601416 GGTGTGATGAGATGTGAGCTGGG + Intronic
1079127665 11:17730424-17730446 AGAGGGATGAGAAGTGGGCTAGG + Intergenic
1079486258 11:20938796-20938818 AGAGTGATGAGAGATGAACCTGG + Intronic
1080216136 11:29843537-29843559 AGGGTGATGAGAGATGATGTTGG - Intergenic
1081187439 11:40061691-40061713 AGAAGGATGAGAATTGAGTTTGG + Intergenic
1081680388 11:44998544-44998566 AGAGTGATGCCAGGTGAGGCTGG + Intergenic
1083282619 11:61636558-61636580 AGAGTGAAGAGAGGTGAGGTTGG - Intergenic
1084729743 11:71065586-71065608 AGAGAGATGAGCAGTGAGTGGGG + Intronic
1084729792 11:71065798-71065820 AGGGAGATGAGTGGTGAGTGGGG + Intronic
1084729807 11:71065852-71065874 AGGGAGATGAGCGGTGAGTGGGG + Intronic
1084729821 11:71065902-71065924 AGGGAGATGAGCGGTGAGTGGGG + Intronic
1084729849 11:71066009-71066031 AGGGAGATGAGTGGTGAGTGGGG + Intronic
1085253094 11:75156378-75156400 GGAGAGATGAGAGATGAGCTGGG + Intronic
1086351981 11:85951403-85951425 AGAGTGATGTGAGCAGAGTGTGG - Intergenic
1086681639 11:89680393-89680415 AGATTTTTGAGAGGTGAGCTGGG + Intergenic
1087723633 11:101694541-101694563 TGAGTTATGAGAGCTGATTTAGG - Intronic
1088728100 11:112657132-112657154 AGAGAGAGGAGAGGGGAGGTAGG - Intergenic
1089152226 11:116373046-116373068 ACAGTGCTGAGAGGTGGGTGGGG - Intergenic
1090140764 11:124257944-124257966 AGAGAGAAGAGAGGTGATGTTGG - Intergenic
1090521009 11:127479342-127479364 ACAGAGCTGAGAGCTGAGTTGGG + Intergenic
1090617633 11:128530303-128530325 AGATAGATGAGATGTGAGCTGGG - Intronic
1091087088 11:132731906-132731928 AGAGGTATGAAAGGTGAGGTTGG + Intronic
1091193076 11:133710483-133710505 AGGGTGATAGGAGTTGAGTTTGG - Intergenic
1091511319 12:1129688-1129710 AGAATGATGAGAGTTCAGCTTGG - Intronic
1091810323 12:3391511-3391533 GGAGTGATGGGAGAAGAGTTTGG + Intronic
1092459536 12:8674198-8674220 ATTGTGAGAAGAGGTGAGTTAGG - Intergenic
1092758590 12:11788627-11788649 AGAGTGAAGGGAGGGGAGTGGGG - Intronic
1093539577 12:20265346-20265368 AGAGTGGTGAGAGAAAAGTTGGG - Intergenic
1094402833 12:30080939-30080961 ATAGTGCTGAGAGGTGAGACTGG + Intergenic
1095352963 12:41236557-41236579 AGAGAGAAGAAAGGTCAGTTAGG + Intronic
1096581829 12:52590624-52590646 AGAGGGGTGAGAGGTGAATGAGG - Intronic
1096821165 12:54235980-54236002 AGAGAGAAAACAGGTGAGTTGGG - Exonic
1098555053 12:71809023-71809045 AGAGTGATAGGAGATGAATTTGG + Intergenic
1101195084 12:102373397-102373419 GGAGAGGTGAGAGGTGAGTGGGG + Intergenic
1102762085 12:115396627-115396649 AGGGTGATGAGAACTGAGTCAGG - Intergenic
1102765595 12:115430475-115430497 AGAGGAATAAGAAGTGAGTTGGG - Intergenic
1102852837 12:116266446-116266468 AGAGTGTGGAGAGGTGAGGATGG - Intronic
1104502474 12:129299586-129299608 AGTTTGATGAGAGGTGGGGTGGG - Intronic
1105414323 13:20195161-20195183 AGAAGGAGGAGAGGTGAGGTGGG + Intergenic
1105910810 13:24864320-24864342 ACAGTGAGGAGCAGTGAGTTTGG + Intronic
1108289560 13:48945278-48945300 AGAGTAATGACATGTGTGTTTGG + Intergenic
1108427476 13:50318580-50318602 AGAATATTGAGGGGTGAGTTTGG + Intronic
1110002374 13:70220336-70220358 AGAGTCATAAGAGATGAGGTGGG + Intergenic
1111739255 13:92182005-92182027 AGAGTATTGAGAGCTGGGTTGGG + Intronic
1112942588 13:104883233-104883255 AGATTAAAGAGAGGTGATTTGGG + Intergenic
1114182776 14:20379835-20379857 AGAGTGATAACAGGTGTGTTTGG + Intronic
1114628525 14:24145217-24145239 AGAGAGATAAGAGGTGACTAGGG - Intronic
1115751904 14:36502540-36502562 GGAATGATAAGAGGTGACTTAGG - Intronic
1117831739 14:59758242-59758264 AGAGTGAGAAGAGGTGAGGCTGG - Intronic
1118152961 14:63209353-63209375 AGAGTGTTAAGAGATGAGATTGG - Intronic
1122142217 14:99669088-99669110 TGAGTGATGAGAGCTGAGGAAGG - Intronic
1202829085 14_GL000009v2_random:6320-6342 AGAGTAATTAGAGGTAAATTAGG + Intergenic
1123450470 15:20356714-20356736 AGGGTGCACAGAGGTGAGTTTGG + Intergenic
1124010359 15:25833510-25833532 AGAGTGAAGAGAAGTGTGGTAGG - Intronic
1124012845 15:25852508-25852530 AGAGGATTGAGAGGTGAGGTTGG - Intronic
1124998291 15:34745520-34745542 GAAGTCATGGGAGGTGAGTTTGG - Intergenic
1125044874 15:35233727-35233749 AGAGTGATGAGGGGTGAGGTGGG - Intronic
1126558868 15:50021623-50021645 AGAGTGATGGGATGGGAGATGGG - Intronic
1127287542 15:57544585-57544607 AGAGTGAGGAGAGGTGAGCCGGG + Exonic
1127373023 15:58357854-58357876 AGAGTGATGTTAGGTGACTGAGG - Intronic
1127376575 15:58390464-58390486 AGAGAGCTGAGAGGTGACTCTGG - Intronic
1127661543 15:61104113-61104135 AGGAAGATGACAGGTGAGTTGGG - Intronic
1128383792 15:67132803-67132825 GGAGTGATGAGTGGGGAGTGCGG - Intronic
1128477103 15:68006579-68006601 AGAGTCAAAAGAGATGAGTTTGG + Intergenic
1128689283 15:69710970-69710992 AGAGTGATGAGAGATGAGCCTGG - Intergenic
1129000018 15:72325025-72325047 AGAGAGAGGAGAGGGGAGATGGG - Intronic
1129791544 15:78343902-78343924 AGCCTGATGAGAGGGGAGCTTGG - Intronic
1131022175 15:89108157-89108179 TGAGTCATGAGAGGTAATTTGGG + Intronic
1132813900 16:1817001-1817023 AGAGAGGTGACAGGTGAGCTCGG + Intronic
1133417035 16:5614952-5614974 AGAGTGATGAGAGATGGGTGGGG + Intergenic
1133897750 16:9945447-9945469 AGAGTGGTGAGACATGAGTTAGG + Intronic
1135106299 16:19652953-19652975 AGAGTGATGTGAGATGAGACAGG + Intronic
1135197168 16:20403969-20403991 AGAGTGCTGAAAGCTGAGATGGG - Intronic
1135269433 16:21056329-21056351 AGAGTGAGGGGAGGGAAGTTAGG - Intronic
1136077496 16:27827021-27827043 ACAGTGATGGAAGGGGAGTTGGG - Intronic
1136247210 16:28982956-28982978 AGGCTGATGAGAGCAGAGTTGGG + Intronic
1138731810 16:59203826-59203848 AGGGTGATGATAGGAGAGTATGG + Intergenic
1139063890 16:63289851-63289873 AAGGTAATGAGAGGAGAGTTAGG + Intergenic
1139722130 16:68864922-68864944 AGAGAGAGGACAGGAGAGTTAGG + Intronic
1140140000 16:72246551-72246573 GGAGTGATGAGAGGGGACTGGGG - Intergenic
1141133688 16:81451994-81452016 AGGGTGATGAGACGTGCGTGTGG + Intronic
1141659099 16:85432056-85432078 AGAGGGGTGAGGGGTGAGTTCGG - Intergenic
1142520817 17:503387-503409 AGAGTGGTTAGGGGTGAGTAAGG + Intergenic
1143173213 17:4942119-4942141 AGAGGGATGATGGGAGAGTTTGG + Intronic
1144599412 17:16599299-16599321 GCAGTGTTGAGAGGTGATTTGGG + Intergenic
1146180293 17:30693829-30693851 AGTGTGAAGAGAGGTGGGTTCGG - Intergenic
1146557535 17:33839484-33839506 AGAGTGTAGAAGGGTGAGTTTGG - Intronic
1146655212 17:34630927-34630949 ACAGTGGTCAGAAGTGAGTTGGG + Intronic
1147605969 17:41773805-41773827 AGAGAGAGCAGAGGAGAGTTTGG + Intronic
1147863279 17:43536486-43536508 AGAGAAGTCAGAGGTGAGTTTGG + Intronic
1148127365 17:45243763-45243785 AGAGGGAGGAGAGGGGAGATTGG - Intronic
1148629445 17:49095548-49095570 AGAGAGATGAGAGGGGAGAGGGG - Intergenic
1149092914 17:52805158-52805180 ACAGTGAAGAGAGATAAGTTGGG - Intergenic
1150191898 17:63251093-63251115 AGAGTAATGAAAGATGAATTGGG + Intronic
1151552472 17:74830062-74830084 AGACCGAAGAGAGGTGAGCTGGG + Intronic
1152371128 17:79889235-79889257 AGAGGGGTGAGAAGGGAGTTTGG - Intergenic
1155298515 18:24407589-24407611 ATAGTGATGAGAGATGAGTCTGG - Intergenic
1155370875 18:25099038-25099060 AGAGTGTTGAGAACTCAGTTTGG + Intronic
1155699186 18:28722259-28722281 AAATTGATGGCAGGTGAGTTTGG + Intergenic
1156260404 18:35440615-35440637 AGAGTGATGTGGGCTGACTTCGG - Intergenic
1156935851 18:42706350-42706372 AGAATGATTAGAGGTGATTAAGG + Intergenic
1157092546 18:44653134-44653156 AGAGAGGTGAGACGTGAGTTAGG - Intergenic
1159915282 18:74182717-74182739 ATTGTAATGAGAGGTGAGTCAGG - Intergenic
1162978307 19:14221711-14221733 AGTGTGAAGAGAGGTGGGTTCGG + Intergenic
1164063335 19:21693963-21693985 CCACTCATGAGAGGTGAGTTTGG - Intergenic
1165934729 19:39382504-39382526 ACAGTGATGAGAGATGAGGGTGG + Intronic
1166626244 19:44358794-44358816 AGAGTGAAGAATGGTGGGTTTGG - Intronic
1167004481 19:46766731-46766753 AGAGTGGGAAGAGGTGAGGTCGG + Intronic
1167297223 19:48658432-48658454 AGACTTATAAGAGGTGAGGTCGG + Intergenic
1202643612 1_KI270706v1_random:121469-121491 AGAGTAATTAGAGGTAAATTAGG - Intergenic
925104956 2:1283242-1283264 AGATTGGTGAGAGGTGACTTCGG - Intronic
925510707 2:4622155-4622177 AGAGTGGTGAGGGGTGTGTAAGG - Intergenic
926366823 2:12140932-12140954 TGAGTGAATAAAGGTGAGTTTGG - Intergenic
926381438 2:12294498-12294520 AGAGTGACCGGAGGTGAGTGGGG + Intergenic
926756681 2:16242034-16242056 CGAGTGATGAGAGGTTACTCTGG + Intergenic
927318148 2:21710139-21710161 AAAGTGATGAAAGGTAAGTCAGG - Intergenic
930832911 2:55764267-55764289 AGTGCCATGAGAGGGGAGTTGGG + Intergenic
930840878 2:55843665-55843687 AGAGTGCTCAGAGGTGGGTGGGG - Intergenic
931465989 2:62487293-62487315 AGAGTGATGTGATGTGAGAAAGG - Intergenic
931684431 2:64781426-64781448 GCAGAGGTGAGAGGTGAGTTGGG - Intergenic
932262795 2:70341414-70341436 GGAGTGATGGGAAGTGTGTTGGG + Intergenic
934299128 2:91766599-91766621 TGAGTCATGAGAGATGAGTCAGG + Intergenic
934730739 2:96655219-96655241 AGAGTGAAAAGATGTGATTTGGG + Intergenic
934760493 2:96853256-96853278 AAAGTGATGACAGGTGAGCAAGG + Intronic
935116054 2:100137463-100137485 AGAGTACTGAGGGGTAAGTTAGG - Intronic
935920225 2:108004675-108004697 GGTATGATGAGAGGTGAGTGAGG - Intronic
937815593 2:126247391-126247413 AGAGTGATGAGAAATATGTTTGG + Intergenic
938250649 2:129813134-129813156 TGAGGGATGAGAGGAGAGTCAGG - Intergenic
938364536 2:130724413-130724435 AGAGTGATGAGAAATCAGTGGGG + Intergenic
939951970 2:148486273-148486295 AGAGTGGTGAGAGCTGAGGCTGG - Intronic
940581899 2:155590977-155590999 TGAGTGAAGAGAGGAGAGTTCGG + Intergenic
940748285 2:157595715-157595737 TGAGTTATGAGAGATGAGGTTGG - Intronic
941051200 2:160736117-160736139 AGAAGGATGAGAGATGAGTCTGG - Intergenic
941208254 2:162602168-162602190 AGTTTGGTTAGAGGTGAGTTGGG + Intronic
941525912 2:166607038-166607060 AGTATTATGAGAGGTGAGTCCGG - Intergenic
941704586 2:168644385-168644407 AGAATGATGAGAGGCAAGTGAGG + Intronic
941918727 2:170828820-170828842 AGAGGGAGGAGAGGTGAGGACGG - Intronic
942504457 2:176626891-176626913 AGAGCAAGGAGAGGGGAGTTAGG - Intergenic
942826840 2:180188380-180188402 AGAGTCATAAGACCTGAGTTTGG + Intergenic
942949001 2:181701617-181701639 AGAGTGGAGAGAAGTGATTTAGG + Intergenic
943236671 2:185330185-185330207 ATAGTTATCAGAGGTGAGGTAGG - Intergenic
945911047 2:215649621-215649643 GGAAGGATGAGAGGTGAGTGAGG - Intergenic
946308019 2:218867003-218867025 AGTGGGATCTGAGGTGAGTTTGG + Intronic
946531686 2:220577555-220577577 AGATTGATGACAGATGATTTGGG + Intergenic
947614953 2:231549916-231549938 CGAGAGATGAGAGGAGATTTGGG + Intergenic
948271958 2:236681152-236681174 TGAGTGATGAGAGGTGATGGTGG + Intergenic
948372210 2:237496525-237496547 AGAGTACTGAGAGGTGACCTGGG - Intronic
1169172077 20:3472899-3472921 AGAGTTGTGAGAGAGGAGTTTGG + Intronic
1170243794 20:14198038-14198060 AGAATGCTGAGTGGTGATTTGGG + Intronic
1171102909 20:22402849-22402871 AAAATGATGATAGGTGAGTATGG - Intergenic
1171876110 20:30578357-30578379 AGAGTGAAGAATGGTGGGTTTGG + Intergenic
1172126996 20:32630351-32630373 AGAGTAAGGAGAGCTTAGTTTGG + Intergenic
1172216381 20:33238540-33238562 AGAGTGATGCCAAGTGAGTAAGG + Intronic
1172376792 20:34448956-34448978 AGAATTATGAGAAGAGAGTTGGG - Intronic
1172397618 20:34620217-34620239 AGAGTGGTGAGAGGTGAAACTGG - Intronic
1173437481 20:43046032-43046054 GGAGGGATAAGAGGTGAGTAGGG + Intronic
1174037092 20:47674979-47675001 AGAGTGCTGAGGGCGGAGTTTGG - Intronic
1174104143 20:48150172-48150194 TGAGTGATGGGTGGTGATTTAGG + Intergenic
1174256347 20:49258418-49258440 AAAGGAATGAGAGGAGAGTTAGG + Intronic
1174553982 20:51381020-51381042 AGAGTACTGGGAGGTGAGGTAGG + Intergenic
1174647510 20:52098503-52098525 AGAGTGATGACAGGGGCCTTCGG + Intronic
1174710803 20:52703060-52703082 AGGGTGAGGAGAGGTGGGGTGGG - Intergenic
1174969776 20:55261932-55261954 ACAGTGGTAAGAGGTGAGTCAGG + Intergenic
1175525841 20:59632789-59632811 AGAGTGATGTGAGGGGAAGTAGG - Intronic
1175587322 20:60152086-60152108 GGACTGATGGTAGGTGAGTTAGG - Intergenic
1175629598 20:60523960-60523982 AGCGTGTTGAGAGGTGAGATGGG - Intergenic
1176608269 21:8851159-8851181 AGAGTAATTAGAGGTAAATTAGG + Intergenic
1177412462 21:20747978-20748000 AGAGTGATGAGAGTTAAACTAGG + Intergenic
1179017944 21:37609968-37609990 AGAGAGATGAGCTGTGAGGTAGG - Exonic
1180058091 21:45369627-45369649 AGCATGATGGGAGGTGAGATCGG + Intergenic
1180102502 21:45595368-45595390 TGAGTGCTGAGAGCTGAGTCCGG + Intergenic
1180358353 22:11860964-11860986 AGAGTAATTAGAGGTAAATTAGG + Intergenic
1180379909 22:12131366-12131388 AGAGTAATTAGAGGTAAATTAGG - Intergenic
1180717747 22:17883392-17883414 ATACTGAGGAGTGGTGAGTTGGG - Intronic
1180735126 22:18010795-18010817 AGAGGGATGGGTGGGGAGTTGGG + Intronic
1180941324 22:19661249-19661271 AAAGAGATGAGAGGGGAGGTAGG + Intergenic
1181324419 22:22033742-22033764 ACAGTGAGGAGAGCTCAGTTGGG + Intergenic
1181359444 22:22323385-22323407 AGAGTGATGGGAGGAGGGTGAGG - Intergenic
1183134631 22:35874846-35874868 AGGGTGCAAAGAGGTGAGTTAGG - Intronic
1183837068 22:40463308-40463330 GGAGAGATGAGGGGTCAGTTGGG + Intronic
1184777288 22:46629538-46629560 AGGGTGATGAGAGGGGACCTCGG - Intronic
949367457 3:3298474-3298496 AGAGTGCTGAGAGCTGTGTTTGG + Intergenic
951844123 3:27067150-27067172 AGAGGGATGGGAAGTGACTTTGG - Intergenic
952135755 3:30417300-30417322 AGAGTGATGTGAGGCCAGTCGGG - Intergenic
952374670 3:32756135-32756157 AGAGTGATGAGAGGTGAGTTGGG + Intronic
952527203 3:34223236-34223258 AGATTGAGAAGAGATGAGTTAGG + Intergenic
954278491 3:49558364-49558386 GGAGTGAAGAGAGGCGACTTTGG - Intronic
954628925 3:52037854-52037876 GGAGTGATGGGAGGAGAGATGGG - Intergenic
954908663 3:54085057-54085079 AGAGTGGTGCAAGGTGAGTTTGG - Intergenic
955317700 3:57952614-57952636 TGAGTAATGAGAAATGAGTTTGG - Intergenic
955926609 3:64012375-64012397 AGGGTGGTGAGAGTAGAGTTGGG - Intronic
956450712 3:69372007-69372029 AAGGTCATGAGAGGTGGGTTTGG - Intronic
957825966 3:85444381-85444403 AGAGCAGTGGGAGGTGAGTTTGG - Intronic
960268071 3:115644095-115644117 AGAGTGATGAAAGAAGAATTTGG + Intronic
960369975 3:116823221-116823243 AGAGTGAAGAGAGGGGAGGTGGG + Intronic
960536572 3:118822085-118822107 AGAGTGTTGAGAGGTGGGGGTGG - Intergenic
962850229 3:139302915-139302937 GAAGTGGTGAGAGGTGAGGTTGG + Intronic
962955577 3:140263306-140263328 AGGGTGATAAGAGATGAGGTGGG + Intronic
964440217 3:156700816-156700838 AAAGTAATAAAAGGTGAGTTTGG + Intronic
965881608 3:173395385-173395407 AGAGGAAAGAGAGGGGAGTTTGG + Intergenic
966017996 3:175166923-175166945 TGATTGATTAGAGGTGAGTTAGG - Intronic
966196367 3:177318068-177318090 AGAGTGGTTAGATGTGGGTTTGG - Intergenic
966248423 3:177834626-177834648 GGAATGATGAGAGGTGAGACAGG + Intergenic
967089957 3:186126765-186126787 TGAGTGGTGGGAGGTGAGCTAGG + Intronic
967502598 3:190217266-190217288 TGAGTCATGAGATGTGAGTTAGG + Intergenic
967580061 3:191142134-191142156 AGAGAGATGAGAAATGAATTTGG - Intergenic
967859127 3:194138265-194138287 GGAGGGAAGAGAGGTGGGTTGGG - Exonic
969170405 4:5357827-5357849 ACAGTGATGGGAGGTGTGGTGGG - Intronic
969254362 4:5992352-5992374 CGAGCCATGGGAGGTGAGTTGGG + Intergenic
970202361 4:13622936-13622958 AAAGTGACAAGAGGTGAGGTAGG - Intronic
970450763 4:16164955-16164977 AGAGGGAGGAGAGGAGAGTTGGG - Intronic
970476890 4:16432811-16432833 AGAGTGAGGAGACGAGAGTGTGG - Intergenic
970483614 4:16502827-16502849 ACTCTGATGGGAGGTGAGTTTGG - Exonic
970706561 4:18810945-18810967 AGAGTGGTGAGAGAAGAGATAGG + Intergenic
971425688 4:26512782-26512804 AGAGGGAGGAGAGATGAGTTGGG + Intergenic
975165255 4:71171255-71171277 AGAGTGTGGAGAGGAGAGTGTGG + Intergenic
975538121 4:75473557-75473579 AGTGTGATGAGAGCTAAGGTGGG - Intergenic
975645660 4:76543277-76543299 TGAGTCTTGAAAGGTGAGTTAGG + Intronic
976195800 4:82530196-82530218 GGAGTGAAGAGATATGAGTTTGG + Intronic
977645805 4:99410304-99410326 GGAGTGATGAGGGGTGTGTGAGG + Intergenic
978247704 4:106595030-106595052 GAAGTGATGAGAAGTGGGTTAGG - Intergenic
978573261 4:110163329-110163351 AGTGTGATAGGAGGTGACTTGGG - Intronic
978573350 4:110164419-110164441 AGACTTATGAAAGCTGAGTTAGG - Intronic
979507909 4:121519138-121519160 AGAGGGAGGAGAGGTAAGTAGGG + Intergenic
979995504 4:127426332-127426354 AGAGTGACCAGCGGTGAGTGGGG - Intergenic
980141674 4:128924956-128924978 AGAGTGAGGAGAGAGGAGTGAGG - Intronic
980947786 4:139339826-139339848 AGACTGAAGATAGGTGGGTTGGG + Intronic
981484159 4:145267596-145267618 GGAGGGAAGAGAGGTGAGTGAGG + Intergenic
982522465 4:156436091-156436113 AGAGTGACGCAAGGTGAGTGTGG + Intergenic
984030365 4:174596744-174596766 ACAGGGATGAGAAGAGAGTTAGG - Intergenic
984577101 4:181463457-181463479 TGAGTGAAGATAGGTGAATTGGG - Intergenic
1202770979 4_GL000008v2_random:207383-207405 AGAGTAATTAGAGGTAAATTAGG - Intergenic
985892801 5:2728991-2729013 AGAATGCTGAGAGGTGCGTGTGG - Intergenic
986813831 5:11386302-11386324 TGAGGGATGAGAGGTGGGTGGGG + Intronic
988263040 5:28913192-28913214 ACAGTGATCAAAGGGGAGTTAGG + Intergenic
989073387 5:37535398-37535420 AGAGTGATAGGAAATGAGTTTGG + Intronic
989285084 5:39690220-39690242 AGAGTGTTGGGAGATGAGATGGG + Intergenic
990569320 5:57061807-57061829 AGAGTGGTAAGAGGTGAGGCTGG - Intergenic
990607003 5:57420901-57420923 ATGGTGTTGAGAGGTGAGGTGGG + Intergenic
990902928 5:60772635-60772657 AGAGGGAGGAGAGTGGAGTTGGG - Intronic
991170305 5:63616730-63616752 AGTGTGGTTAGAGGTGAGTGGGG - Intergenic
992445064 5:76826097-76826119 AGAGGAGTGGGAGGTGAGTTTGG - Intronic
992990709 5:82280063-82280085 AGAGTTGTGAGTTGTGAGTTGGG + Intronic
993072854 5:83187581-83187603 AGAATGGTGAGAGATGAGATTGG + Intronic
995195563 5:109363441-109363463 AGAGTGATGAGAGATGCTGTTGG - Intronic
995588422 5:113673239-113673261 AGAGTGAGGAGAGATGAGGCAGG + Intergenic
995654558 5:114410680-114410702 AGAGAGAGCAAAGGTGAGTTAGG + Intronic
995870217 5:116736596-116736618 AGGGTGAGCAGAGGAGAGTTAGG + Intergenic
997039298 5:130233041-130233063 GGAGTGATGAGAGGAAAGATAGG - Intergenic
997047410 5:130334874-130334896 AGAGTAATTAGAGGTGTCTTAGG + Intergenic
997379506 5:133425566-133425588 AGAGTCTTGGGAGGTCAGTTGGG - Intronic
998389009 5:141774872-141774894 AGAGTGATGAGAAATGAATGTGG - Intergenic
998556245 5:143126886-143126908 AGTGTGATAAGGTGTGAGTTTGG - Intronic
998563326 5:143192641-143192663 TGAGTACTGAGAGGGGAGTTGGG + Intronic
999178610 5:149652443-149652465 GGAGTAATGGGAGGTGAGATTGG + Intergenic
1000858699 5:166430932-166430954 AGAGTGAATAGAGGTCAGTGGGG + Intergenic
1001797556 5:174514760-174514782 ACAAAGATGAGAGGTGAGCTGGG + Intergenic
1001868712 5:175131340-175131362 GGAGTGAGGAGGGGTGAGTAAGG - Intergenic
1002479239 5:179488638-179488660 ATAGTGATGAGAGATGTGTGAGG + Intergenic
1004976857 6:20977502-20977524 GAAGTGATGAGAGAAGAGTTTGG + Intronic
1005559054 6:27019550-27019572 AGTGTTTTGAGAGGAGAGTTTGG - Intergenic
1005891370 6:30141602-30141624 AGAGGCATGAGAGCTGAGTTGGG + Intronic
1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG + Intergenic
1007165339 6:39824971-39824993 AGAATGATGAGAGGTGACCTGGG + Intronic
1007377887 6:41468924-41468946 AGAGTGAGGAGTGGTCAGTAGGG - Intergenic
1008081220 6:47196190-47196212 AGTGTGATGAGTCGTGAGGTTGG - Intergenic
1009698602 6:67143807-67143829 TGAGTAATGAGAGTTGAGGTGGG - Intergenic
1010025704 6:71213765-71213787 AAAGTGATGATAGGTCAATTTGG - Intergenic
1010855022 6:80827041-80827063 AGATGGATCAGAGGTGAGATTGG - Intergenic
1010951883 6:82046712-82046734 AGAGAGATGAGTCCTGAGTTGGG + Intergenic
1011208301 6:84925717-84925739 AGAGTGATGAGGGCTGAGTTGGG + Intergenic
1012242039 6:96884233-96884255 AAAGTCGTGAGAGATGAGTTTGG + Intergenic
1012977929 6:105800033-105800055 AGAGTCAGGAGAGTGGAGTTGGG - Intergenic
1015597520 6:134879950-134879972 AGAGTGTTGAGTGGTGGGATTGG - Intergenic
1016158556 6:140845780-140845802 AGAGCTATGTGAGGTGTGTTAGG + Intergenic
1016527117 6:145014286-145014308 AGAGTGAGGGGAGAAGAGTTGGG + Intergenic
1018812493 6:167308002-167308024 AGAGCCAAGAGAGATGAGTTGGG + Intronic
1019848168 7:3527636-3527658 TGAGTGGTGGGAGGTGAGGTTGG + Intronic
1019848254 7:3528049-3528071 TGAGTGGTGGGAGGTGAGGTTGG + Intronic
1020477280 7:8611748-8611770 AAAGTGATGATAGGAGACTTTGG + Intronic
1022093858 7:27125844-27125866 ACAGTGAGGAGAGCAGAGTTTGG + Intronic
1022122514 7:27323292-27323314 AGAGAGGTGAAAGGTCAGTTAGG - Intergenic
1022795331 7:33727348-33727370 AAAGTGATGGGAGGAGTGTTTGG + Intronic
1023122820 7:36926352-36926374 AGAGGGATGGGAGTTGAGTGAGG - Intronic
1023272575 7:38480535-38480557 GGACTGGTGAGAGGTGGGTTGGG + Intronic
1023330566 7:39111673-39111695 AGAGTGAAGAGCGTTCAGTTTGG + Intronic
1023617835 7:42038464-42038486 AAAGAGCTGAGAGGTAAGTTAGG + Intronic
1023620920 7:42071734-42071756 AGGGAGATGAGAGGCAAGTTTGG - Intronic
1023652793 7:42388997-42389019 GGAGAGAGGAGAGGTGAGTTTGG + Intergenic
1024283993 7:47741426-47741448 AGAGTGAAGAGTAGTGAGGTTGG - Intronic
1026098668 7:67367026-67367048 AGAAGGATGGGAGGGGAGTTAGG + Intergenic
1026385261 7:69840654-69840676 ATAGTGATGAGAGATGGGGTGGG + Intronic
1026413967 7:70157889-70157911 AGTGGGAGGAGAGGTGACTTTGG + Intronic
1027828722 7:83150524-83150546 GGAGTGATGATTCGTGAGTTTGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028294587 7:89112761-89112783 AGAGTGAAGAGAGAGGAATTAGG + Intronic
1028493956 7:91443666-91443688 AGAGTCCTGAATGGTGAGTTTGG + Intergenic
1029576866 7:101409182-101409204 AGTGAGATGAGAGTTGAGTGTGG - Intronic
1029685857 7:102147396-102147418 TGAGTGATGAGTGGTGAGCTGGG + Intronic
1029735025 7:102460872-102460894 AGAGTGAGGAGAAGGGAGGTTGG - Intronic
1031359613 7:120832748-120832770 AGAGGAATGAGAGGTGAGGAAGG + Intronic
1032493160 7:132340233-132340255 AGAGGGATGGGAGGAGTGTTTGG - Intronic
1032890402 7:136189186-136189208 AGAGTGGTGGGAGGAGAGGTAGG + Intergenic
1032960443 7:137027368-137027390 AGTGTGGTGAGAGGTGAGGATGG - Intergenic
1033722649 7:144078005-144078027 GGACTGATGACAGGTGAGCTTGG + Intergenic
1034189908 7:149206052-149206074 AGACTGATGACAAGTGTGTTCGG - Intronic
1036712174 8:11087049-11087071 AGAGAGTTCAGAGGGGAGTTCGG - Intronic
1037607480 8:20449870-20449892 AGAGTGCTTTGAGATGAGTTTGG + Intergenic
1038248851 8:25884125-25884147 AGAGTGATGGGAGATGAGGTTGG - Intronic
1038467470 8:27777893-27777915 GCAATGATGAGAGGTGGGTTAGG - Intronic
1038669278 8:29569408-29569430 AAAGGGCTGAGAGGTGAGTTGGG - Intergenic
1039712492 8:40070235-40070257 AGAGTGATGTCAGCTGAATTTGG - Intergenic
1039865815 8:41500446-41500468 AGAATGATGGGAGGTGGATTTGG + Intronic
1040433401 8:47366127-47366149 AGAGTGATGAGACGTCTTTTTGG + Intronic
1041352916 8:56966922-56966944 ACAGTTAAAAGAGGTGAGTTAGG + Intronic
1041958677 8:63586072-63586094 AGAGGTATGAAAGGTGAGTCAGG + Intergenic
1042519773 8:69699272-69699294 AGAATGATGACAGGGAAGTTAGG + Intronic
1042526088 8:69766382-69766404 GGAGTGATGAGAGATGAAGTGGG - Intronic
1044641426 8:94385902-94385924 GGAGTGATGAGAGATGAGGCTGG + Intronic
1044921051 8:97169870-97169892 ACAGGCCTGAGAGGTGAGTTAGG - Intergenic
1045110257 8:98933751-98933773 AGAGTGATTCCAGGTGAGATTGG + Intronic
1045251192 8:100484643-100484665 AGAGGGTTCAGAGGTGAATTAGG + Intergenic
1046645426 8:116780853-116780875 AGAGTGATGAGGGCTGGGTGTGG - Intronic
1046774972 8:118154260-118154282 AGTGTGATGAGAGGACAGATGGG - Intergenic
1047072822 8:121366040-121366062 GGAGTGGGGAGAGGTGAGGTTGG + Intergenic
1048409905 8:134162043-134162065 AGGGTGATGAGTGGGGAGTGAGG + Intergenic
1048630395 8:136236041-136236063 AGAGTGGTAAGAGCTGTGTTTGG + Intergenic
1048769819 8:137883389-137883411 TGAGTGATGAGATTTGAGTGTGG - Intergenic
1048952298 8:139506375-139506397 GGAGTGGGGAGAGGTGGGTTGGG + Intergenic
1050981980 9:12031055-12031077 ATAATGATGAGAGGTGAGCCTGG + Intergenic
1051565503 9:18493404-18493426 AGAATGAAGAGAGGTGGGTGAGG - Intronic
1055120609 9:72656230-72656252 AGAGTGAACAGTGGTGAGTCAGG + Intronic
1056102290 9:83311515-83311537 AGAGTGGAAAGAAGTGAGTTGGG + Intronic
1057288235 9:93778086-93778108 AGAAAGATGAGATGTAAGTTAGG - Intergenic
1057304355 9:93903716-93903738 AGAGTGGTCAGAGGAGATTTAGG - Intergenic
1058311942 9:103514897-103514919 GGAGTGGTCAGAGGAGAGTTGGG - Intergenic
1058800072 9:108537188-108537210 GAAATGATGTGAGGTGAGTTTGG + Intergenic
1059611557 9:115902974-115902996 AGAGTGAAGAGAGATGGGATGGG - Intergenic
1059679822 9:116575419-116575441 GGAGTGATGAGAAGTGAGGCTGG + Intronic
1059974953 9:119706092-119706114 AGAGTGGTGCGAGCTGAGGTTGG + Intergenic
1060456664 9:123804974-123804996 AAAGTTAGGAGAGGAGAGTTAGG - Intronic
1203703669 Un_KI270742v1:16372-16394 AGAGTAATTAGAGGTAAATTAGG + Intergenic
1185767427 X:2737016-2737038 AGAATGCAGAGAGGTGAGTGAGG - Intronic
1188133603 X:26467965-26467987 TGAGTCATGAGTCGTGAGTTTGG + Intergenic
1190232293 X:48591595-48591617 AGAGTGCCAAGAGGTGAGGTTGG + Intronic
1190321136 X:49179836-49179858 ACTGAAATGAGAGGTGAGTTGGG + Intronic
1190783558 X:53621961-53621983 AGAAAGAAGAGAGGGGAGTTGGG + Intronic
1191925108 X:66300557-66300579 AGAGTGAAGGGAGGAGAGGTAGG - Intergenic
1192830030 X:74741668-74741690 AGAGTCATCAGATGGGAGTTGGG + Exonic
1194481669 X:94433874-94433896 AGAGTCATGAGAGCTGGTTTTGG + Intergenic
1195390135 X:104353093-104353115 AAAGTGATGGGAGGTGGGCTTGG + Intergenic
1195405095 X:104504030-104504052 AAGGTGATAAGAGGTCAGTTAGG - Intergenic
1195479475 X:105327014-105327036 AGAGAGATGAAAGGGAAGTTGGG + Intronic
1196224102 X:113145547-113145569 AGAGTGGTGAGGGTTGAGGTGGG - Intergenic
1197663047 X:129194357-129194379 AGATTTATGAGTGGTGAGTCTGG + Intergenic
1197803961 X:130381573-130381595 TGAGTGATGAGAGGTGATTCAGG - Intergenic
1198127657 X:133662167-133662189 AGAGTGATTAGAGCTGTGCTAGG + Intronic
1198270990 X:135055873-135055895 AGAGTGGTTAGAGAAGAGTTGGG + Intergenic
1200235510 X:154466068-154466090 TCAGTGCTGAGAGGTGAGTGCGG + Exonic
1200695742 Y:6357383-6357405 ATGGTGATAAGTGGTGAGTTTGG + Intergenic
1201240708 Y:11954601-11954623 AGAGGGATGAGGGGCGAGTTGGG - Intergenic
1201283071 Y:12357766-12357788 CCAGTCATAAGAGGTGAGTTTGG - Intergenic