ID: 952374956

View in Genome Browser
Species Human (GRCh38)
Location 3:32759208-32759230
Sequence ATCCCCAACAAAATAACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952374956_952374959 -10 Left 952374956 3:32759208-32759230 CCATTGGTTATTTTGTTGGGGAT 0: 1
1: 0
2: 0
3: 22
4: 199
Right 952374959 3:32759221-32759243 TGTTGGGGATGTGGGTCAATTGG 0: 1
1: 0
2: 1
3: 34
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952374956 Original CRISPR ATCCCCAACAAAATAACCAA TGG (reversed) Intronic
900021957 1:191636-191658 ATCCCCACCAAAAAAGCCCATGG + Intergenic
901898385 1:12335411-12335433 ATCCCCATCAAAATACCCATAGG - Intronic
901950551 1:12742350-12742372 ATGACCACCAAAATCACCAATGG + Intergenic
902043362 1:13508278-13508300 ACCCCAAATAAAATAACCAGAGG + Intronic
902977602 1:20100242-20100264 ATCCCAAACAAACAAACAAATGG + Intergenic
906727688 1:48055724-48055746 ATCCCCATCAGAAAAACGAAGGG - Intergenic
906902240 1:49847631-49847653 AACCCCATTAAAATAAGCAAAGG + Intronic
908243692 1:62210303-62210325 GTCCCCAACCAAATAACTAAAGG - Exonic
911557770 1:99366216-99366238 ATCCCAAACGAAATATCCTAAGG + Intergenic
918128232 1:181603124-181603146 ATCCCCAAGGATATAAGCAAGGG - Intronic
919297513 1:195721477-195721499 TTCCCCAACAAAACAAAAAAGGG - Intergenic
919681570 1:200440715-200440737 ATCCCAATCAAAATAACAATAGG + Intergenic
923563141 1:235056908-235056930 ATGCCCAACAAAAGAACAGAAGG - Intergenic
1064450651 10:15439366-15439388 ATCCCAAACAAAATCACAGAAGG - Intergenic
1065893247 10:30138825-30138847 ATCCACAACAAAATATCACACGG + Intergenic
1071225027 10:83519187-83519209 CACCCCAACAAAAGAATCAAGGG + Intergenic
1072442626 10:95470543-95470565 ATCCCCAACAACCTAAACCAAGG + Intronic
1072554840 10:96506864-96506886 GTCCACAACAACATAATCAAAGG - Intronic
1073366317 10:102945085-102945107 ATCCCCCACAAACTCACCCAAGG + Intronic
1078168290 11:8909976-8909998 ATCTCCTACCAAATAACCAGCGG + Intronic
1078500812 11:11874089-11874111 ATACCCAACATCATAACAAAGGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1085160042 11:74332413-74332435 AACATTAACAAAATAACCAAAGG + Exonic
1086986793 11:93260039-93260061 ATGCCCAACCAAAAAAGCAAAGG - Intergenic
1091375656 12:23173-23195 ATCCCCAACAAAAAAGCCCACGG + Intergenic
1091435292 12:467683-467705 ATCACTAACAAAATAACCTAAGG + Intronic
1093874543 12:24334373-24334395 ATCCCCCAAAAAATAAACAAAGG + Intergenic
1096900049 12:54867744-54867766 AAAGCCAACAAAATAAGCAATGG - Intergenic
1097953117 12:65454999-65455021 TTCCCCAACAAAATACCCTGTGG - Intronic
1098054407 12:66489215-66489237 ATCCTCAATAAAATAAGTAATGG + Intronic
1098467694 12:70806703-70806725 ATTCCGAACAGAATAAACAATGG - Intronic
1098483181 12:70989548-70989570 ATCTCCACCAAAATAAATAAAGG - Intergenic
1098926043 12:76350153-76350175 ATCCCCGCCAAAAAAACCAGTGG + Intergenic
1099170664 12:79359947-79359969 AACCCCATCAAAATCACCTAGGG + Intronic
1099903362 12:88740438-88740460 ATGATCAACAAAATAACTAAAGG - Intergenic
1100091880 12:90983095-90983117 ATTCCCAACAAAGTATGCAAGGG + Intronic
1105625000 13:22104219-22104241 AACAACAACAAAACAACCAAAGG - Intergenic
1108762214 13:53582004-53582026 ATGATCACCAAAATAACCAACGG - Intergenic
1108868735 13:54955578-54955600 ATTCCCAACACAATGAACAAGGG + Intergenic
1109881968 13:68490427-68490449 AACAACAACAAAATAACAAATGG + Intergenic
1110067517 13:71127371-71127393 ATTCCCAGCAAAATAACACAGGG - Intergenic
1110268260 13:73564355-73564377 ATCCCTAAATACATAACCAAAGG + Intergenic
1110326788 13:74225641-74225663 ATTGGCAACAAAATTACCAAGGG - Intergenic
1111978214 13:94989783-94989805 ATCCACAATAAAATATCCATAGG - Intergenic
1112201080 13:97275272-97275294 ATTCCCAACAATAAAATCAATGG + Intronic
1112701762 13:102018309-102018331 GTCCGCAACCAAATAACTAAAGG + Intronic
1113668976 13:112162764-112162786 AAAGACAACAAAATAACCAAGGG + Intergenic
1115392104 14:32865815-32865837 ATACCCAACAAAAGAAACATGGG - Intergenic
1117272038 14:54154599-54154621 ATCAGCAAAAAAATAACTAATGG - Intergenic
1117364082 14:55007989-55008011 ATCCCCAACCATCTAACCCAAGG + Intronic
1118032139 14:61828596-61828618 CACCCCAACAAAATAATCATAGG + Intergenic
1118724202 14:68616573-68616595 ACCCCAATCAAAATAAGCAAGGG - Intronic
1120448633 14:84636401-84636423 ATCCCAAACAAAAAGAACAAAGG - Intergenic
1124609789 15:31200603-31200625 ATCCCTAAAAAAGAAACCAATGG - Intergenic
1127109777 15:55656098-55656120 ATACCCAACAAATTTAACAATGG + Intronic
1127712546 15:61614159-61614181 ACCCCCAACAAAAGATCCAGAGG + Intergenic
1128826054 15:70718387-70718409 ATCCCCAAAGCAATAACCTAGGG - Intronic
1130233724 15:82115540-82115562 AGCCCCAACATCATAACCTATGG + Intergenic
1131136318 15:89938975-89938997 CTCCCCCACAAAAAAACCCATGG + Intergenic
1134083561 16:11341054-11341076 ATCTCCTGCAAAATAGCCAAGGG - Intronic
1135342685 16:21662763-21662785 ATCCAAAACAAAAAAGCCAATGG - Intergenic
1137859902 16:51836055-51836077 ATAACCAATAAAACAACCAATGG - Intergenic
1138676585 16:58655838-58655860 ATCCCCATCAAAAAAAGAAAAGG + Intergenic
1138864942 16:60806145-60806167 AACCCCAATACAATAACCACAGG + Intergenic
1139839825 16:69869348-69869370 ATCCCCAACAAAAAAAAAAAAGG - Intronic
1141911771 16:87065027-87065049 ATCACTAACTAAACAACCAATGG + Intergenic
1142512439 17:405246-405268 ATCCCCATCAAAATCTCAAAGGG + Intergenic
1144155913 17:12502284-12502306 ACCCTCAACAAATTAACCATAGG + Intergenic
1144379380 17:14678868-14678890 ATTCCCATCAAACTACCCAATGG + Intergenic
1146761808 17:35485762-35485784 AAGTCCACCAAAATAACCAATGG - Intronic
1149479386 17:56990106-56990128 TTCCACAACTAAATACCCAAAGG - Intronic
1149974032 17:61248162-61248184 TTCCCCAACAAAGCCACCAAGGG + Intronic
1150037640 17:61821071-61821093 GTGTGCAACAAAATAACCAATGG - Intronic
1150615736 17:66769577-66769599 TTCCCCAACAAAATTTGCAAGGG - Intronic
1153210545 18:2758768-2758790 ACCAACCACAAAATAACCAAAGG - Intronic
1154436570 18:14347644-14347666 CTCCCCCACAAATTAACCACAGG - Intergenic
1157032667 18:43931580-43931602 ATACACAACAAAATCAGCAAGGG + Intergenic
1157642003 18:49225256-49225278 ATATCCAAGAAAATAAGCAAAGG + Intronic
1159557564 18:69961514-69961536 ATCCCCATGAAAGTAAGCAATGG + Intronic
1159932242 18:74325718-74325740 AACTCCTCCAAAATAACCAAGGG - Intronic
1160331554 18:77997140-77997162 ATACGCAACGAACTAACCAAAGG - Intergenic
1167832330 19:52035465-52035487 ATCCCCAACAAGATTATAAAAGG - Intronic
1168435862 19:56316267-56316289 ATCTGTAACAACATAACCAAGGG + Intronic
926930637 2:18036318-18036340 GTGCCCAACAAAAAAAACAATGG - Intronic
927762159 2:25768074-25768096 AACCACAACAAAAGATCCAAAGG + Intronic
928674843 2:33640315-33640337 AGCCCCAACACAATACTCAAAGG - Intergenic
930629374 2:53735587-53735609 AGCCCAATCAAAATACCCAAAGG + Intronic
931989771 2:67778614-67778636 ATCCCGATCAAAACAACCACAGG + Intergenic
932912889 2:75822698-75822720 ATACCCAACAAAATACCCATGGG + Intergenic
933187617 2:79295977-79295999 TTCCTCAACAAAATTTCCAAAGG + Intronic
935605343 2:104967172-104967194 ATCCCAAATAAAACAATCAATGG - Intergenic
936567489 2:113592308-113592330 ATCCCCACCAAAAAAGCCCATGG - Intergenic
937392562 2:121503322-121503344 CTCCCCATCAAAAAAAACAATGG + Intronic
939329293 2:140737051-140737073 TCCCCCAAAAAAATAAACAAGGG + Intronic
939424720 2:142020104-142020126 ATCCCCATCAAAATTGCAAAAGG + Intronic
939919472 2:148091151-148091173 ATCGTCAACAATATAAACAATGG + Intronic
940161974 2:150723396-150723418 ACCCCCACAAAGATAACCAAGGG - Intergenic
940555374 2:155219985-155220007 ATCCACAGTAAAATAACAAAAGG + Intergenic
940753139 2:157650244-157650266 ATATCCAAAAAAACAACCAAGGG + Intergenic
942492362 2:176502333-176502355 AGCCCTAACAAAATAACAAGGGG - Intergenic
943925412 2:193771037-193771059 ATCTCAAAAAAAATAACAAAAGG + Intergenic
1169853334 20:10077173-10077195 ATCCCCAGGACAATAAGCAAGGG + Intergenic
1169934882 20:10872703-10872725 TTCCCCAACCAAATAACAACAGG - Intergenic
1170755857 20:19206399-19206421 ATCCCCATCAGAATAACACAGGG + Intergenic
1172540534 20:35712056-35712078 CCCACCAACAAAATAACAAAAGG + Intronic
1174673522 20:52331139-52331161 ATCCCCAAAAATACAACCAGGGG - Intergenic
1175680034 20:60979648-60979670 ATCCCTATCAAAATACCCATGGG + Intergenic
1176997121 21:15568494-15568516 ATCCCCAATGGAATGACCAAAGG + Intergenic
1177494365 21:21870342-21870364 AACAACAACAAAATAACTAAAGG - Intergenic
1177611949 21:23461417-23461439 AACCCAAACAAAATTACCAGAGG - Intergenic
1179012424 21:37566152-37566174 TTCCACAACAAAGTAACAAAAGG - Intergenic
1182823445 22:33240180-33240202 ATGCCCACTAGAATAACCAAAGG - Intronic
1184103074 22:42351793-42351815 ATCCCCTGCAGAACAACCAAAGG - Intergenic
1184193679 22:42911939-42911961 ACCTCCACCAAAAAAACCAAAGG + Intronic
1184882032 22:47313118-47313140 ATACACATCAAAATAACCCATGG - Intergenic
950417592 3:12877044-12877066 AGTCCCAACAGAATAACAAAGGG + Intergenic
950713904 3:14834039-14834061 AACCCCAACATAGAAACCAAGGG + Intronic
950946255 3:16950175-16950197 ATCCCTAACAAAATCCCAAATGG - Intronic
950970798 3:17185364-17185386 ACCACCAACAAAATAAAAAAAGG + Intronic
951018819 3:17759971-17759993 ATTTCCAACAAAATAACAAAAGG + Intronic
951307467 3:21083024-21083046 ATCAACAACAAAAAAAGCAATGG - Intergenic
951947980 3:28163987-28164009 CTGCACAGCAAAATAACCAATGG + Intergenic
952374956 3:32759208-32759230 ATCCCCAACAAAATAACCAATGG - Intronic
957227859 3:77472860-77472882 AGCCCCAACAAAATATACAAGGG - Intronic
959122656 3:102251515-102251537 AACACCAAAAAAATAACCCAGGG - Intronic
959248912 3:103914212-103914234 ATCCCCACTAAAAGAGCCAATGG + Intergenic
959479314 3:106852767-106852789 ATCCCAATCAAAATTACCATAGG + Intergenic
960059849 3:113310009-113310031 ATCCCCAACTAAATCAGCAAAGG + Intronic
960267699 3:115639672-115639694 ATCCCCAAACCAATAAACAAAGG + Intronic
960502100 3:118450254-118450276 AACCTCAACAAAACAAGCAATGG - Intergenic
962411852 3:135147652-135147674 CTCCCCAACACAATAACTCATGG - Intronic
963964931 3:151356837-151356859 ATCTCCTATAAAATAAACAAAGG - Intronic
965213606 3:165829765-165829787 ATCCCCAACAACATCACCCAAGG + Exonic
965965287 3:174481677-174481699 ATACCAAACAAAATCAGCAAAGG + Intronic
966552315 3:181219046-181219068 AACCCCAGCAAAATGACCATAGG - Intergenic
967392736 3:188973038-188973060 ATCCCCAAGGCAATAACCCAAGG + Intronic
967534573 3:190587749-190587771 ATCTCCAAAATAAAAACCAAGGG + Intronic
969926734 4:10592606-10592628 ATCCACAACATAAGAACCTAGGG + Intronic
970915226 4:21324799-21324821 ATTCCTATCAAAATAACCAATGG - Intronic
971815867 4:31487997-31488019 TTCTCCAACAAAATTACCAGAGG + Intergenic
972992963 4:44845088-44845110 AACCCCCACAAAATAACAACTGG + Intergenic
973091520 4:46142980-46143002 ATCCTCAACAAAGTAAGCATAGG - Intergenic
973853013 4:54980253-54980275 ACCCCCAACAAAATAACAGCTGG + Intergenic
975912368 4:79282129-79282151 AGCCCCAAGAAAAGAACGAATGG + Intronic
980136389 4:128862547-128862569 AGCCCCAAGAAAATGACCCAAGG + Intronic
981315828 4:143338201-143338223 AGCAGCAACAAAACAACCAATGG - Intronic
982761184 4:159285950-159285972 ATCCACATCAAAATATCCAGTGG - Intronic
983007186 4:162497961-162497983 ATAGTCAACAAAATAACCACTGG - Intergenic
983463129 4:168051164-168051186 ATTTCCAACAAAGAAACCAAGGG - Intergenic
986142709 5:5046767-5046789 AGCCCCAAGAAAAAAAACAAGGG - Intergenic
988853891 5:35207587-35207609 ATTCCCAATCAAATTACCAATGG + Intronic
989760834 5:45014425-45014447 ATCACCAATAAAATTAACAAAGG - Intergenic
990686635 5:58310212-58310234 ATCCCCAAGAAAGTAACTAATGG - Intergenic
994008068 5:94864349-94864371 ATTCCTAACAGAATAACTAAAGG - Intronic
994362084 5:98863413-98863435 ATCCTGAACAAATTAAGCAATGG - Exonic
995758544 5:115539345-115539367 AACACAAACAAAAGAACCAAAGG + Intronic
996306396 5:122053042-122053064 ATACCCAACAAAAGAAACATGGG - Intronic
1002543294 5:179920630-179920652 ATCCCCAAGAGACTAACCACTGG + Intronic
1002587011 5:180255343-180255365 AACCCCCACAAAATCACCAAGGG + Intronic
1003674635 6:8192005-8192027 ATCCCCAAAAAGAAACCCAAAGG - Intergenic
1005207762 6:23424203-23424225 ATCTTCAACAAAATAAGCAATGG + Intergenic
1005859640 6:29890327-29890349 CTCCCAAACACAATATCCAAAGG - Intergenic
1006206139 6:32344845-32344867 AGCCCCAAAAAAAAAACCTAAGG - Intronic
1007961732 6:45966486-45966508 ATGTCCAACAGAATCACCAAAGG + Intronic
1008335671 6:50301930-50301952 AAACCCTACAAAATAACCTATGG - Intergenic
1008580830 6:52904993-52905015 GTGCACAACAAAATAACCACTGG + Intronic
1009337018 6:62504027-62504049 ATCCCCAAAAATATGAGCAAAGG + Intergenic
1011825164 6:91297414-91297436 ATCTTCAACAAAACAAGCAATGG - Intergenic
1012142801 6:95644319-95644341 AACCCCATCAGAATAACCAGTGG + Intergenic
1012748520 6:103125756-103125778 ACCCCAAACAACATAACCACTGG - Intergenic
1012759021 6:103273244-103273266 GCCCCCTACAGAATAACCAAAGG + Intergenic
1015040715 6:128715483-128715505 TTCTCTAACAAAATATCCAAAGG + Intergenic
1015929816 6:138347928-138347950 ATCCCCCCCAAAATCACCAAAGG - Intergenic
1017124048 6:151049830-151049852 ACCCCCAACATTATAACAAAAGG - Intronic
1020558232 7:9696065-9696087 AGCCCCAATAATTTAACCAAGGG + Intergenic
1020856217 7:13427645-13427667 ATCCCAAACCAAATAATCTAGGG - Intergenic
1021170822 7:17396051-17396073 TACCACAAGAAAATAACCAAGGG + Intergenic
1022993758 7:35733037-35733059 ATCCCCCACAAGATGACAAAAGG + Intergenic
1024125915 7:46294741-46294763 ATCCCCACCCTAACAACCAATGG + Intergenic
1024609202 7:51049241-51049263 ATCTCAAACAAAAGAACAAATGG - Intronic
1025822460 7:64980966-64980988 AACAACAACAAAAAAACCAATGG + Intronic
1028184570 7:87767939-87767961 ACTACCAACAAAATAACCCAAGG + Intronic
1029330384 7:99848671-99848693 ATCCTCAGCAAAATAATGAAGGG - Intronic
1030098143 7:105919867-105919889 ATCCCCATCAAAGAAGCCAATGG - Intronic
1030437530 7:109542867-109542889 AACCCCAACAATATAATTAATGG - Intergenic
1030799166 7:113827988-113828010 AACCCCATCAATATAACCCATGG + Intergenic
1031316314 7:120261775-120261797 ATTCTCATCAAAATAACCAGTGG - Intergenic
1031787253 7:126048306-126048328 ATCCCAAACAATTTACCCAAAGG - Intergenic
1032865083 7:135916880-135916902 ATCCCCACCAAAAAAGCCCATGG - Intergenic
1035352272 7:158255196-158255218 CTACCCAACAAGATCACCAAGGG + Intronic
1038863669 8:31415065-31415087 ATCTGCAACCACATAACCAATGG - Intergenic
1039405208 8:37306765-37306787 ATCCTCAAGAAAAAAACCAAAGG - Intergenic
1042671908 8:71273324-71273346 ATCCCAAATAAACTAACCCATGG - Intronic
1043676595 8:82963823-82963845 ATCCCCTCCAAAATAACTAATGG + Intergenic
1044261322 8:90126200-90126222 ATATCCACCAAAATAAACAAAGG - Intergenic
1044405761 8:91824347-91824369 ATCCTCAGCAAACTAACCACAGG + Intergenic
1044777931 8:95713236-95713258 ATCCCAAAGAAAATAAGCAGAGG + Intergenic
1048883717 8:138891654-138891676 ATCCCAAACAATCTAACCATAGG + Intronic
1050194904 9:3071922-3071944 ATCCCCAGCAAACTAACACAGGG - Intergenic
1050208596 9:3227249-3227271 ATCCACAACAAAATAGACAGAGG - Intronic
1053195235 9:36112455-36112477 ATCCCTGCCAAAAAAACCAAAGG + Exonic
1053668362 9:40334413-40334435 ATCCCCCACCAATTAACCATAGG - Intergenic
1054516250 9:66041880-66041902 ATCCCCCACCAATTAACCATAGG + Intergenic
1055176339 9:73321935-73321957 ATGCCTAAAAAAAGAACCAAGGG - Intergenic
1056696200 9:88855961-88855983 AACCCCAAAAGAATAACTAAAGG + Intergenic
1057515955 9:95721250-95721272 ATCACCAGCAACATAAACAAAGG + Intergenic
1058238411 9:102523377-102523399 AACCCCAAAAAATTAACAAATGG - Intergenic
1058588476 9:106535356-106535378 ACCCCCACCAAAATAAGCAAAGG + Intergenic
1058997935 9:110318007-110318029 AACCCCAACAATAAAACCAGGGG - Intronic
1060061136 9:120460897-120460919 TTCCCCAAGAAAATAACTAAAGG + Intronic
1185492025 X:525096-525118 ATCTCAAAAAAAAAAACCAAAGG + Intergenic
1185637819 X:1566543-1566565 CTACAGAACAAAATAACCAAAGG - Intergenic
1191175364 X:57494441-57494463 ATACCCAAGAAAATACCCAAAGG + Intergenic
1192046927 X:67685788-67685810 ATCCCTAAAAAAAACACCAATGG + Intronic
1193464049 X:81825543-81825565 ATCCTCAGCAAAATAACACAGGG - Intergenic
1193914019 X:87343518-87343540 ATGTCCAACAACATAACCATGGG + Intergenic
1194322779 X:92472561-92472583 ATCCTAAACAAAATGAACAAAGG - Intronic
1195391592 X:104368009-104368031 ATCTCCAACAAAAGAAGCAGTGG + Intergenic
1198082790 X:133254879-133254901 ATACCCAACCAAATCACCATGGG + Intergenic
1199640936 X:149860280-149860302 AGCCCCAACAGAATAACTGAGGG + Intergenic
1201696043 Y:16827498-16827520 ATCCCAAACACAATAACTTATGG - Intergenic
1201909305 Y:19117537-19117559 ATACCATACAAAATAACAAAGGG - Intergenic