ID: 952382419

View in Genome Browser
Species Human (GRCh38)
Location 3:32816031-32816053
Sequence GGCCTCGGGCACCACCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952382414_952382419 -6 Left 952382414 3:32816014-32816036 CCCAGAACCGCTCAGGCGGCCTC 0: 1
1: 0
2: 0
3: 1
4: 67
Right 952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 166
952382409_952382419 16 Left 952382409 3:32815992-32816014 CCAGGGCCATGCAAGTTCCTCTC 0: 1
1: 0
2: 2
3: 12
4: 147
Right 952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 166
952382415_952382419 -7 Left 952382415 3:32816015-32816037 CCAGAACCGCTCAGGCGGCCTCG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 166
952382410_952382419 10 Left 952382410 3:32815998-32816020 CCATGCAAGTTCCTCTCCCAGAA 0: 1
1: 0
2: 4
3: 19
4: 243
Right 952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 166
952382412_952382419 -1 Left 952382412 3:32816009-32816031 CCTCTCCCAGAACCGCTCAGGCG 0: 1
1: 0
2: 0
3: 3
4: 103
Right 952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952382419 Original CRISPR GGCCTCGGGCACCACCCAGA TGG Intergenic
900507968 1:3039105-3039127 GGCCTTGTGGACCACCCAGAAGG + Intergenic
900662069 1:3789736-3789758 GGCTTTGCGCCCCACCCAGATGG - Intronic
901685700 1:10942229-10942251 GGCCTCGTGGGCCACCCAGCTGG - Intergenic
902744684 1:18465772-18465794 GGCCTCCAGCACCACAGAGAAGG + Intergenic
902885484 1:19401830-19401852 GGCCCCCTGCTCCACCCAGAGGG + Intronic
903913965 1:26749592-26749614 GCCCTCAGCCTCCACCCAGAGGG + Intronic
910387956 1:86705054-86705076 GGCCTCGCCGACCACCCAGCGGG + Intronic
915349241 1:155214190-155214212 AGCCCCTGGCACCACCTAGAGGG + Intergenic
915352428 1:155234817-155234839 AGCCCCTGGCACCACCTAGAGGG + Exonic
916120560 1:161524936-161524958 GCCCTCGCTCACCACCCGGAAGG - Exonic
918041747 1:180917876-180917898 GGCCTCGGGCACCTCCTTGCAGG + Exonic
919780150 1:201216279-201216301 AGCCTTGGGCATTACCCAGAGGG - Intronic
920989310 1:210921605-210921627 GACCTCAGGAACCACCCAGATGG - Intronic
921180941 1:212630697-212630719 GCTCTCGGGCAGCACGCAGAAGG + Intergenic
922870314 1:228897456-228897478 GGCCTACGGCCCCACCTAGAAGG + Intergenic
1064622688 10:17230460-17230482 GACTTCGGGCACCGCGCAGAGGG - Intronic
1065866758 10:29921216-29921238 GGCATCAGGGACCACGCAGACGG - Intergenic
1065967626 10:30782350-30782372 GGCCTAGGCCCCCACCCAGATGG - Intergenic
1067690016 10:48495837-48495859 CGCCTCGGGCAGCTCCCAGCAGG - Intronic
1069177586 10:65312785-65312807 GTCCTGTGGCCCCACCCAGAAGG + Intergenic
1069619134 10:69825735-69825757 GGCCCTGGGCGGCACCCAGAAGG + Intronic
1069629700 10:69890057-69890079 TCCCGCGGCCACCACCCAGATGG + Intronic
1076737810 10:132466608-132466630 GTCCTTGGGCACCAACCAGGCGG - Intergenic
1079803118 11:24896229-24896251 GGCCTCGGCCAGCCCACAGAGGG - Intronic
1082106679 11:48228850-48228872 GGCCTCGGCCAGCACAGAGAGGG - Intergenic
1083664213 11:64265850-64265872 GGGCCCAGGCATCACCCAGAGGG + Intronic
1084533950 11:69745940-69745962 TCCCTCAGCCACCACCCAGAGGG - Intergenic
1086350978 11:85943011-85943033 GGCCTATGGCAGCACACAGAGGG + Intergenic
1088103174 11:106176920-106176942 TGGCTCGGGCTCCACCCCGACGG + Intergenic
1089262674 11:117232981-117233003 GGCCTTGGCCACCCCCCACAGGG - Intronic
1089572220 11:119418413-119418435 GGGCTCAGGCACCAGCCAGCAGG + Exonic
1090352337 11:126115389-126115411 GGCCTCTGGGGCCACCCAGCTGG + Intergenic
1090807628 11:130212235-130212257 GGCCACTGGCCCCACCCAGCGGG - Intergenic
1095976151 12:47942320-47942342 AGCCTGGCGCACCACCCGGACGG + Intronic
1103115794 12:118330485-118330507 GGCCTCAGGCACTCTCCAGATGG + Intronic
1104285197 12:127418550-127418572 GCCCTGGGGCAGCACCCAGGTGG - Intergenic
1104340465 12:127944102-127944124 GTCAGCTGGCACCACCCAGATGG - Intergenic
1104952222 12:132446380-132446402 CTCCGCTGGCACCACCCAGACGG + Intergenic
1105477439 13:20740348-20740370 GGCCTCGGCCACCTCAGAGAGGG + Intronic
1106072302 13:26424478-26424500 GGCCCCGGGCCCCACCCGCACGG + Intergenic
1106351523 13:28935670-28935692 GTCTTAGGGCACTACCCAGAAGG + Intronic
1108350429 13:49585965-49585987 GCCCCGGGGCACCACCCAGGTGG + Intergenic
1113807329 13:113117525-113117547 GGCCGCGGAGACCACCCAGATGG - Exonic
1121411062 14:93748585-93748607 GGCCTCGGCCACCAGCCAGGGGG - Intronic
1122004246 14:98688827-98688849 GGCCTTGGGAACCACCATGATGG + Intergenic
1124009899 15:25830028-25830050 GGCCTCGGTCACCATCTGGAGGG + Intronic
1125508669 15:40281634-40281656 GGCCTCAGTCCCCACCCGGAGGG - Exonic
1125524055 15:40364346-40364368 GAGCTCAGGCTCCACCCAGAAGG - Intronic
1128131244 15:65228499-65228521 GGTGTAGGGCACCACACAGAAGG + Intergenic
1130149716 15:81302115-81302137 GGCCTGGGGCAGCACCTAGAGGG - Intronic
1132045491 15:98559792-98559814 GGTCTTGGGCAGCAGCCAGATGG - Intergenic
1132419411 15:101652512-101652534 CTCCTCGGGGACCTCCCAGAAGG - Intergenic
1132573623 16:655037-655059 GGCCTGGGGCACCGGCCAGGTGG + Exonic
1133051313 16:3118957-3118979 GGCCTCGGGCTCCAGCCGGCAGG + Exonic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1134249362 16:12563566-12563588 GGCCTAAGCCACCACCCAAAGGG - Intronic
1141680606 16:85541583-85541605 GGCCACGGGCACATCACAGAGGG + Intergenic
1142005408 16:87687468-87687490 GGCCTTGGGCAGAACCCTGACGG - Intronic
1142623504 17:1179290-1179312 GGGCGGGGGCAGCACCCAGAAGG + Intronic
1142967374 17:3590064-3590086 GGCCGCGTGCACCAACCAGCTGG - Exonic
1143448461 17:7022234-7022256 GGCCTCGGGCACCCGCCCGTCGG - Intergenic
1145237820 17:21221479-21221501 GGACTTAGGCACCACCCTGAAGG - Intergenic
1146009340 17:29180846-29180868 AGCCTGGGGCACCATCCAGCAGG - Intergenic
1146769531 17:35555899-35555921 GGCTTAGGGCACCACCAAGTGGG - Intronic
1147564233 17:41527089-41527111 GGGCTTGGTCTCCACCCAGAGGG - Intronic
1147957071 17:44142056-44142078 GGCCTTGGACACGACCCAGGTGG - Exonic
1149623316 17:58062044-58062066 GGCCTTGGGGGCCACTCAGAGGG + Intergenic
1151464656 17:74276695-74276717 GGCCTTGGGAAACACCAAGAAGG + Intronic
1151756316 17:76077194-76077216 GGCCTGGGGCACGGCCCAGCAGG - Exonic
1152922773 17:83074029-83074051 TGCCCCTGGCACCACCCCGAAGG - Intergenic
1160682377 19:417792-417814 GGCCTCGGGCTGCAGGCAGAGGG - Intronic
1160764893 19:803175-803197 GGCCTCAGCCACCAGCCAGCAGG - Intronic
1160936528 19:1598796-1598818 GGCCCCGGGCTCCACGCAGTAGG + Intronic
1161717014 19:5882038-5882060 TGCCTCCGGGACCAGCCAGATGG + Intronic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1163812152 19:19440063-19440085 GGGCTCAGGCACCACCCTGTAGG - Intronic
1165931663 19:39363046-39363068 AGCCTCAGGCACCAGTCAGAGGG - Intronic
1165996094 19:39845262-39845284 GTGCTCAGGCACCACCGAGAAGG + Intronic
1166567503 19:43774197-43774219 GGCCACGGACAGCACCCAGGCGG + Exonic
1166971843 19:46574123-46574145 GGCCCCGGGCTCCAGCCACAGGG + Intronic
1168115326 19:54219065-54219087 GGCTCAGGGCACCAGCCAGAGGG - Intronic
1168121046 19:54252807-54252829 GGCTCGGGGCACCAGCCAGAGGG - Intronic
925417462 2:3680633-3680655 GGCCTTGGGCAGCAGCGAGATGG + Intronic
926242237 2:11097174-11097196 GGCCTCCAGCACCACCCACGAGG - Intergenic
927040810 2:19228596-19228618 GGGGTCAGGCACCAACCAGATGG + Intergenic
928327248 2:30329168-30329190 TGCTTCGGGCACCAGCCAAATGG + Intergenic
928413134 2:31069755-31069777 GGCCTTGGGCAACAACGAGATGG + Intronic
933837982 2:86261166-86261188 GGCCCCTAGCACCACACAGAAGG + Intronic
934670544 2:96209561-96209583 GGATCCTGGCACCACCCAGATGG + Intergenic
934737756 2:96698591-96698613 GGGCTGGGGCACCTCCCAGAGGG + Intergenic
935878412 2:107536508-107536530 GGCCTCGGCCAGCCCACAGATGG + Intergenic
937221799 2:120346244-120346266 GGCCTCAGGCCCCAGCCAGCCGG - Exonic
938560599 2:132469162-132469184 GGCCTCTGGCCCCACTCAGAGGG - Intronic
938789378 2:134663309-134663331 GGCCTTGGGGTCCACCCAGCAGG - Intronic
943365238 2:186962209-186962231 GGCCTCGGCCAGCACAGAGAGGG - Intergenic
945158800 2:206867131-206867153 GGCCGTGGGCCCCACCCACAGGG + Intergenic
945206892 2:207341998-207342020 GGCCTGGAGAACCACCTAGAGGG + Intergenic
948600767 2:239106394-239106416 GGCCTTGGGCAGTCCCCAGAAGG + Intronic
1169026397 20:2375052-2375074 GGCCTGGGGTGCCACCCACAGGG + Intergenic
1169193900 20:3673411-3673433 GGCCTCAGCCACGACCCCGACGG - Exonic
1170671020 20:18433697-18433719 GGCCTCACACACCACACAGATGG + Exonic
1170859696 20:20091106-20091128 GGCCTGGTGCACCACCTGGAAGG - Intronic
1171908640 20:30921537-30921559 GCCCGCGCGCACCAGCCAGAGGG - Intergenic
1172173428 20:32958509-32958531 CTCCACTGGCACCACCCAGAAGG + Intronic
1175597871 20:60249808-60249830 GCTCTAGGGCTCCACCCAGAAGG - Intergenic
1176147860 20:63573477-63573499 GGTCTCAGGCCCCACCTAGAAGG + Intronic
1180729849 22:17973127-17973149 AGCCTCCTTCACCACCCAGATGG + Intronic
1183582320 22:38733379-38733401 GGCCTCTGGCCGCACCCAGGAGG + Exonic
1184465672 22:44668109-44668131 GAACTCTGGAACCACCCAGAAGG + Intergenic
1185063358 22:48618644-48618666 TGCCTCCGGGACCTCCCAGACGG - Intronic
1185215878 22:49599816-49599838 GGCCTCTGGCACCACGCATGGGG - Intronic
950493006 3:13317622-13317644 AGCCTCGTGCACCCCCAAGATGG - Exonic
952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG + Intergenic
953890054 3:46744657-46744679 GGCCGCAGTCACCACCCAGCTGG + Exonic
954795647 3:53160322-53160344 GTCCTGGGGAACCACCTAGAAGG - Intronic
956459244 3:69454655-69454677 GGCCTCAGCCACCTCCCCGAGGG + Intronic
961452319 3:127007977-127007999 GGCCTCAGGCGACACCCAGATGG - Intronic
961683132 3:128612090-128612112 GGCCTGGGGCCCCATCCTGATGG + Intergenic
967061946 3:185880396-185880418 GGCCTCAGGCAGAACCCTGAGGG + Intergenic
968898897 4:3421561-3421583 GGCCTCTGGGACCAGCCAGCTGG - Intronic
968936208 4:3611816-3611838 GGCCTTGGGCACCAGCCTAAGGG + Intergenic
969596589 4:8152509-8152531 GGTGTCGGGCAGCACCCAGGTGG - Intronic
969720870 4:8892582-8892604 GGCCCCGGGCGCCTCCGAGAGGG - Intergenic
973945327 4:55949114-55949136 GCCCGCGGGTACCGCCCAGAAGG - Intronic
978886564 4:113772539-113772561 GGCCTCGGGCACCTCCCCGCGGG + Intergenic
981322513 4:143409254-143409276 GGCCTCAGACAGCACCCACATGG - Intronic
982500899 4:156153361-156153383 ATCCACTGGCACCACCCAGATGG - Intergenic
985494985 5:199305-199327 GGCCACGTCCACCACACAGAGGG - Exonic
985494996 5:199346-199368 GGCCACGTCCACCACACAGAGGG - Exonic
992153184 5:73926590-73926612 GGCCACAGACTCCACCCAGAAGG + Intronic
1001021786 5:168189269-168189291 GGCCAGGGGCATCATCCAGAAGG + Intronic
1001092804 5:168753824-168753846 GGCCTGGGCCAAGACCCAGAGGG - Intronic
1002091737 5:176810333-176810355 AGCCTCAGGCATCGCCCAGAGGG + Intergenic
1002140124 5:177133186-177133208 GGCCTCGGGCCGAACCCAGCGGG + Intronic
1002896795 6:1384238-1384260 GGCCGCGGGGCCCACCCAGGAGG - Intergenic
1003140639 6:3468585-3468607 AGCCTAGGGGACCACCTAGAGGG - Intergenic
1006802888 6:36770636-36770658 GGCCTCTGGCATCACCCACAGGG + Intronic
1009651248 6:66480251-66480273 GGCCTGTGGCAGCACACAGAGGG - Intergenic
1009746634 6:67825344-67825366 GGCCTCGGCCAGCACAGAGAGGG - Intergenic
1011410376 6:87060175-87060197 GGCCTCGGCCAGCCCCAAGAGGG + Intergenic
1011640478 6:89412350-89412372 GGCCGCGGGCACCACTCGGCGGG + Intergenic
1013006372 6:106078120-106078142 AGCCTCTGGCAGCACCCAGCAGG - Intergenic
1013369371 6:109455998-109456020 GCCCTCGGGCGCCACCCTGCAGG - Intergenic
1019352885 7:563213-563235 GCCCTCGGCCCCCACCCTGAGGG + Intronic
1020067236 7:5197982-5198004 GGCCTCGGGGACACCACAGAAGG - Intronic
1020111646 7:5451212-5451234 GGCCTGGGGCCCCACACAGTGGG - Intronic
1020278584 7:6638396-6638418 GGCAGCGGGGGCCACCCAGAGGG + Intronic
1021470963 7:21002265-21002287 GACCTCTTGCACCACCCAGCTGG + Intergenic
1031025164 7:116672117-116672139 GGGGACTGGCACCACCCAGAGGG - Intergenic
1031656620 7:124364053-124364075 GGCCTCTAGCACCATCCAAATGG + Intergenic
1034150280 7:148909963-148909985 GGCATCAGGGACCACCCAAAGGG - Intergenic
1034936488 7:155203745-155203767 ACCCTCGGGGACCACCCAGAAGG + Intergenic
1035269882 7:157713008-157713030 GGCCTCGGGCAGCTCACACATGG + Intronic
1036590505 8:10163786-10163808 GGCCACAGGCCCTACCCAGATGG + Intronic
1036952498 8:13154339-13154361 GGCCTCAGCCACCTCCCAGCAGG - Intronic
1038450766 8:27637523-27637545 GGCCTCAGGGACCACCCAGGAGG - Intronic
1038639969 8:29315821-29315843 GGCCTCGGGGGCCTCCAAGAGGG + Intergenic
1038803748 8:30772055-30772077 GCCCTGTGGCCCCACCCAGAGGG - Intergenic
1044620735 8:94188463-94188485 GGTCACGGGCACCCCCAAGAAGG + Intronic
1048334276 8:133491380-133491402 AGCCTCCAGCACCACCCAAATGG - Intronic
1049094580 8:140540845-140540867 GCCCTCGGGAAGCCCCCAGATGG + Intronic
1049217483 8:141414868-141414890 GGCCTAGGGCAGCATCCTGATGG + Intronic
1049378171 8:142298909-142298931 GGCCTCGTGCACCAGCAGGAAGG + Intronic
1050727892 9:8673370-8673392 AGACTCAGTCACCACCCAGAGGG - Intronic
1051709127 9:19912115-19912137 GGCCTCGGTCCCCACCCCGGGGG - Intergenic
1061290209 9:129646458-129646480 GCCCTGGGGCACCACCCTGTGGG + Intergenic
1061992944 9:134170067-134170089 GGCCTCTGGGACCAGCCAGCAGG - Intergenic
1062543948 9:137053545-137053567 GGCGTCCGGCAGCACCCAGGGGG + Intronic
1185946710 X:4385020-4385042 GTCCTGTGGCCCCACCCAGAAGG + Intergenic
1187311040 X:18143079-18143101 GGCCTCTTGCACCAACCAGTTGG + Intergenic
1189271872 X:39757786-39757808 GGCCTGGGTCACCGTCCAGATGG - Intergenic
1192146409 X:68685948-68685970 GGCCTTGTGCAACAGCCAGATGG - Intronic
1194074121 X:89367604-89367626 GGCAGCGGGTACCACCCAGGCGG - Intergenic
1198278958 X:135123674-135123696 GGCCTCGGGTAACACAGAGACGG - Intergenic
1198292000 X:135248846-135248868 GGCCTCGGGTAACACAGAGACGG + Intergenic
1199006132 X:142698348-142698370 GGCCTCGAGCTCCATCCAGGTGG - Intergenic
1199082482 X:143592199-143592221 GTCAGCTGGCACCACCCAGATGG + Intergenic
1199771043 X:150975630-150975652 GGCCTCAGTCACTAGCCAGACGG + Intergenic
1200729513 Y:6719131-6719153 GGCAGCGGGTACCACCCAGGCGG - Intergenic
1201389352 Y:13480328-13480350 GGCATCGGGCATCACCCACGGGG + Exonic