ID: 952387967

View in Genome Browser
Species Human (GRCh38)
Location 3:32856530-32856552
Sequence GTTAAAAATAGGACCTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952387964_952387967 10 Left 952387964 3:32856497-32856519 CCAAGCATGAGGCAATAAGGAAA 0: 1
1: 0
2: 1
3: 17
4: 218
Right 952387967 3:32856530-32856552 GTTAAAAATAGGACCTCTGTTGG 0: 1
1: 0
2: 0
3: 22
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952387967 Original CRISPR GTTAAAAATAGGACCTCTGT TGG Intronic
900670727 1:3852738-3852760 TTTGAAAATAGGGTCTCTGTGGG + Intronic
902319264 1:15648934-15648956 TTTAAAAATAGGTCATCTGCTGG + Intronic
903862991 1:26376384-26376406 GTTAAGAATACGAGCTCTGCTGG + Intergenic
904099792 1:28015291-28015313 TTGAAACAAAGGACCTCTGTAGG + Intronic
904117779 1:28175210-28175232 GTTAAAATACTGACCTCTGTGGG - Intronic
910843181 1:91580827-91580849 TTTAAAAATACAACCACTGTAGG + Intergenic
912777139 1:112512960-112512982 GTAATAAAAAGGACCTATGTGGG + Intronic
915191712 1:154156271-154156293 GTTAAAAATAGCATCTTTGTGGG - Intronic
916382277 1:164225383-164225405 GTTAATAATAGGGCCTTTCTTGG + Intergenic
919237992 1:194871063-194871085 GTGAAAAGTAGGACATCTATAGG + Intergenic
922294133 1:224234596-224234618 GTTAAAAATTTAAGCTCTGTGGG - Intronic
923362771 1:233228312-233228334 GTTAGAAATAGAAGCTCTGCAGG - Intronic
1063181409 10:3603983-3604005 GTTAAAAAAAGTACCTGTGTAGG - Intergenic
1067179611 10:43974622-43974644 GCTAAAAATCTGACCCCTGTGGG - Intergenic
1068194440 10:53697734-53697756 CTCAAATATAGGACCTCTTTAGG + Intergenic
1068721755 10:60253380-60253402 CTTAGAAATGGCACCTCTGTAGG + Intronic
1069225006 10:65932098-65932120 GTTAAGAATAGGGACTCTGGAGG + Intronic
1070452336 10:76573760-76573782 GATAAATATAGTACCTCTGTAGG + Intergenic
1073923650 10:108487920-108487942 GTTAAAACTAGGCCATCTCTGGG - Intergenic
1074084702 10:110200568-110200590 GTTAAAAAAAGGTCTTCTCTTGG - Intergenic
1074492726 10:113953691-113953713 GCAAATAATAGGCCCTCTGTTGG - Intergenic
1074505411 10:114065682-114065704 GTTAAAAATATGACCTTTGGTGG - Intergenic
1075311122 10:121414438-121414460 GTTGGAAAGAGGACCTCTGCAGG + Intergenic
1077636986 11:3849216-3849238 GTTACAAATAGGTGCTCAGTAGG + Intergenic
1078836226 11:15032908-15032930 GTTAGAACTAGGACTTCTATTGG + Intronic
1080066706 11:28024730-28024752 GTTAAAAATTGATCCTCTTTAGG - Intronic
1081736773 11:45409806-45409828 GTTAAAAATGACACCTCTGCAGG + Intergenic
1082921542 11:58500217-58500239 ATTGAATATAGGAGCTCTGTTGG + Intergenic
1089157463 11:116413507-116413529 GTTAAATAAAAGCCCTCTGTGGG - Intergenic
1091878536 12:3957801-3957823 TTTGAAATTATGACCTCTGTGGG + Intergenic
1092867963 12:12780907-12780929 ACTAAATATAGGACCTCTTTTGG - Intronic
1105904470 13:24792634-24792656 GTTAAATGTATGTCCTCTGTTGG + Intronic
1106687376 13:32075104-32075126 GTTAAAAATCAGACCTATGAAGG + Intronic
1108126335 13:47248299-47248321 GTTAAAAATAGAACTTCCATAGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108363473 13:49688401-49688423 CTTAAAGAGAGGAGCTCTGTAGG - Intronic
1108634823 13:52322958-52322980 CTTAAAAATAGGACATTTTTAGG - Intergenic
1108652981 13:52500230-52500252 CTTAAAAATAGGACATTTTTAGG + Intergenic
1110413348 13:75226647-75226669 GTTAAAAATATAACCTCTCAAGG + Intergenic
1110841210 13:80145658-80145680 GCCCAAAAGAGGACCTCTGTGGG + Intergenic
1111544726 13:89717538-89717560 TTTAAAAATTTGACCACTGTGGG - Intergenic
1113068602 13:106395964-106395986 TTTTAAAATAGGACATCTTTTGG + Intergenic
1116643673 14:47498602-47498624 GTTAGAAATATAACCTTTGTTGG - Intronic
1116670573 14:47836443-47836465 TTTAAATTTAGGACATCTGTTGG + Intergenic
1118175253 14:63433340-63433362 ATTTAAAATAGGGGCTCTGTGGG + Intronic
1119418515 14:74492715-74492737 GTTACAAATAGGACTTCCTTTGG - Intronic
1124823926 15:33074717-33074739 GTTAAGAACAGGACCTCAGCCGG + Intronic
1125107188 15:35986110-35986132 TTTAAAAATAGCTCCACTGTGGG - Intergenic
1125148150 15:36497298-36497320 AGTGAAAATATGACCTCTGTAGG - Intergenic
1125209998 15:37203310-37203332 GCTAAAACCAGGAGCTCTGTAGG - Intergenic
1126478438 15:49091496-49091518 GTTAAAATTAGGAGCCCAGTGGG - Intergenic
1137807330 16:51319783-51319805 GTTATAAATAATACCTCAGTTGG + Intergenic
1139022037 16:62761459-62761481 CTTAAAAATATGGCCTGTGTGGG - Intergenic
1141035933 16:80625727-80625749 GTTAAATATTTGCCCTCTGTAGG - Intronic
1141585821 16:85032928-85032950 ATTGAAAATAGGGTCTCTGTGGG - Intronic
1144168650 17:12637055-12637077 GTTACAAATTGGACCTCTAAGGG + Intergenic
1145233066 17:21189083-21189105 ATTCAGAACAGGACCTCTGTGGG + Intronic
1147481132 17:40764372-40764394 GGAAAGAATAGGACCTCTGTTGG + Intergenic
1155790713 18:29966665-29966687 GTTCAAAATAGAGCCTCTGCTGG - Intergenic
1156234353 18:35186938-35186960 GTTAAAAATATGATCGCTGGAGG + Intergenic
1157861956 18:51149745-51149767 TTTAAAAATAAGATCTTTGTTGG + Intergenic
1159023088 18:63158887-63158909 TTTAAAAAAAGGATCTCTCTTGG + Intronic
1163049209 19:14669017-14669039 ACTAAAAATAGGACCACTGTTGG + Intronic
1164025090 19:21344620-21344642 GGTAAAAATAGGACAGGTGTGGG - Intergenic
1164431046 19:28189108-28189130 GTAAAAAATAAAACCTCTTTTGG + Intergenic
1164577829 19:29416463-29416485 CTTATAAATAGGACCTTTCTTGG - Intergenic
926909743 2:17841142-17841164 ATTAAAAATAGGACCCTTGCAGG + Intergenic
927876527 2:26658990-26659012 GGTTAAAATAGCACCTCAGTGGG + Intergenic
928951307 2:36815547-36815569 GGTAAAAATGGGGCCTCTTTGGG - Intergenic
929130134 2:38559708-38559730 GTTTAAAATAGGGCCTTTTTGGG + Intergenic
930811875 2:55550987-55551009 GTTAAAAATAGGCTAACTGTAGG + Intronic
931259925 2:60608469-60608491 GATAAAAATAGGACTTCCATAGG - Intergenic
931519765 2:63082838-63082860 GTTTAAAATATAACCCCTGTAGG + Intergenic
935426449 2:102923635-102923657 GTTAAAAATAAGACCTATTGTGG - Intergenic
940320384 2:152370593-152370615 ATTAATGATAGGACCTGTGTTGG + Intronic
941425646 2:165341391-165341413 CTTAAAAATATCACCACTGTGGG - Intronic
941453834 2:165692482-165692504 GATAAAAATGTGACCTCTTTGGG + Intergenic
941656791 2:168152963-168152985 GTTAAAAATATGATCCCTATGGG + Intronic
942584607 2:177461646-177461668 GTGAAAAATAGAACTTCTTTTGG + Intronic
942782443 2:179661117-179661139 GTTAAAAATAGGAAAACTGAGGG + Intronic
943510115 2:188814690-188814712 GTTATAAATGGTACCTCTGATGG - Intergenic
944386792 2:199174420-199174442 GTAAAAAATGGTACGTCTGTAGG - Intergenic
944959086 2:204849323-204849345 TTTAAAAATAGAAACTCTTTTGG + Intronic
945637364 2:212372354-212372376 TTCAAAATTAGGACCTCTATTGG + Intronic
946473865 2:219989068-219989090 TTTAGAAATAGGACTTTTGTAGG + Intergenic
947197887 2:227586703-227586725 GTTAAATAAAGGAACCCTGTTGG - Intergenic
1169853914 20:10082957-10082979 GTTAAGAATAGGACATAGGTTGG - Intergenic
1169918681 20:10709643-10709665 CTTTAAAATAGAACCTCTTTGGG - Intergenic
1169957394 20:11119782-11119804 GGTAAATATAGAACCTCTGATGG + Intergenic
1177114457 21:17068918-17068940 GTTAAAAAAAGGACCTGGATCGG - Intergenic
1178587274 21:33880873-33880895 GTCAAAAAGGGGGCCTCTGTGGG + Intronic
1179135953 21:38679828-38679850 GTTAAAAATAGCTCAACTGTGGG - Intergenic
1180759636 22:18190560-18190582 GTTAAATATAGAACCCCTGTTGG + Intergenic
1180769949 22:18374861-18374883 GTTAAATATAGAACCCCTGTTGG + Intergenic
1180776379 22:18487805-18487827 GTTAAATATAGAACCCCTGTTGG - Intronic
1180809107 22:18745174-18745196 GTTAAATATAGAACCCCTGTTGG - Intergenic
1180827889 22:18877816-18877838 GTTAAATATAGAACCCCTGTTGG + Intergenic
1181072028 22:20350152-20350174 GTTAAATATAGAACCCCTGTTGG - Intergenic
1181195103 22:21179097-21179119 GTTAAATATAGAACCCCTGTTGG - Intergenic
1181214343 22:21313677-21313699 GTTAAATATAGAACCCCTGTTGG + Intergenic
1181328252 22:22068227-22068249 GTTGAAAATAGGATTTCAGTGGG - Intergenic
1184265933 22:43346044-43346066 GTGAAAAATAGGACAGCTGTGGG - Intergenic
1203231779 22_KI270731v1_random:116045-116067 GTTAAATATAGAACCCCTGTTGG + Intergenic
1203277987 22_KI270734v1_random:103814-103836 GTTAAATATAGAACCCCTGTTGG + Intergenic
949302354 3:2599078-2599100 ATTAAAAATAGCAACACTGTAGG + Intronic
952387967 3:32856530-32856552 GTTAAAAATAGGACCTCTGTTGG + Intronic
955010860 3:55012931-55012953 GCTAAAAATTGGACCACTTTTGG - Intronic
955525387 3:59814620-59814642 GAAAGAAATAGGACCTATGTGGG - Intronic
955863534 3:63357521-63357543 GTTAAAAGAAGGAACTCAGTGGG - Intronic
956079906 3:65547592-65547614 GTTAAAAGCAGGAGCTCTGGAGG + Intronic
957020140 3:75117705-75117727 GTTAAAACTACTACCTCTGAAGG - Intergenic
959627531 3:108469701-108469723 GCTAAAAATATGAGCACTGTAGG - Intronic
960652301 3:119964679-119964701 GTTAATTATAGGCCCTATGTTGG - Intronic
962560480 3:136601159-136601181 ATTAAAAATAGTACTTCTTTAGG - Intronic
964617327 3:158681598-158681620 CTTGAAAATAGGACCTTTGATGG - Intronic
965737811 3:171840491-171840513 CTTAAAAATAACAGCTCTGTGGG - Intergenic
966474541 3:180328414-180328436 GTTAAAAGCAGGAGCCCTGTAGG + Intergenic
970918252 4:21361837-21361859 GTTACAAATATGAACTCTTTAGG - Intronic
970957882 4:21836431-21836453 GAAAAAAATAGGACATCTCTTGG - Intronic
971145793 4:23974983-23975005 GTTCAAAGTAGGACAGCTGTGGG + Intergenic
971313349 4:25545964-25545986 GCTAATAAAAGGACTTCTGTTGG + Intergenic
974881044 4:67757514-67757536 GTTAAAGACAGGAGCTCTGAAGG - Intergenic
976960249 4:90962564-90962586 GTTAAAAATATTACCTATGTGGG - Intronic
977200458 4:94108703-94108725 GTTAAAAATTGTCCTTCTGTTGG - Intergenic
981723199 4:147822116-147822138 ATTAAGATGAGGACCTCTGTAGG + Intronic
983397617 4:167220788-167220810 GCCAAATATAGTACCTCTGTAGG + Intronic
986888507 5:12270648-12270670 ATTAAAAATAGTAACTCAGTGGG + Intergenic
989215763 5:38902798-38902820 ATTAAAAAGAGGTCCTCTGATGG - Intronic
990045867 5:51430384-51430406 GTTAAAAATAACACCTATTTTGG - Intergenic
990350017 5:54906626-54906648 GTTGAAAGTAGGACCTGTGTTGG - Intergenic
992499209 5:77325106-77325128 GTTAAAAATGGGGCCTCTAGAGG - Intronic
992935387 5:81698421-81698443 GTTAAAAATAGGATAACTTTTGG - Intronic
993243798 5:85425898-85425920 GTTGAATATAGGATCACTGTAGG - Intergenic
996240458 5:121193975-121193997 GAAAAAAATATGACCTGTGTTGG - Intergenic
997825120 5:137099280-137099302 GTTAAAAATGAGACCTGTGGAGG - Intronic
999662940 5:153884464-153884486 GATAAAAATAGGGCCTCTCCAGG + Intergenic
999681938 5:154068719-154068741 TTTAGAAATAGGATCTTTGTAGG - Intronic
1001702154 5:173714539-173714561 GTCAAGAACAGGGCCTCTGTTGG + Intergenic
1002395868 5:178953890-178953912 GATAAAAATAGAACCACAGTAGG - Intronic
1003578691 6:7320017-7320039 GTTAAAAATAAGAGCACAGTTGG - Intronic
1004274634 6:14224841-14224863 ACTTAAAATAGGACCTATGTAGG + Intergenic
1004677998 6:17863179-17863201 TTTTTAAATGGGACCTCTGTGGG - Intronic
1006459125 6:34148105-34148127 GTTAAAAAAAGAAACACTGTTGG + Intronic
1007026613 6:38582521-38582543 GTTAAAAACAGGGCCTCTGCAGG - Intronic
1011091254 6:83603053-83603075 GTTAAAGATAGTACCTTTCTTGG + Intronic
1012880895 6:104787708-104787730 TTTGAAAATAGGATCACTGTTGG - Intronic
1013725356 6:113088934-113088956 GGAAAACATAAGACCTCTGTTGG + Intergenic
1014840929 6:126219150-126219172 GTTAAAACTAGGTCCTGTGATGG + Intergenic
1018132239 6:160742938-160742960 GTTAAAAATCAGATGTCTGTAGG + Intronic
1018522384 6:164664927-164664949 GTTAAAAATACGTCCTTTGCAGG + Intergenic
1019051855 6:169189737-169189759 GTTAATAAAAGCAGCTCTGTGGG + Intergenic
1020748357 7:12108382-12108404 GTTACAAATTGGAACTCTATTGG - Intergenic
1021328100 7:19299597-19299619 GTTAAAATTAGTTCCTCTATTGG + Intergenic
1033463929 7:141573541-141573563 GCTAAAACTAGACCCTCTGTAGG + Intronic
1038602333 8:28957920-28957942 TTTAAAAATAGGACCTAGGCTGG - Intronic
1040727245 8:50396834-50396856 CTTAAACATAGGACCTAGGTTGG - Intronic
1042773276 8:72402089-72402111 GTTAGAAATCTGACCTCTGATGG + Intergenic
1042775414 8:72425253-72425275 GTTAAAAATAGAATGTCAGTGGG - Intergenic
1044908990 8:97036365-97036387 TTTAAAAATATGAACTCTATTGG + Intronic
1045521671 8:102908477-102908499 ATTAAAAATAGAACCACCGTAGG + Intronic
1051517526 9:17946601-17946623 ATTAAAAATAGGAATTCTTTAGG + Intergenic
1051931201 9:22388465-22388487 GGTAAAATCTGGACCTCTGTGGG + Intergenic
1057996141 9:99822835-99822857 ATTGAAAATAGGAGCTCTGGTGG + Intronic
1058542404 9:106025586-106025608 ATTCAAAGTAGGACCTCTTTGGG - Intergenic
1059030318 9:110686387-110686409 ATTAAAACAAGAACCTCTGTGGG + Intronic
1186209886 X:7239269-7239291 ATTTAAAACAGGACCTTTGTTGG + Intronic
1192789678 X:74369021-74369043 GTTAAAAAGAGGACATTTGTTGG - Intergenic
1194167902 X:90543814-90543836 GTCTAAAATATGACCTCTGCTGG - Intergenic
1195277885 X:103299946-103299968 GATATATATAGGACATCTGTAGG - Intergenic
1196857119 X:119994863-119994885 ATTAAAAATAGTACATATGTCGG + Intergenic
1198425728 X:136518194-136518216 TTTAAAAATAGACCCTCTGTTGG - Intergenic
1201334589 Y:12866825-12866847 ATTAGCAATAGGAGCTCTGTTGG + Intergenic