ID: 952391237

View in Genome Browser
Species Human (GRCh38)
Location 3:32882434-32882456
Sequence TCACATGGCAAGAGTGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952391237_952391242 12 Left 952391237 3:32882434-32882456 CCTGTCACACTCTTGCCATGTGA 0: 1
1: 0
2: 3
3: 19
4: 221
Right 952391242 3:32882469-32882491 GACTCTTCAAACTACATGTATGG 0: 1
1: 0
2: 0
3: 4
4: 93
952391237_952391243 13 Left 952391237 3:32882434-32882456 CCTGTCACACTCTTGCCATGTGA 0: 1
1: 0
2: 3
3: 19
4: 221
Right 952391243 3:32882470-32882492 ACTCTTCAAACTACATGTATGGG 0: 1
1: 0
2: 0
3: 10
4: 125
952391237_952391244 19 Left 952391237 3:32882434-32882456 CCTGTCACACTCTTGCCATGTGA 0: 1
1: 0
2: 3
3: 19
4: 221
Right 952391244 3:32882476-32882498 CAAACTACATGTATGGGAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952391237 Original CRISPR TCACATGGCAAGAGTGTGAC AGG (reversed) Intronic
900182626 1:1319004-1319026 TGAAATGGCCAGAGTGGGACAGG - Intronic
900331361 1:2136277-2136299 TCATGTGGCAAGAGTGGGTCTGG + Intronic
902388768 1:16090830-16090852 TCACTTGGCAAGAGGGAGAGGGG + Intergenic
902979628 1:20113623-20113645 TCACATGGCCAGACTGTGCAGGG + Exonic
903351296 1:22718155-22718177 TTACAGGGCAAGGGTCTGACTGG + Intronic
903479086 1:23639967-23639989 ACCCAGGGCAAGAGTGTGTCTGG - Intronic
904424914 1:30417023-30417045 TCACACCGCAAGTGTGTGGCAGG + Intergenic
904478357 1:30778630-30778652 TCACAGGGAAAGAGTCTGATTGG - Intergenic
904936346 1:34132287-34132309 TCACATGGTAAGAGTGAATCGGG - Intronic
908316301 1:62936158-62936180 CCACATGGCATGAGTTTGAGGGG + Intergenic
910401157 1:86839372-86839394 TCAGATGGTGAGAGTGTGGCGGG + Intergenic
911271728 1:95809918-95809940 TCACATGGCATGAGGGAGAATGG + Intergenic
912136860 1:106671043-106671065 TAACATGGCAAGATTTTGAGTGG - Intergenic
913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG + Intergenic
917148449 1:171918421-171918443 TCACACAGCAAGAGTGTGCTGGG + Intronic
919349537 1:196431982-196432004 TCACAGGACCAGAGTGTGAAAGG + Intronic
920859008 1:209689659-209689681 TCACATGGCAAGAGAGGGGTGGG - Intronic
921817645 1:219581889-219581911 TGACATTGCAACAGTGTGAGGGG + Intergenic
923499948 1:234556273-234556295 TCACAGGTCCAGAGTGGGACTGG - Intergenic
924464242 1:244285625-244285647 TCACCTTGCAAGAGTTTGCCAGG + Intergenic
1063905234 10:10774547-10774569 TCACATGGCAGGAGCGAGAGCGG - Intergenic
1064300100 10:14115702-14115724 TCACATGGCAAGAGAGAGCGGGG - Intronic
1064630969 10:17310374-17310396 TCACATGGCAAAAGGGTGGATGG - Intergenic
1069980873 10:72251647-72251669 ACACAAGGCAAAGGTGTGACTGG - Intergenic
1072279873 10:93856107-93856129 TCACAGGGCAAGGATGTGGCCGG + Intergenic
1073200124 10:101728469-101728491 TCACATTGTCAGAGGGTGACAGG - Intergenic
1074392192 10:113067703-113067725 TCACATGGCAAGTTTCTAACTGG - Intronic
1075559328 10:123456992-123457014 TCACGTGCCAGGAGTGTGCCAGG + Intergenic
1076748582 10:132528022-132528044 TCACATGGGTTGAGTGTGTCTGG + Intergenic
1076813278 10:132899970-132899992 TCACATGGCAAGGGTGGGAGTGG + Intronic
1077712757 11:4552742-4552764 TGAAAGGGCAAGAGTGAGACTGG - Intergenic
1079399144 11:20091742-20091764 TCTCATGGAAAGAGTGTTTCAGG - Intronic
1080830999 11:35893184-35893206 TCACATGGCGAGAGAGAGAGAGG - Intergenic
1081401769 11:42651737-42651759 TCACATGGGAACAGTTTGAATGG + Intergenic
1085719420 11:78899755-78899777 TCACATGGCAACAGAGAGAGGGG - Intronic
1087178028 11:95112977-95112999 TCACATGGTTAGTATGTGACGGG - Intronic
1088663400 11:112071134-112071156 TAATATGGTAAGAGTGTGAGAGG + Exonic
1091711739 12:2745876-2745898 TCACATGGCAAGTGTATGTTTGG - Intergenic
1095374320 12:41508182-41508204 TCACATAGCAAAAAAGTGACAGG + Intronic
1096556789 12:52408815-52408837 TCAAATGGAAAGAGTGGGAGAGG + Intergenic
1099002818 12:77200878-77200900 TCACATAGCAAGAATATGGCAGG - Intergenic
1099032812 12:77549385-77549407 TAACATGGCAACAGGGTAACAGG - Intergenic
1099618534 12:84971842-84971864 TCATATGGCAATAATGTAACAGG + Intergenic
1100168721 12:91948037-91948059 TTAAATTTCAAGAGTGTGACAGG - Intergenic
1100678646 12:96894713-96894735 TCCCATGGCAGGAGGGTGATGGG - Intergenic
1101691683 12:107088289-107088311 TCACATGGCGAGAGAGAGAGGGG - Intronic
1102136778 12:110582547-110582569 TCACAACCCGAGAGTGTGACCGG - Intronic
1103053586 12:117801582-117801604 TCACATGGCCAGAGTGGGGTTGG + Intronic
1103065590 12:117894754-117894776 TCACGTGGCCAGAGTGAGAGAGG - Intronic
1104630598 12:130398316-130398338 TCACATGGCAAGAGTTGCTCTGG - Exonic
1104815486 12:131643125-131643147 TGACATGGCAGGGGTGTGAGTGG - Intergenic
1108580886 13:51827296-51827318 CCACATGGCCAGTGAGTGACAGG - Intergenic
1111204974 13:84994810-84994832 CCAAATGGCAAGACTATGACAGG + Intergenic
1111469185 13:88655137-88655159 TCATAGGGCAAAGGTGTGACAGG - Intergenic
1112144636 13:96684684-96684706 TCAAGTAGCAAGAGTGTGAAAGG - Intronic
1112207270 13:97337165-97337187 GCACATGGCAGGAGGGTGAGGGG - Intronic
1112286353 13:98107838-98107860 TCACATGGCAGAAGAGTGAAAGG - Intergenic
1116129509 14:40836734-40836756 TCACATGGCAAGAGCAAGAAAGG + Intergenic
1117009051 14:51451738-51451760 TCACATGGCAAGAGAGGAAGTGG - Intergenic
1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG + Intronic
1121368820 14:93338298-93338320 TCACATGGCAAGAGATGGACTGG - Intronic
1127089948 15:55457216-55457238 TGGCATGGCCAGAGTGAGACTGG + Intronic
1128756663 15:70187930-70187952 TGACAGGGCGAGAGTGTGGCAGG - Intergenic
1129806526 15:78464965-78464987 ATACATGGCAAGAGTTTCACAGG + Intronic
1130776744 15:86992139-86992161 TCACATGGCAAGAGTGAACAAGG + Intronic
1131068356 15:89448560-89448582 TCACATGGCAAGAGGGTGGTGGG + Intergenic
1131080184 15:89527860-89527882 TCTCATGGCAAGACTGGGAGAGG + Intergenic
1133713209 16:8421506-8421528 TCTCTTGGCAAGACAGTGACAGG + Intergenic
1134232521 16:12439732-12439754 TCACATGGCTAGTATGTGACTGG - Intronic
1136088852 16:27904000-27904022 CCCCAAGGCAAGAGTGTGCCTGG - Intronic
1136857733 16:33674308-33674330 TCCCAAGACAACAGTGTGACAGG + Intergenic
1138148124 16:54630319-54630341 ACACATGGGAAGACTGTGGCAGG - Intergenic
1138740345 16:59301538-59301560 ACAGATGGCAAAAGTGTGAGAGG + Intergenic
1139026298 16:62822544-62822566 TCACATGGCAAGAGAGAGACTGG - Intergenic
1139362836 16:66412996-66413018 TCACATGGCAAAATTGTGTGTGG - Intergenic
1139794781 16:69473667-69473689 TGACATGGCACAAGTGTGACAGG - Intergenic
1141293050 16:82738345-82738367 TCACATTCCTAGAGTTTGACAGG - Intronic
1142165001 16:88581743-88581765 CCACATGGCATGAGTGGGTCAGG - Intronic
1203119314 16_KI270728v1_random:1522791-1522813 TCCCAAGACAACAGTGTGACAGG + Intergenic
1145026727 17:19473399-19473421 TCACATGGCAAGTGGGAGAGTGG - Intergenic
1145784433 17:27584912-27584934 TCAGTTGGCAAGGGTGTGGCTGG - Intronic
1147530349 17:41270676-41270698 TCACTTGGGAAGAGGGTGATTGG - Intergenic
1148588866 17:48800623-48800645 TCACATGGCAAGGGTATCAGAGG - Intronic
1149574133 17:57699421-57699443 TCACATGACAAGATTCTGAAAGG - Intergenic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1151993191 17:77591746-77591768 TCACAGGGCAGGAGTGGGGCTGG + Intergenic
1154955077 18:21245487-21245509 TCATATGGCAAGATTGGGAAGGG - Intronic
1155227617 18:23743262-23743284 TCACATAGCCAGTGGGTGACAGG + Intronic
1156985080 18:43341560-43341582 TCACATGGTAATAATGAGACCGG - Intergenic
1159784993 18:72703057-72703079 TCACATGGCAAGAGAGAGCAAGG + Intergenic
1160165021 18:76503677-76503699 TCACAGGGGAAGAGCATGACTGG - Intergenic
1162032696 19:7924320-7924342 TCACATGGCTAGAGTCTGGTAGG - Intergenic
1163842708 19:19621100-19621122 CCAAATGGCAACAGTGGGACGGG - Intergenic
1165382771 19:35492893-35492915 TCACACAGCCAGAATGTGACAGG + Intronic
1166669689 19:44702397-44702419 TCACACGGCCAGAGAGTGGCAGG + Intronic
1166743124 19:45126146-45126168 TCTCATGGCAGGTGAGTGACCGG - Intronic
1167280988 19:48568482-48568504 TCTCTTGGCAGGAGTGTGACTGG - Intronic
1168490283 19:56803237-56803259 TCAGATGGAAAGAGGGTGGCAGG - Intronic
925117904 2:1396094-1396116 TCACGTGGGAAGAGTCTGCCTGG + Intronic
925288468 2:2730846-2730868 TCGCAGGGCAGGAGTGTGCCTGG - Intergenic
925829567 2:7881275-7881297 TTGCATGGAAAGAATGTGACTGG + Intergenic
926268598 2:11347226-11347248 TCACATGGCAAGTGTGTGTTTGG - Intronic
926589770 2:14728207-14728229 TCACATGGCAAGAGAGAAAGGGG - Intergenic
928222656 2:29417590-29417612 TCACATGGCTAGTGAGTGAAAGG + Intronic
930258497 2:49118444-49118466 TCACATGGCAGCAGTGGGACCGG + Intronic
934609809 2:95726712-95726734 TCACATGGCAGGGGGGTGAGGGG + Intergenic
934636638 2:95995363-95995385 TCACATGGCAGGAGACTGAAGGG - Intergenic
934797010 2:97110058-97110080 TCACATGGCAGGAGACTGAAGGG + Intergenic
934836404 2:97593369-97593391 TCACATGGCAGGAGACTGAAGGG - Intergenic
937444989 2:121950033-121950055 TCACAGGTCAGGAGTGTAACTGG + Intergenic
937604063 2:123775327-123775349 TCACATGGCAACATTTAGACAGG + Intergenic
938556213 2:132426551-132426573 TCAGATGGAAAAAGTGTGTCAGG + Intronic
939003458 2:136761012-136761034 GAAAATGGCAAGAGTGTAACAGG - Intergenic
939578898 2:143925253-143925275 TCACATGGCAGGAGTATGGCTGG - Intergenic
939988443 2:148855122-148855144 TCATATGGCAAAAGTGCGAGAGG - Intergenic
940094360 2:149957394-149957416 TCACATGGCAAGAGTGTTCATGG - Intergenic
942536487 2:176969908-176969930 GCACATGGAGAGAGTGTGAAGGG - Intergenic
943487945 2:188511503-188511525 TCACATCTGAAGAGTGAGACAGG - Intronic
946336682 2:219042333-219042355 TCACATGGCCAGAGACTGGCAGG + Intergenic
946635015 2:221715432-221715454 TCTCAAGGCAAAAGTGAGACAGG + Intergenic
946966345 2:225041914-225041936 TCACTTAGCACCAGTGTGACTGG + Intronic
947636918 2:231684881-231684903 TCTCAAGGCAAGAGGGAGACTGG + Intergenic
948026751 2:234784523-234784545 CCACAAGCCAAGATTGTGACAGG + Intergenic
1170637653 20:18122460-18122482 AGACATGGCAAAAGTGTGGCCGG - Intergenic
1170971901 20:21124574-21124596 TTCCAGGGCAAGAGTGTGAATGG - Intergenic
1173670835 20:44797803-44797825 ACACATGGCAAGGCTCTGACTGG - Intronic
1178117339 21:29430846-29430868 GCACATGGCAAGAGTTGGACAGG + Intronic
1183964025 22:41430601-41430623 TCACCTAGCAAGAGAGTGGCAGG + Intergenic
1184919169 22:47593542-47593564 TCACATGGCAAGAGCCAGAGAGG - Intergenic
949114068 3:298324-298346 TCACATGGCATGGGTGAGCCAGG + Intronic
950048792 3:9969918-9969940 TCACATAGCCAGTGGGTGACAGG - Intronic
952391237 3:32882434-32882456 TCACATGGCAAGAGTGTGACAGG - Intronic
952865198 3:37850496-37850518 TCTAAGGGCAAGAGTGGGACAGG + Intergenic
954817064 3:53291000-53291022 TCCCAAGGGAAGAGTCTGACAGG + Intronic
955578069 3:60387977-60387999 TCACATGGCAAGACAGAGAAGGG - Intronic
956336178 3:68166648-68166670 TCACAAGGGAGGAGTGTGGCAGG - Intronic
956573148 3:70719426-70719448 TCACAGGGCTGGAGTCTGACAGG - Intergenic
956754734 3:72373498-72373520 TCCCATGGCTAGAGTGTGACAGG - Exonic
959796025 3:110429322-110429344 TCACATGGCAGAAGAGTGAAAGG - Intergenic
960352347 3:116608477-116608499 TCACATGGCAGGAGTGAGAAAGG - Intronic
961617664 3:128195787-128195809 CTTCATGGCAAGAGTGAGACTGG + Intronic
963023628 3:140897369-140897391 GGGCATGGCAAGAGTGAGACCGG - Intergenic
963550053 3:146708919-146708941 TCACATGGCAAAATGGTGAAGGG - Intergenic
966120187 3:176512032-176512054 TCCCATAGCAAGACTGTGAGGGG - Intergenic
966243295 3:177778233-177778255 TCTCCTTGCAAGACTGTGACGGG - Intergenic
966447889 3:180024000-180024022 TCACATACCAAGTGTGTGCCTGG + Intronic
966569788 3:181428751-181428773 TCACATGGCAAGAGAGTGAGGGG + Intergenic
968138584 3:196237442-196237464 TCACGTGACAAGAGTGTGGTAGG - Exonic
969628005 4:8317554-8317576 TCAGAATGCAACAGTGTGACAGG - Intergenic
969925101 4:10577975-10577997 TCACATGGCTCAAGAGTGACAGG - Intronic
970524572 4:16918347-16918369 TCACTGGGGAAGAGTGTGAATGG + Intergenic
970758775 4:19457137-19457159 TCCCATGTCATGAGTGTGTCAGG + Intergenic
972285229 4:37641976-37641998 TCACACAGCTAGAGAGTGACAGG + Intronic
978193037 4:105938282-105938304 GCACCTGGAAAGAGAGTGACTGG - Exonic
978742350 4:112151256-112151278 TCACATGGCAAGAGGGAGGGAGG - Intronic
979752169 4:124291983-124292005 TCACATGGCAAGAGAGGGAGCGG - Intergenic
980830821 4:138127817-138127839 TCACATGGCAAGAGAGAGAAGGG - Intergenic
981022415 4:140042696-140042718 TCACATGGCCCCTGTGTGACTGG - Intronic
982496396 4:156098843-156098865 TCCCATGGCAAGTGTGGGGCCGG + Intergenic
984080645 4:175245457-175245479 TCACAAGTCAAGGGTGGGACAGG + Intergenic
985151683 4:186953867-186953889 TCAGATGGCTAGAAAGTGACAGG - Intergenic
985328405 4:188798295-188798317 TCTTATGGCAATACTGTGACTGG - Intergenic
985357102 4:189133052-189133074 TCACATGGCAAGACAGGGAGTGG - Intergenic
986399609 5:7368223-7368245 TCACATGGCAAGAGAGAGAGAGG - Intergenic
986444022 5:7805694-7805716 TCCCATGGGAAGAGTGAGAGTGG + Intronic
990645647 5:57841097-57841119 TCACATGGCAAGAAGGTAAAGGG - Intergenic
991349151 5:65702598-65702620 TCACATGGCAAGAGGGACAGGGG + Intronic
991937165 5:71813696-71813718 TCACAGGGTCAGAGTGTGAATGG + Intergenic
992887423 5:81172659-81172681 GCACATGGCCAGAATGTGAAGGG - Intronic
995550031 5:113271781-113271803 TCACATGGCAAGAGGGGAATGGG - Intronic
996330291 5:122320997-122321019 TCTCAGGGCAAGAGGGTGAGTGG - Intronic
996787066 5:127249905-127249927 TCACATGGCAGAAGAGTGAAAGG + Intergenic
998693119 5:144609891-144609913 TCACATGGCAAGAGAGAAAGGGG + Intergenic
998697351 5:144655433-144655455 GCAGATGGCAAGAGTGTAATGGG - Intergenic
999515149 5:152294507-152294529 TCACATGGCCAGAAGGTGGCAGG + Intergenic
999728961 5:154461253-154461275 TCACCTGGAAAGAGACTGACTGG + Intergenic
1001545306 5:172567410-172567432 CCAGATGACAAGAGTGTGGCAGG + Intergenic
1001821838 5:174716509-174716531 TCACCCAGCAAGAGAGTGACAGG + Intergenic
1004321799 6:14637528-14637550 TTGCATGGCAAGAGTGTGCAAGG - Intergenic
1004404064 6:15315557-15315579 TCACGTATCTAGAGTGTGACTGG + Intronic
1004976930 6:20978393-20978415 TGAAATGGCAAGACTGTGAAAGG - Intronic
1005197001 6:23298747-23298769 TCTCATGGGAAGACTCTGACAGG + Intergenic
1005878494 6:30034701-30034723 TCACATGGCAAGTGGGTCAAGGG - Intergenic
1005883362 6:30076059-30076081 GCACATGCCAAGAGTGAGCCTGG - Intergenic
1005919024 6:30382273-30382295 TCACATGGCAAAAGAGGAACAGG + Intergenic
1007929485 6:45677503-45677525 ACAGCTGCCAAGAGTGTGACAGG + Intergenic
1008056611 6:46952114-46952136 TCACATGGCAAGATAGTTGCAGG + Intronic
1009319571 6:62270341-62270363 TCACATGGCGAGAGAGAGAAAGG - Intronic
1010805600 6:80231943-80231965 TCACAGGGCGAGAGTCTGTCTGG + Intronic
1011440294 6:87380247-87380269 TCCTAAGGCAAGAGTGTGTCTGG + Intronic
1013013661 6:106142411-106142433 TGACTTTGGAAGAGTGTGACTGG - Intergenic
1013307610 6:108864132-108864154 TCACATGCCAAGAGTGACAGAGG + Intronic
1015175170 6:130298484-130298506 TCACTTAGCAACAGTATGACAGG + Intronic
1015804156 6:137091811-137091833 TCACATGGCAAGAGGGGAGCAGG - Intergenic
1016432478 6:144001687-144001709 TCACATGGCAAGATGGTGTCTGG - Intronic
1016594694 6:145786248-145786270 TAACATGAAAAGAGTGAGACTGG - Intergenic
1016796293 6:148121465-148121487 TGACATGGCAACAGTGTCCCAGG - Intergenic
1017227375 6:152037785-152037807 TCACAAGGCTAGAGAGTGGCCGG + Intronic
1017353485 6:153473218-153473240 TCACATGGCAATAGGTTGAAGGG + Intergenic
1018783990 6:167093798-167093820 AGACATGGCCAGCGTGTGACCGG - Intergenic
1019146699 6:169980090-169980112 TCACATGGAAAGGGGGAGACGGG + Intergenic
1020166678 7:5812865-5812887 CCACGTGTCAAGAGTGGGACAGG + Intergenic
1020672268 7:11131214-11131236 TCATATGGTAAGAGTGTGTTTGG + Intronic
1021027441 7:15686623-15686645 TCAGATGTCAAGAGTGGGAGAGG + Exonic
1021358136 7:19679350-19679372 TCACAAGGATAGAGTGTGAGAGG - Intergenic
1023625462 7:42111192-42111214 TCTCCTGCCAAGAGTGAGACTGG + Intronic
1024526357 7:50353310-50353332 CATCATGGCAAGAGTGTGGCTGG - Intronic
1028831077 7:95327151-95327173 TCACATGGCAAGAGAGGGAGTGG - Intergenic
1029031390 7:97471061-97471083 TCACATAGCATGAGTGGCACTGG + Intergenic
1030128515 7:106177784-106177806 TCATCTTGCAGGAGTGTGACAGG - Intergenic
1030436792 7:109531829-109531851 TCACATGGCAAGAGGTGGAATGG - Intergenic
1030911262 7:115252074-115252096 CCACATGGCAAGAGCGAGAAGGG - Intergenic
1031921833 7:127608203-127608225 TCACCTGCCAAGAGTGAGCCAGG + Intergenic
1032644265 7:133804643-133804665 TCATATGTCAAAAATGTGACTGG - Intronic
1033625022 7:143101824-143101846 TCACATGGCAGAAGAGTGAAAGG + Intergenic
1036968557 8:13328430-13328452 TCACAGGGCAAGAATCTGAGAGG - Intronic
1037896799 8:22662172-22662194 ACACATGCCAGGAGTGTGAGGGG - Intronic
1042249922 8:66745842-66745864 TCATATGGCAAAAGAGTGAGTGG + Intronic
1043350231 8:79352108-79352130 TGATATGGCAGGAGTGTGAGGGG + Intergenic
1043531760 8:81158961-81158983 TCACCTGGCAACAGTATGAAAGG - Intergenic
1043587733 8:81788858-81788880 TCACATGGCAAGAGAGAGCAAGG + Intergenic
1043654995 8:82652418-82652440 CCACTTGGCTAAAGTGTGACTGG + Intergenic
1047022231 8:120786679-120786701 TACCAGGTCAAGAGTGTGACTGG + Intronic
1048942889 8:139417591-139417613 GCACATGGCCAGGGTGTGTCAGG + Intergenic
1050563978 9:6863493-6863515 TCACATGGTAAGAGAGAGAAGGG + Intronic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1055015410 9:71612383-71612405 TCACATGGTAAGAGTATGTTTGG - Intergenic
1056672377 9:88641544-88641566 TCAATTGGCAAAAGTGTGATAGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057064803 9:92038668-92038690 GCACATGGCAAGGGAATGACAGG - Intronic
1058146565 9:101418531-101418553 TCACATGGCTAGTAAGTGACAGG + Intergenic
1058983592 9:110192174-110192196 ACCCATGGCAAGAGAGAGACAGG + Intronic
1060043631 9:120323185-120323207 TCACAAGGGAAGCCTGTGACTGG + Intergenic
1060531786 9:124351522-124351544 GCACCTGGCCAGAGTGTCACAGG + Exonic
1062200394 9:135299836-135299858 ACACGTGGCGAGAGCGTGACTGG + Intergenic
1186300468 X:8195290-8195312 TCACATGGCAAGAACGGGAGTGG + Intergenic
1188976428 X:36681654-36681676 TCACAAGGCTAGAATGTGGCAGG - Intergenic
1189419562 X:40844651-40844673 TAGCATGGCAGGAGTGTCACTGG - Intergenic
1190326597 X:49210523-49210545 TCACATGGCAAGGGTGGGAAGGG - Intronic
1192241447 X:69333021-69333043 TCACATGGCAAGAGCAGGAGGGG + Intergenic
1192533161 X:71906934-71906956 TCTCATGGCAAGAGGGTGTGGGG + Intergenic
1195146302 X:102020449-102020471 TCACATGGCAGAAGTGTAAAAGG - Intergenic
1195345710 X:103949106-103949128 TCCTATGGCAAGAGTGAGCCCGG + Intronic
1198959498 X:142169334-142169356 TCGCATCGCTAGAGAGTGACAGG - Intergenic