ID: 952392555

View in Genome Browser
Species Human (GRCh38)
Location 3:32892847-32892869
Sequence GGGTGGACATGCGTGTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952392547_952392555 30 Left 952392547 3:32892794-32892816 CCTCGTTCTCAGAGAGAGGGTTT 0: 1
1: 0
2: 1
3: 7
4: 116
Right 952392555 3:32892847-32892869 GGGTGGACATGCGTGTGCTGAGG 0: 1
1: 0
2: 2
3: 29
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952392555 Original CRISPR GGGTGGACATGCGTGTGCTG AGG Exonic
900116869 1:1032813-1032835 GGGTGGCCAGGGGTGTGCGGGGG + Intronic
900238885 1:1605445-1605467 GGGTGGTCAGGCGTGGGGTGGGG + Intergenic
900380813 1:2382928-2382950 GGGTGGACATGCATGCGGAGGGG + Intronic
901230594 1:7639906-7639928 GGGTGACCATGCCTGTGTTGGGG + Intronic
902174463 1:14638857-14638879 GGGTGGAAATGGGTGGGATGGGG - Intronic
902329292 1:15723220-15723242 GGGTGCAACTGCGTGTGCTGAGG + Intronic
902439748 1:16421632-16421654 GGGTGGAACTGAGTGTCCTGGGG - Intronic
902561897 1:17282844-17282866 AGGTGAACATGCTGGTGCTGGGG + Exonic
907298618 1:53471256-53471278 GTGTGGACAAGGGTGTGCAGAGG + Intergenic
907311067 1:53539397-53539419 GGGTGTGCATTCATGTGCTGTGG - Intronic
907614808 1:55913003-55913025 GGGTGGCCATGGGTGGGCTGGGG - Intergenic
911579600 1:99619647-99619669 GTGTGGCCATGCTTGTGATGTGG - Intergenic
917691968 1:177478965-177478987 TGGTTGGCATGAGTGTGCTGTGG - Intergenic
917801746 1:178577561-178577583 AGGTGTACATGCATATGCTGTGG + Intergenic
918615684 1:186541245-186541267 GGGTAGACAGGCCTGTGCTCAGG - Intergenic
918636410 1:186780003-186780025 GGGTGATCATGAGTGTGATGTGG - Intergenic
919502196 1:198350886-198350908 GTGTGCACATGCGTGTGTTTTGG - Intergenic
920948727 1:210553399-210553421 GGGAGGACATTCTTCTGCTGAGG + Intronic
1064182752 10:13133718-13133740 GGATGGAGATGGGAGTGCTGTGG - Intronic
1068550275 10:58400251-58400273 GGGTGGACATGGGTGTGTGGTGG + Intergenic
1069560926 10:69428851-69428873 GGGGGGTCCTGCCTGTGCTGGGG + Intergenic
1069866329 10:71505614-71505636 GTGTGGAAATGTGTGTGCTGAGG + Intronic
1069955876 10:72051230-72051252 GGGTGGGCATGTGTGTCCTTTGG - Intergenic
1070676174 10:78413146-78413168 GCGTGCACATGTGTGTGTTGGGG + Intergenic
1070820505 10:79351391-79351413 GGGTGGGCTTGGGTGGGCTGAGG + Intronic
1074871664 10:117581790-117581812 GGATGGAAATGCGGTTGCTGGGG + Intergenic
1075064863 10:119282544-119282566 GGCAGGAGAGGCGTGTGCTGCGG + Intronic
1075395395 10:122123363-122123385 GGGTGGACAAGTGTGGCCTGTGG - Intronic
1075427148 10:122350706-122350728 GTGTGGTCATGTCTGTGCTGGGG - Intergenic
1075476926 10:122743979-122744001 GTGTGCACATGCACGTGCTGCGG - Intergenic
1075654870 10:124154554-124154576 GTGTGGGCATGCGTGTGTGGGGG - Intergenic
1076716034 10:132364315-132364337 GTGTGGTCATGGGTGTGGTGTGG - Intronic
1077059346 11:610928-610950 GAGGGGACATGTGTGTGATGCGG - Intronic
1078340519 11:10495328-10495350 GTGTGGAGATGCTTCTGCTGTGG + Intronic
1078653108 11:13214234-13214256 GTGTGCACATGCTTGTGTTGGGG - Intergenic
1080640807 11:34157313-34157335 GGGAAGGCATGTGTGTGCTGTGG + Intronic
1081554639 11:44147129-44147151 GGGTGTACAAGTATGTGCTGGGG - Intronic
1082817070 11:57515854-57515876 GGGTGGAAATGTAGGTGCTGGGG - Intergenic
1084043930 11:66558213-66558235 GGGTGGAGATTGGTGTGCAGGGG + Intronic
1084380293 11:68807622-68807644 GGCTGGACATGCAGTTGCTGTGG + Exonic
1084648313 11:70473687-70473709 TGGGGGACCTGCCTGTGCTGGGG + Intronic
1084648333 11:70473756-70473778 TGGGGGACCTGCCTGTGCTGGGG + Intronic
1088900228 11:114110096-114110118 AGGTGCAAATGTGTGTGCTGGGG + Intronic
1089254940 11:117189197-117189219 GGAAGGACAAGCGTGTTCTGCGG + Exonic
1090420689 11:126573059-126573081 GGGTGGAGATGTGTGGGCTAAGG + Intronic
1090806371 11:130204874-130204896 GGGTGGGCACGCGAGTGATGTGG + Intronic
1090975473 11:131676461-131676483 CTGTGTACATGCGTGTGCGGGGG + Intronic
1091277537 11:134362638-134362660 CGGTGGACAGGAATGTGCTGTGG + Intronic
1091342910 11:134833060-134833082 GGGAGGCCATGCATGTGCTGAGG + Intergenic
1095362749 12:41363715-41363737 GGGTGGAGATGCATTTGCTCAGG + Intronic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1096079436 12:48823920-48823942 GGGTGGACAGGTGTGTGTTAAGG - Intronic
1100289336 12:93199094-93199116 GGGCGGGCATGGGTGGGCTGGGG - Intergenic
1100705569 12:97196833-97196855 GGGAGGAAATACGAGTGCTGGGG + Intergenic
1103724301 12:122990117-122990139 GGGTGGCCATGCAGGAGCTGAGG - Intronic
1103910771 12:124350835-124350857 GTGTGGACACGCGTGTGCATCGG - Intronic
1103961731 12:124613177-124613199 GGGTGTGGATACGTGTGCTGTGG - Intergenic
1104645945 12:130497242-130497264 GGGTGGACATGACTGTGGGGAGG + Intronic
1105580737 13:21693372-21693394 GGGTGGACATGGGGGTGCTGAGG + Intronic
1107571070 13:41658716-41658738 GGGTGGACATGGGAGTGATGTGG - Intronic
1112329417 13:98465359-98465381 GGGTGGAGCTCTGTGTGCTGGGG + Intronic
1113442633 13:110341048-110341070 GGGTGGGGAGGGGTGTGCTGGGG + Intronic
1113493033 13:110706816-110706838 GGGTGCAGATGTGTGTGCTGGGG - Intronic
1113789389 13:113019512-113019534 GGGTGGCCCTGGGTGTTCTGCGG + Intronic
1113957079 13:114104816-114104838 GGGTGAGCATGTGTGGGCTGGGG - Intronic
1114612752 14:24053045-24053067 GTGTGCACGCGCGTGTGCTGGGG - Intronic
1116215843 14:42016421-42016443 GGGTGGACATCCCTTTTCTGTGG + Intergenic
1119105503 14:71919593-71919615 GCCTGCACATGTGTGTGCTGGGG + Intergenic
1119260162 14:73233398-73233420 TGGTGGACATGTGTTTTCTGGGG + Intergenic
1120667402 14:87323002-87323024 GGGTGAGGATGGGTGTGCTGTGG - Intergenic
1121325318 14:93016358-93016380 GGTTGCACATGCCTGTGCTGAGG + Intronic
1121483247 14:94294332-94294354 AGGTGGACATGTGAGTCCTGGGG + Intergenic
1122810091 14:104283468-104283490 GGGTGGTCAGGCCAGTGCTGAGG + Intergenic
1122979783 14:105186310-105186332 GGGTGTACATGAGTGTGTGGGGG + Intergenic
1123055486 14:105567384-105567406 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055494 14:105567418-105567440 GGGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055509 14:105567485-105567507 GTGTGGACAGGTGTGTGGTGCGG + Intergenic
1123055543 14:105567637-105567659 GGGTGGACAGGTGTGTGGTATGG + Intergenic
1123055560 14:105567703-105567725 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055572 14:105567753-105567775 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055584 14:105567803-105567825 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055590 14:105567837-105567859 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055614 14:105567938-105567960 GGGTGGACAGGTGTGTGGTGTGG + Intergenic
1123079945 14:105687241-105687263 GGGTGGACAGGTGTGTGGGGTGG + Intergenic
1123079950 14:105687258-105687280 GGGTGGACAGGTGTGTGGGGTGG + Intergenic
1123079953 14:105687275-105687297 GGGTGGACAGGTGTGTGGTGTGG + Intergenic
1123127081 14:105954351-105954373 GGGTGCACATGCATCTGCTGGGG - Intergenic
1123407546 15:20030171-20030193 GGGTGCACATGCCTCTGCTGGGG - Intergenic
1123516874 15:21036827-21036849 GGGTGCACATGCCTCTGCTGGGG - Intergenic
1126480319 15:49111282-49111304 GGCTGGACATGCCTGTCCTTGGG - Intronic
1127501261 15:59556179-59556201 GGGGGCACATGTGTGTGCAGAGG + Intergenic
1127977579 15:64009523-64009545 AGGTGGAAATGAGTGTGTTGGGG - Intronic
1129775920 15:78236429-78236451 GGGTAGACATGAATTTGCTGGGG + Intronic
1130655264 15:85788219-85788241 GGCTGGGCCTGCGTGGGCTGCGG - Intronic
1132067256 15:98742406-98742428 GTGTGGAGATGCTTGTGGTGGGG + Intronic
1132809674 16:1791530-1791552 TGCTGGGCCTGCGTGTGCTGCGG - Exonic
1134408580 16:13983896-13983918 GGGTGGACATGCATTTTGTGGGG + Intergenic
1136067118 16:27766781-27766803 GGGTGGCCAGGCCTCTGCTGAGG + Intronic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1138345820 16:56319604-56319626 GGCTGGTCACGAGTGTGCTGGGG - Intronic
1139279189 16:65755133-65755155 GGAAGGACATGGGTGTTCTGAGG - Intergenic
1139803838 16:69546780-69546802 GGGTTGAAATGTTTGTGCTGGGG - Intergenic
1141174955 16:81712771-81712793 GGCAGGACATGCCTGGGCTGAGG - Intergenic
1141757314 16:85999961-85999983 GGCTGGCCATGCCTGTGCTTGGG - Intergenic
1141877268 16:86834490-86834512 GGGTGGACAGGAACGTGCTGTGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1143269551 17:5665649-5665671 GGGGGGGCCTGCATGTGCTGAGG - Intergenic
1143369298 17:6428490-6428512 GGGTAGACCCCCGTGTGCTGTGG + Exonic
1143721867 17:8818094-8818116 GGGAGGTCATGAGTTTGCTGTGG + Intronic
1144094389 17:11886726-11886748 GAGTAGACATGCGTCTGCTTAGG - Intronic
1144960861 17:19043183-19043205 GGGTGGAGATGGGGGTGCAGAGG - Intronic
1144974299 17:19131341-19131363 GGGTGGAGATGGGGGTGCAGAGG + Intronic
1145250546 17:21294688-21294710 GGGTGGACAGGGGTGGTCTGGGG + Intronic
1146674855 17:34766221-34766243 GACTGGAGATGGGTGTGCTGTGG + Intergenic
1151555262 17:74843292-74843314 GGGTGGGCAGGCATGGGCTGGGG + Exonic
1152127245 17:78454597-78454619 CGGTGGACATGCGGTCGCTGGGG + Exonic
1152420989 17:80193183-80193205 GGGTGGACATGAGTTTCCAGGGG + Intronic
1156477210 18:37413258-37413280 GGGTGGACATGTGTGTTTTAAGG + Intronic
1157957338 18:52113095-52113117 GTCTGGACATGTGTGTGCTCAGG + Intergenic
1158396117 18:57079468-57079490 GGGTGGAGATCAGAGTGCTGGGG - Intergenic
1159736514 18:72105628-72105650 GGGAGGCCATGCCTGTGTTGGGG + Intergenic
1159984878 18:74830234-74830256 GGGTGTACATTAGTGTGCTAGGG - Intronic
1160412979 18:78687617-78687639 GGGTGCACCTGTGTGTGGTGGGG - Intergenic
1160490949 18:79336203-79336225 GGGTGCACATGGCGGTGCTGGGG - Intronic
1161505956 19:4643548-4643570 GGGTGGTCCTGAGGGTGCTGGGG + Intronic
1164510372 19:28891588-28891610 GGGTGGAGATAAGTGAGCTGTGG + Intergenic
1164600971 19:29562947-29562969 TGGTGGAGATGAGTGGGCTGGGG - Intronic
1165142772 19:33712370-33712392 GGGTGGACAAGCGGGGGCTGTGG + Intronic
1165901332 19:39170640-39170662 GGGTGGAGATGGGTGTGCCTGGG + Intronic
1167376962 19:49117577-49117599 GGGCGGACATTAGTGGGCTGTGG + Intronic
1168309582 19:55453623-55453645 GGGTGGACAGCTCTGTGCTGGGG + Intronic
925621455 2:5797408-5797430 GGGGGGACCTACCTGTGCTGAGG + Intergenic
926152672 2:10433739-10433761 GTGTGGCATTGCGTGTGCTGTGG + Intergenic
928838282 2:35574912-35574934 GGGTGCACATGGGTGGGCAGTGG + Intergenic
932572441 2:72945200-72945222 GGGTGGACACGGGGGTGCAGGGG - Intronic
933032396 2:77346460-77346482 GTGTACACATGTGTGTGCTGGGG + Intronic
933278059 2:80303742-80303764 GGGTGGTCTTGTGTCTGCTGGGG - Exonic
935068454 2:99673351-99673373 GGGGGGACCTGGGTGGGCTGGGG - Intronic
935671383 2:105559836-105559858 GGGTTCACATTGGTGTGCTGAGG + Intergenic
935842978 2:107133628-107133650 GTGTGTACATGTGTGTGTTGGGG + Intergenic
944104000 2:196059781-196059803 GGGTGGACAAACATTTGCTGAGG - Intronic
948809582 2:240467776-240467798 GGGTGGACTTGCCTGTGTTGGGG - Exonic
948920470 2:241063844-241063866 GGGTGGAGGTGAGGGTGCTGGGG + Intronic
1168800747 20:642247-642269 GGGTGGAGTTGCCTGTGGTGGGG + Intergenic
1168967645 20:1908690-1908712 ATGTGAACATGAGTGTGCTGAGG - Intronic
1170709847 20:18780784-18780806 GTGTGTATATGCGTGTGCAGAGG - Intergenic
1174452561 20:50629086-50629108 GGGAGGACACACATGTGCTGAGG + Intronic
1175218701 20:57404905-57404927 GGGTGGACCTGGGTGTGCAGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776399 20:61656456-61656478 GGGTGGACAGGTGCGTGTTGGGG + Intronic
1176108636 20:63401151-63401173 GGGTGGAGTTGAGTGTGCTCTGG - Intergenic
1176241251 20:64076877-64076899 GGGTGGGCATGGGTGGGCGGAGG + Exonic
1180710296 22:17835028-17835050 GTGAGGACAGGCCTGTGCTGAGG - Intronic
1181064583 22:20299464-20299486 GGGTGGACCGGCGTCTGCTGAGG + Intergenic
1184815472 22:46865657-46865679 CTGTGGACATGCCTGTGCAGGGG - Intronic
949887050 3:8703955-8703977 TGGTGGGCATGTGAGTGCTGAGG - Intronic
949976782 3:9468019-9468041 GGGGAGACATTAGTGTGCTGGGG - Intronic
950029768 3:9844538-9844560 GGTTGGACAATCGTGAGCTGGGG - Intronic
950633538 3:14299495-14299517 AGGGGGACATCCGTGTGCAGAGG - Intergenic
950907243 3:16550525-16550547 GGGTGGACTTGCGTGCCGTGAGG - Intergenic
952392555 3:32892847-32892869 GGGTGGACATGCGTGTGCTGAGG + Exonic
952834550 3:37592003-37592025 GGGTGGATAGGGGTGGGCTGAGG + Intronic
953246177 3:41195802-41195824 GTGTGCACGTGCGTGTGTTGCGG + Intronic
954132169 3:48566453-48566475 GGGTGGGCCTGGGTGGGCTGGGG - Intronic
954714116 3:52518659-52518681 TGGTGGCCCTGCGTGGGCTGAGG + Intronic
956176101 3:66474677-66474699 GAGGGGACAGGCGTGTGGTGGGG - Intronic
956726756 3:72162872-72162894 GGCTGGAGCTGCCTGTGCTGGGG - Intergenic
957375592 3:79353583-79353605 GTGTGGACATGGAGGTGCTGGGG + Intronic
959158991 3:102700951-102700973 GTGTGCACATGTGTGTGATGGGG - Intergenic
959530800 3:107431737-107431759 GGGCGGACCTGCGTGGGCTTCGG - Intergenic
960052903 3:113254624-113254646 GGGTGTGCATGCGTGTGCACCGG - Intronic
961237245 3:125377529-125377551 GGTTGGACAGGCATTTGCTGGGG + Intergenic
968490698 4:889192-889214 GGGTAGACCTGCCAGTGCTGAGG - Intronic
969293073 4:6252930-6252952 GGGCGGGCATGCGTGGGCTTAGG - Intergenic
969713059 4:8855456-8855478 GGGTGGACCTGAGACTGCTGGGG + Intronic
971372669 4:26030764-26030786 GGGTGGACTGAGGTGTGCTGGGG - Intergenic
975350802 4:73343711-73343733 GGGTGGAGAAGGGTGTGGTGTGG + Intergenic
979208966 4:118077291-118077313 GGGTGCACATGCGTCAGTTGGGG + Intronic
981952164 4:150422784-150422806 TGGTAGACCTGCATGTGCTGCGG + Intronic
985152230 4:186959318-186959340 GAGGCGACATGCGAGTGCTGAGG + Intergenic
985154642 4:186973367-186973389 CAGGCGACATGCGTGTGCTGAGG + Intergenic
985539078 5:479473-479495 GTGGGCACCTGCGTGTGCTGGGG + Intronic
985638011 5:1049374-1049396 GGGTGCACTGGCGGGTGCTGGGG - Intergenic
986452624 5:7881384-7881406 GGGGGTACAGGCATGTGCTGTGG + Intronic
988846741 5:35135323-35135345 AGTGGGACATGCGTGTGCTGGGG - Intronic
990476410 5:56165345-56165367 TTGTGGACCTGAGTGTGCTGAGG + Intronic
990869868 5:60419834-60419856 AGGTGGACATTCGTGGGCAGAGG - Intronic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
1001137980 5:169118316-169118338 TGGAGGACATGTGTGTGCTGGGG + Intronic
1001431143 5:171663224-171663246 GGGAGGATATGCGTGTGTTGGGG - Intergenic
1001709915 5:173770013-173770035 GGGAGGAGATGCTTGTGTTGGGG - Intergenic
1002347474 5:178557908-178557930 GCATGGACAGGGGTGTGCTGAGG + Intronic
1002394178 5:178940673-178940695 GGGCGGGCCAGCGTGTGCTGGGG - Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003154381 6:3578763-3578785 GGGTGGACATGCTGCTGCCGGGG + Intergenic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004171673 6:13300097-13300119 TGGTGGCCCTGCGTCTGCTGTGG + Intronic
1005926413 6:30449213-30449235 GGATGAAAATGTGTGTGCTGTGG + Intergenic
1005928136 6:30461785-30461807 GGATGAAAATGTGTGTGCTGGGG + Intergenic
1007616246 6:43181228-43181250 GGGAGGACATGCGTGTGTCAGGG + Exonic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1012958384 6:105595260-105595282 GGGTGGTGATGTGTGTGGTGAGG + Intergenic
1016280243 6:142408875-142408897 GGCTGGAAATGAGTGTGCTGAGG + Intronic
1017239676 6:152153339-152153361 GGATGGACATGGGTGTGCTGGGG - Intronic
1017722406 6:157253133-157253155 GCATGGACAGCCGTGTGCTGTGG + Intergenic
1019190930 6:170250241-170250263 GGGTGGACATGCGGGGGTTAGGG - Intergenic
1019223615 6:170493591-170493613 TGGTGGACATGTGAGTACTGAGG + Intergenic
1019409289 7:899642-899664 TGGAGGACAGGCGTGTGCGGAGG - Intronic
1021765484 7:23944071-23944093 GGCTGGACAGGCTTGTGCTCAGG - Intergenic
1023177648 7:37448841-37448863 GAGTGTAAGTGCGTGTGCTGGGG - Exonic
1026819361 7:73536645-73536667 GTGTGCAGATGTGTGTGCTGAGG + Exonic
1028582695 7:92423623-92423645 AGGTGTACATGTGTGTGGTGTGG + Intergenic
1031669463 7:124525134-124525156 GGGTGCACACGTGTTTGCTGTGG + Intergenic
1032198784 7:129804910-129804932 GGGTGGACAGGTCTGTTCTGAGG + Intergenic
1032515138 7:132501307-132501329 GTGTGCACATGGGTGTGCTATGG + Intronic
1032781356 7:135167500-135167522 GGGAGGGCATGCGTGTGTTAGGG - Intronic
1033513838 7:142086782-142086804 ATGTGGACATGCCTGTACTGTGG + Intronic
1035618714 8:1022158-1022180 GGGTGGACAGTCCTGTGCTGAGG + Intergenic
1036800299 8:11786112-11786134 TGGTAGACCTGTGTGTGCTGCGG - Exonic
1036907631 8:12720449-12720471 GGGCGGCCATGGGTGGGCTGGGG - Intergenic
1038488339 8:27951965-27951987 GGGTGGACATGAGTTTGCAGGGG - Intronic
1039791446 8:40879094-40879116 AGGTAGACATGGGTGTGCTGTGG - Intronic
1040279595 8:46032320-46032342 GGGGTGACAGGCGTGGGCTGCGG - Intergenic
1040419311 8:47224296-47224318 GGGGGCACATGAGTGTGCTCTGG - Intergenic
1041804648 8:61836781-61836803 GGCTGGGCAGGCTTGTGCTGAGG + Intergenic
1042625926 8:70756898-70756920 GGGTGGACATCCCTGTCTTGTGG + Intronic
1045265185 8:100612935-100612957 GGGTGGACAGGTGTGAGCAGGGG - Intronic
1045735754 8:105294912-105294934 GGGTAGACTTGGGTATGCTGTGG + Intronic
1047870506 8:129077132-129077154 GTGTGGACATGTGTGTGTTGGGG + Intergenic
1048291127 8:133182576-133182598 GAGTGGAAAAGTGTGTGCTGTGG - Intergenic
1049315726 8:141966259-141966281 GTGTGCACATGTGTGTGCTCTGG - Intergenic
1050283811 9:4080131-4080153 GGGTTGAAAACCGTGTGCTGTGG + Intronic
1055839039 9:80480511-80480533 GTGTGTACATGTGTGTGGTGAGG + Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059053335 9:110952726-110952748 GGGTGGCAATGGCTGTGCTGTGG - Intronic
1059277310 9:113107705-113107727 GGGTGGACAGGGGTGGCCTGGGG - Intergenic
1059278941 9:113116846-113116868 GGGTGGACAGGGGTGGCCTGGGG + Intergenic
1059423138 9:114205284-114205306 GGGTGGACTGGAGTGGGCTGGGG - Intronic
1059433462 9:114263406-114263428 GGGAGGACAGGAGTGTCCTGTGG - Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1061662182 9:132137529-132137551 GGGAGAACAGGCTTGTGCTGGGG + Intergenic
1062195313 9:135269911-135269933 ATGTGGGCATGTGTGTGCTGTGG - Intergenic
1194213772 X:91102075-91102097 GGTTGGACATGTGTATGTTGAGG - Intergenic
1197263958 X:124346792-124346814 CGGTGGACATGGGCCTGCTGAGG + Intronic
1197894180 X:131293095-131293117 GGGTGGGAATGGGTGTGTTGTGG + Intronic
1200182640 X:154160056-154160078 GGGTGGAGCTGCTTCTGCTGCGG - Intergenic
1200188294 X:154197170-154197192 GGGTGGAGCTGCTTCTGCTGCGG - Intergenic
1200193944 X:154234310-154234332 GGGTGGAGCTGCTTCTGCTGCGG - Intergenic
1200199699 X:154272114-154272136 GGGTGGAGCTGCTTCTGCTGCGG - Intronic
1201554689 Y:15255873-15255895 TGGTGGACATGGAGGTGCTGTGG - Intergenic