ID: 952392623

View in Genome Browser
Species Human (GRCh38)
Location 3:32893248-32893270
Sequence GACATTACATCCTACATTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952392623_952392626 22 Left 952392623 3:32893248-32893270 CCTGAAATGTAGGATGTAATGTC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 952392626 3:32893293-32893315 TACCAAAGAATGAAAATTTAAGG 0: 1
1: 0
2: 1
3: 59
4: 590
952392623_952392624 -1 Left 952392623 3:32893248-32893270 CCTGAAATGTAGGATGTAATGTC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 952392624 3:32893270-32893292 CTTTTCTTAAACCTGTAACTCGG 0: 1
1: 0
2: 1
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952392623 Original CRISPR GACATTACATCCTACATTTC AGG (reversed) Exonic
901579861 1:10233213-10233235 GATATTGCAGCCCACATTTCAGG + Intronic
901928273 1:12580732-12580754 GACTTTAAATCCTGAATTTCTGG - Intronic
902476015 1:16687995-16688017 GTCATTACATACTACTTGTCTGG + Intergenic
905190314 1:36228663-36228685 GACATTACATCCTTAATCTATGG + Intronic
906839856 1:49125308-49125330 AACATTAAACCCTACATCTCAGG - Intronic
909967002 1:81925853-81925875 GACATTTCATCAAACATCTCAGG + Intronic
913289275 1:117257643-117257665 CACATTGTATACTACATTTCAGG + Intergenic
915754963 1:158250551-158250573 GACTTTCCATCCTACAACTCTGG + Intergenic
916022447 1:160804929-160804951 GACATTACAACTGACATTACAGG - Intronic
920708181 1:208270332-208270354 GAAATTTCATTCTACATTCCTGG - Intergenic
924415762 1:243854827-243854849 GACATTACATTTAATATTTCAGG + Intergenic
1069230233 10:65999693-65999715 TTCATTACATAGTACATTTCAGG - Intronic
1069323598 10:67204139-67204161 GACATTTCATAGTACATATCTGG - Intronic
1078344613 11:10535736-10535758 AATATTATATCCTACTTTTCAGG - Intronic
1081509744 11:43758130-43758152 AACATTAAATCCTAAATCTCTGG + Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1086952665 11:92907077-92907099 GACAGTACATTGTACCTTTCAGG + Intergenic
1089474827 11:118750868-118750890 AACAGTACATCCCAGATTTCTGG + Exonic
1093837267 12:23849191-23849213 GACATTTCATCCTTGACTTCTGG + Intronic
1094552610 12:31466812-31466834 GACATTAATTCTTAAATTTCAGG + Intronic
1095698690 12:45168540-45168562 TAGATTACTGCCTACATTTCTGG + Intergenic
1097434069 12:59539262-59539284 GACATTACTACCAACATCTCAGG + Intergenic
1098996745 12:77129212-77129234 GAAATTACTTCTTACAGTTCTGG - Intergenic
1099550265 12:84034452-84034474 GACTTTCCATTCTACCTTTCTGG - Intergenic
1099628969 12:85115612-85115634 AATATTACATCCAATATTTCAGG - Intronic
1099995765 12:89776840-89776862 CACTTATCATCCTACATTTCTGG - Intergenic
1102786188 12:115606869-115606891 GTCCTGAGATCCTACATTTCTGG - Intergenic
1104320745 12:127748740-127748762 GTGCTTACATGCTACATTTCTGG + Intergenic
1111464712 13:88593907-88593929 GAAATTACATCTTACATGGCAGG + Intergenic
1111688903 13:91536379-91536401 GAAATAACAGCCTACATTCCTGG + Intronic
1111697184 13:91639836-91639858 GACAATAAAGCCTACTTTTCAGG - Intronic
1115052664 14:29083321-29083343 GGCATTACCTTCTAAATTTCAGG + Intergenic
1115105599 14:29757911-29757933 GACAGGACATCCTTCATATCTGG + Intronic
1118520638 14:66580505-66580527 GACATTACATCTTATATCACTGG + Intronic
1119753121 14:77094832-77094854 GCCCTTAAATCCTACATTTAGGG - Intergenic
1131782355 15:95873374-95873396 GTAATTACAACCTACATTTCAGG + Intergenic
1139034824 16:62931482-62931504 GTCATTAGCTCCTATATTTCAGG - Intergenic
1140622392 16:76751397-76751419 GACAGTACCTCCTAGATGTCCGG + Intergenic
1140702395 16:77593051-77593073 GACATAGCATTCTAAATTTCTGG - Intergenic
1147307126 17:39571945-39571967 GGCATTAATACCTACATTTCAGG - Intergenic
1151067236 17:71164661-71164683 TACATTTCATCCTCCATTTGAGG - Intergenic
1155028671 18:21965097-21965119 GACCTGACATTCTGCATTTCTGG + Intergenic
1155542686 18:26884462-26884484 GACATTACTTTCAACATTGCAGG - Intergenic
1159525079 18:69578542-69578564 GACATTATTTCCATCATTTCTGG + Intronic
1159714914 18:71809704-71809726 AAAATAACATCCCACATTTCTGG + Intergenic
1159826859 18:73223558-73223580 AAAATTACATGCTACATTGCTGG + Intronic
1161776677 19:6266755-6266777 GAGATTACTTCAGACATTTCTGG - Intronic
1168485276 19:56756441-56756463 AACATTACTTCCTACATTTCAGG - Intergenic
1202710031 1_KI270714v1_random:13848-13870 GTCATTACATACTACTTGTCTGG + Intergenic
925217233 2:2107546-2107568 GGCATTAGCTCCTACCTTTCGGG - Intronic
927027512 2:19084539-19084561 AAAATTACATCCAACATTTTTGG - Intergenic
927191974 2:20523289-20523311 GACACTACATCACACACTTCAGG - Intergenic
929151460 2:38752373-38752395 GACATTACATCGTAAATTCTTGG + Intronic
932078234 2:68686584-68686606 GACATTTAAACCAACATTTCTGG - Intronic
933425301 2:82103686-82103708 TATATGACATCCTACTTTTCAGG + Intergenic
934506444 2:94898226-94898248 GATATTACTTCCTATATTACAGG - Intergenic
934540998 2:95175000-95175022 AGCATTAAATCCCACATTTCTGG - Intronic
937582957 2:123511625-123511647 GAAATTACTTCTTACATTTGTGG - Intergenic
939327127 2:140707167-140707189 GCCATTTCTTCCTACTTTTCTGG + Intronic
943290469 2:186064717-186064739 GCCAGTACATCCTACATGGCTGG - Intergenic
943538036 2:189177028-189177050 CAGATTACATTTTACATTTCTGG + Intronic
945679933 2:212901945-212901967 GACCTTCCATCCTACCTATCTGG + Intergenic
946059612 2:216930461-216930483 GACAGTACATAGCACATTTCAGG + Intergenic
946505138 2:220291556-220291578 GCTATTACAAGCTACATTTCTGG + Intergenic
1169694524 20:8372146-8372168 TACTTTACATACTTCATTTCTGG + Intronic
1178013562 21:28316681-28316703 GTCTTTACAGTCTACATTTCTGG + Intergenic
1178043803 21:28671508-28671530 GACATGAAATCAAACATTTCTGG + Intergenic
1182626063 22:31647124-31647146 GGCATTACATGCTACATTATAGG - Intronic
950954590 3:17038210-17038232 ACCAGTACCTCCTACATTTCTGG - Intronic
951581010 3:24162511-24162533 GACATTACATTCTGCATTTTAGG + Intronic
952186835 3:30978653-30978675 GCCATCACATCCTACATGGCTGG - Intergenic
952392623 3:32893248-32893270 GACATTACATCCTACATTTCAGG - Exonic
958729300 3:97944076-97944098 GACACTTCATCCTAGATTTAAGG + Exonic
962324400 3:134421593-134421615 TACAAAACATCCTACCTTTCTGG + Intergenic
963403192 3:144827788-144827810 GACTTGACAGTCTACATTTCAGG + Intergenic
964165665 3:153702132-153702154 GACATTACAAATTACATTTGGGG + Intergenic
973040090 4:45458637-45458659 GATATTATGACCTACATTTCTGG - Intergenic
974195416 4:58568133-58568155 GTCATGAAATCCTACATTTTAGG - Intergenic
980521324 4:133939376-133939398 GACATGACATCCTACTTCTATGG - Intergenic
981649080 4:147035764-147035786 GACATTCCATTATATATTTCTGG - Intergenic
983904055 4:173166996-173167018 TACAATCCATTCTACATTTCCGG + Intergenic
984526195 4:180861612-180861634 AATATTCCCTCCTACATTTCTGG - Intergenic
984615561 4:181893227-181893249 GACATTAATTCTTACATTTATGG - Intergenic
984841684 4:184074237-184074259 GACATTATTTCTTACATTTTTGG - Intergenic
986995942 5:13607303-13607325 GATATTACATCATACCTGTCAGG + Intergenic
987758076 5:22122981-22123003 GACAATTCATCCTAAATATCTGG + Intronic
990121065 5:52452089-52452111 TACATTACAACCTAATTTTCAGG + Intergenic
990792846 5:59501298-59501320 GAGATTACATAATACATTTGGGG + Intronic
994394228 5:99215230-99215252 GATATTACTTCCTATATTGCAGG - Intergenic
994396037 5:99226496-99226518 GATATTACATTCTATATTGCAGG - Intergenic
995148841 5:108818468-108818490 GAAATCACATTTTACATTTCAGG + Intronic
996165784 5:120221057-120221079 GACATTCCATTCTTCTTTTCTGG + Intergenic
1001464723 5:171953294-171953316 GACACTAAAACCTACATTTTTGG - Intronic
1007862144 6:44921731-44921753 GACGTTAGAGACTACATTTCTGG - Intronic
1009364817 6:62849822-62849844 GACATTACTTTCAACATCTCAGG + Intergenic
1009365589 6:62855499-62855521 GACATTACTTCCAATATTGCAGG + Intergenic
1009832788 6:68960351-68960373 CACAATAATTCCTACATTTCTGG - Intronic
1010088391 6:71949254-71949276 GACATCACCTCCTAAATTCCTGG + Intronic
1010862353 6:80928104-80928126 GGCCTCGCATCCTACATTTCTGG + Intergenic
1013132675 6:107249527-107249549 GACATAACTTTCTGCATTTCTGG + Intronic
1016190495 6:141259971-141259993 GACATTACTTCATTCTTTTCTGG - Intergenic
1021079070 7:16341693-16341715 GACATAATATCCCACATTTGAGG - Intronic
1026568578 7:71510247-71510269 GCCATTACATTTTACATTTCAGG - Intronic
1027448371 7:78300994-78301016 AACATTAATTCCTACATTACAGG - Intronic
1029233548 7:99092070-99092092 GATAATACTTCCTACTTTTCAGG + Intronic
1031670910 7:124544239-124544261 GATATTACTTCCTACCTTTTGGG + Intergenic
1032669531 7:134070291-134070313 TTCATTACACCCTCCATTTCAGG - Intergenic
1034697386 7:153065948-153065970 GAGAGTACAACCTACAATTCAGG - Intergenic
1034717835 7:153260129-153260151 TACATTACTTCCTACATTGCTGG + Intergenic
1041987624 8:63944485-63944507 GACATTGTATTTTACATTTCTGG + Intergenic
1047339661 8:123968670-123968692 GACAATACATACAACATTTCAGG - Intronic
1051842135 9:21410584-21410606 CACATGAGATCCTCCATTTCTGG - Intronic
1056525815 9:87442007-87442029 GACATTACCTCCTCCTCTTCTGG - Intergenic
1056785565 9:89590448-89590470 GACATAACAGCCTATATTTCTGG - Intergenic
1057553021 9:96065861-96065883 GAATTTACTTCTTACATTTCTGG - Intergenic
1057935068 9:99230928-99230950 AACATTTCATCCGAGATTTCTGG - Intergenic
1058518851 9:105800202-105800224 GACATTACTTCCAATATTGCAGG - Intergenic
1058521529 9:105817918-105817940 GACATTACGTCCAATATTGCAGG + Intergenic
1059400161 9:114064273-114064295 GACATTACATCTTTAATTTCTGG - Intronic
1186977995 X:14928766-14928788 GACATGACTACCTACATTCCTGG - Intergenic
1187230571 X:17418396-17418418 GTAATTTCCTCCTACATTTCTGG + Intronic
1187284048 X:17885914-17885936 GAAATTAAACCCTTCATTTCAGG + Intergenic
1192000004 X:67139695-67139717 GGCATTACAGTCCACATTTCAGG + Intergenic
1194850336 X:98860942-98860964 GACCATACATCCAATATTTCTGG - Intergenic
1198008872 X:132529803-132529825 GACATTACAACCTACACAACAGG - Intergenic
1201998011 Y:20116456-20116478 GACATAACATCTTTCAGTTCTGG - Intergenic