ID: 952393155

View in Genome Browser
Species Human (GRCh38)
Location 3:32898179-32898201
Sequence CTGTCTGAGTAGAGGTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 87}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952393150_952393155 9 Left 952393150 3:32898147-32898169 CCTTTCTCTGGAAGGTCTTGGCC 0: 1
1: 1
2: 0
3: 16
4: 215
Right 952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
952393140_952393155 24 Left 952393140 3:32898132-32898154 CCACCACCCTGTCCCCCTTTCTC 0: 1
1: 2
2: 10
3: 148
4: 1312
Right 952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
952393149_952393155 10 Left 952393149 3:32898146-32898168 CCCTTTCTCTGGAAGGTCTTGGC 0: 1
1: 0
2: 4
3: 25
4: 257
Right 952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
952393144_952393155 17 Left 952393144 3:32898139-32898161 CCTGTCCCCCTTTCTCTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 300
Right 952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
952393147_952393155 11 Left 952393147 3:32898145-32898167 CCCCTTTCTCTGGAAGGTCTTGG 0: 1
1: 0
2: 0
3: 18
4: 246
Right 952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
952393146_952393155 12 Left 952393146 3:32898144-32898166 CCCCCTTTCTCTGGAAGGTCTTG 0: 1
1: 1
2: 2
3: 22
4: 249
Right 952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
952393143_952393155 18 Left 952393143 3:32898138-32898160 CCCTGTCCCCCTTTCTCTGGAAG 0: 1
1: 0
2: 3
3: 27
4: 368
Right 952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
952393141_952393155 21 Left 952393141 3:32898135-32898157 CCACCCTGTCCCCCTTTCTCTGG 0: 1
1: 0
2: 8
3: 77
4: 761
Right 952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952393155 Original CRISPR CTGTCTGAGTAGAGGTACCT GGG Intergenic
903080728 1:20810090-20810112 CTTTCTGAGTAGCTGTAGCTGGG + Intronic
904486444 1:30827662-30827684 TTCTCTGAGTAGAGGGTCCTCGG + Intergenic
905027278 1:34859505-34859527 CTGTCTGCGGAGGGCTACCTGGG + Intronic
908262857 1:62352376-62352398 CTACCTGAGAAGAGGTCCCTAGG - Intergenic
911033918 1:93518634-93518656 CTTGTTGAATAGAGGTACCTGGG + Intronic
912553968 1:110502767-110502789 CTGCCTGGGTAAAGTTACCTGGG + Intergenic
915242799 1:154535738-154535760 CTTTCTGAGAACAGGTACATGGG - Intronic
918996357 1:191765374-191765396 CTGTCTGAAGAAAAGTACCTGGG - Intergenic
923993618 1:239467270-239467292 CTGAATGAGTAGAGGTCGCTTGG + Intronic
1067523134 10:47022781-47022803 CTGTCTGAGTGCAGGTGCCCTGG + Intergenic
1074085734 10:110207947-110207969 ATGTCTGAGAAGGGGCACCTGGG - Exonic
1076194916 10:128510929-128510951 CTGTCTGACAAGAGGCAGCTGGG - Intergenic
1077303934 11:1859522-1859544 TTTTCTGAGGGGAGGTACCTGGG - Intronic
1084287025 11:68138643-68138665 TTGTCTGAGAAGAGGCACTTGGG + Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1099584983 12:84504469-84504491 CTGTCTTAGTAGCTGTGCCTTGG + Intergenic
1099843047 12:87990992-87991014 TTGCCAGAGTAGAGGTATCTTGG + Intronic
1101825277 12:108215614-108215636 CTCTCTGATTATAGGTAGCTAGG + Intronic
1103407801 12:120687704-120687726 CTGTATGACTCTAGGTACCTTGG - Intronic
1107490523 13:40876766-40876788 CTTTCTGGGCTGAGGTACCTTGG + Intergenic
1107892250 13:44924533-44924555 CTATCTGAGTAGAGGTTGCAGGG - Intergenic
1110507267 13:76301513-76301535 CTGTCTGAACATAGGTACATGGG - Intergenic
1110867740 13:80416604-80416626 CTCTCTGAGGAGAAGTACTTAGG - Intergenic
1116139251 14:40968567-40968589 CTGTCTGAGGAGGGGTATGTAGG + Intergenic
1117053886 14:51890442-51890464 ATTTCTGAGTAGAGTTACATTGG - Intronic
1118152499 14:63204745-63204767 CTGTCTGACTTTGGGTACCTTGG - Exonic
1118363411 14:65074642-65074664 CAGTCTGAGTAGAGCTAACTCGG + Intronic
1123210866 14:106759345-106759367 CAGTCTGGTTGGAGGTACCTGGG + Intergenic
1124168074 15:27347187-27347209 CTATGTGAGGAGAAGTACCTAGG - Intronic
1127032634 15:54880779-54880801 CTGTCTTAGTAGAGGTAAACCGG - Intergenic
1134250352 16:12569670-12569692 CTCTCAGAGTACAGGGACCTTGG + Exonic
1135150297 16:19999484-19999506 GTGTCTGAGTAGGGCTTCCTTGG + Intergenic
1138914058 16:61441077-61441099 TTGTCTGAGTAGGGGTATTTAGG + Intergenic
1139179974 16:64735656-64735678 CTGTGTGACTAGAGCTACCTAGG + Intergenic
1142693298 17:1619969-1619991 CTGCCTGAGTAAAGGCACCAGGG + Intronic
1144417644 17:15066915-15066937 CTGTGTGCGTAGAGCTTCCTGGG + Intergenic
1148902007 17:50885283-50885305 CTCTCTGAGCAGAGGTTGCTGGG + Intergenic
1150054508 17:62001082-62001104 GTTTCTAAGTAGAAGTACCTTGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1155075484 18:22350230-22350252 CTGTCTGAGTAGAGGGTTCCAGG - Intergenic
1158102997 18:53851904-53851926 CTTTCTATGAAGAGGTACCTAGG + Intergenic
1164526797 19:29018938-29018960 GTGTCTGAGGAAAGGTGCCTGGG + Intergenic
1164576611 19:29408951-29408973 CTGGCTGTGTAGAGGTTCCCAGG + Intergenic
1165406495 19:35634074-35634096 CTGTCTGTGTGGAAGTTCCTGGG - Intronic
1166684813 19:44789999-44790021 CCATCTGGGTAGAGGTAGCTGGG - Exonic
1167721760 19:51184581-51184603 CTGTCTGAGTTCAGGGACCCAGG + Intergenic
925377777 2:3400516-3400538 CTGACTGAGGAAAGGCACCTGGG - Intronic
925962273 2:9028705-9028727 TTGCCTGAGAAGAGGTAGCTGGG + Intergenic
928376260 2:30777117-30777139 CTGCCTAAGAGGAGGTACCTGGG - Intronic
929112310 2:38415169-38415191 CTGGCTGAGCTCAGGTACCTTGG + Intergenic
931911572 2:66905411-66905433 CTCTGTCAGTAGAGGCACCTGGG + Intergenic
934638142 2:96009728-96009750 CTGTCTAAGGAAAGGTATCTGGG - Intergenic
942074842 2:172348020-172348042 CTCTCTGAGTAGAGGAAACTGGG - Intergenic
1168986587 20:2054252-2054274 GTGTCTGAGCATAGTTACCTGGG - Intergenic
1173330049 20:42068243-42068265 CTGTCTGAGGAAAGGCACCATGG + Intergenic
1174311472 20:49658727-49658749 CAGTCTGGGTAGTGGGACCTAGG - Intronic
1176303865 21:5113512-5113534 CTGGCTGAGGAGGGGTCCCTGGG - Intergenic
1179853165 21:44148438-44148460 CTGGCTGAGGAGGGGTCCCTGGG + Intergenic
1180670505 22:17548984-17549006 TTATCTGAGAAGAGGGACCTTGG - Exonic
1181835573 22:25605138-25605160 CTGTCTGTGAAGAGGTTCTTTGG + Intronic
1183679468 22:39319239-39319261 TTGTCTGGGTAGAAGGACCTTGG - Intronic
952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG + Intergenic
952577770 3:34795297-34795319 CTGCCTGAGAAGATGTTCCTGGG - Intergenic
964629549 3:158795328-158795350 GTGTCTGGGTAGAGGTATGTGGG - Intronic
969674509 4:8607525-8607547 CGCTCTGAGTAGAGGTTCCTAGG - Intronic
975554417 4:75646595-75646617 CTGCTTGAGTAAACGTACCTTGG - Intronic
976665706 4:87588503-87588525 CTGACTAAGGAGAGATACCTGGG + Intergenic
977381867 4:96285198-96285220 CTGTCTTAATTGAGGTACCTAGG + Intergenic
986702299 5:10422568-10422590 TTGTCTGGGTAGAGGAAGCTTGG - Intronic
987829989 5:23083851-23083873 CTGTGTTAGTTGGGGTACCTTGG + Intergenic
989198934 5:38743699-38743721 TTGTCTGAGCAGAGATAACTAGG - Intergenic
992386563 5:76290307-76290329 TTGGCAGAGTACAGGTACCTAGG - Intronic
999074076 5:148778295-148778317 CTCTCTTAGTAAAGCTACCTTGG - Intergenic
1000253295 5:159515101-159515123 GTGTCTGAGCTGAGGTGCCTGGG + Intergenic
1001068983 5:168567542-168567564 CTGTATGAAAAGAGGTGCCTTGG - Intronic
1001256607 5:170188151-170188173 CAGACTGAGAAGAGGTACCGCGG + Intergenic
1004011142 6:11688901-11688923 CTGTCTAAGGAAAGGTTCCTCGG + Intergenic
1005757584 6:28939012-28939034 CTTTCTGAGAAAAGGTACTTGGG + Intergenic
1006117693 6:31784106-31784128 CTGGCTGAGGAGAGGAAACTGGG - Intronic
1016515151 6:144884796-144884818 CTGCCTGAGTCGAGGTTCCTTGG - Intergenic
1024383882 7:48729199-48729221 CTCACTGAGTAGATGTACCTAGG + Intergenic
1033108991 7:138558433-138558455 CAGTCAGAGTAAAGTTACCTTGG + Intronic
1033964947 7:146963790-146963812 CTATCTGAGTAGAACTGCCTTGG + Intronic
1041468092 8:58178028-58178050 TTGTCTGACTTGAGGTCCCTAGG - Intronic
1048184113 8:132223424-132223446 CTGTCAGAGCAGGGGTAGCTTGG + Intronic
1051382555 9:16472991-16473013 CTGTCTGTCTAGATGTGCCTTGG - Intronic
1055134908 9:72817417-72817439 CTGTGTCAGTAGACGTTCCTCGG - Intronic
1057906047 9:98984250-98984272 CTGTCTCACTACTGGTACCTTGG + Intronic
1058661206 9:107271024-107271046 CTGTGTAAGTTCAGGTACCTGGG - Intergenic
1060224921 9:121784824-121784846 CTGTCTGAGTAGTGGCCACTGGG + Exonic
1060863382 9:126974853-126974875 CTCCCTCAGGAGAGGTACCTTGG - Intronic
1190978725 X:55434578-55434600 CAGTTTGTGGAGAGGTACCTGGG + Intergenic
1194909613 X:99624903-99624925 CTGTCTGAGGAGAAGTACCTAGG + Intergenic
1196685650 X:118508228-118508250 CTGGCTCTGCAGAGGTACCTGGG + Intronic
1197805982 X:130399069-130399091 CTCTCTCAGCAGAGGTGCCTAGG + Intergenic
1200232527 X:154451174-154451196 CTGTCTGAGCAGGGCTAGCTAGG - Intergenic