ID: 952396238

View in Genome Browser
Species Human (GRCh38)
Location 3:32922873-32922895
Sequence CCTGATTAGGAGGAATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952396229_952396238 20 Left 952396229 3:32922830-32922852 CCTTGGATGCATAGAAGAAATTA No data
Right 952396238 3:32922873-32922895 CCTGATTAGGAGGAATTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952396238 Original CRISPR CCTGATTAGGAGGAATTGTT GGG Intergenic
No off target data available for this crispr