ID: 952400770

View in Genome Browser
Species Human (GRCh38)
Location 3:32961296-32961318
Sequence CACCTGATCTCAGCTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952400770_952400778 8 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400778 3:32961327-32961349 GTGGGAAAGGGTGAAGTGCAGGG No data
952400770_952400774 -5 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400774 3:32961314-32961336 AGGTGAAACCTGTGTGGGAAAGG No data
952400770_952400780 21 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400780 3:32961340-32961362 AAGTGCAGGGTGGTAAGAGATGG No data
952400770_952400773 -10 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400773 3:32961309-32961331 AGATCAGGTGAAACCTGTGTGGG No data
952400770_952400779 11 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400779 3:32961330-32961352 GGAAAGGGTGAAGTGCAGGGTGG No data
952400770_952400781 27 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400781 3:32961346-32961368 AGGGTGGTAAGAGATGGAGCAGG No data
952400770_952400775 -4 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400775 3:32961315-32961337 GGTGAAACCTGTGTGGGAAAGGG No data
952400770_952400782 28 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG No data
952400770_952400777 7 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400777 3:32961326-32961348 TGTGGGAAAGGGTGAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952400770 Original CRISPR CACCTGATCTCAGCTGCTTT GGG (reversed) Intergenic
No off target data available for this crispr