ID: 952400776

View in Genome Browser
Species Human (GRCh38)
Location 3:32961322-32961344
Sequence CACTTCACCCTTTCCCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952400776_952400783 27 Left 952400776 3:32961322-32961344 CCTGTGTGGGAAAGGGTGAAGTG No data
Right 952400783 3:32961372-32961394 AGACGTCAGCAACACGCCAAAGG No data
952400776_952400781 1 Left 952400776 3:32961322-32961344 CCTGTGTGGGAAAGGGTGAAGTG No data
Right 952400781 3:32961346-32961368 AGGGTGGTAAGAGATGGAGCAGG No data
952400776_952400782 2 Left 952400776 3:32961322-32961344 CCTGTGTGGGAAAGGGTGAAGTG No data
Right 952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG No data
952400776_952400780 -5 Left 952400776 3:32961322-32961344 CCTGTGTGGGAAAGGGTGAAGTG No data
Right 952400780 3:32961340-32961362 AAGTGCAGGGTGGTAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952400776 Original CRISPR CACTTCACCCTTTCCCACAC AGG (reversed) Intergenic
No off target data available for this crispr