ID: 952400780

View in Genome Browser
Species Human (GRCh38)
Location 3:32961340-32961362
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952400776_952400780 -5 Left 952400776 3:32961322-32961344 CCTGTGTGGGAAAGGGTGAAGTG No data
Right 952400780 3:32961340-32961362 AAGTGCAGGGTGGTAAGAGATGG No data
952400771_952400780 20 Left 952400771 3:32961297-32961319 CCAAAGCAGCTGAGATCAGGTGA No data
Right 952400780 3:32961340-32961362 AAGTGCAGGGTGGTAAGAGATGG No data
952400770_952400780 21 Left 952400770 3:32961296-32961318 CCCAAAGCAGCTGAGATCAGGTG No data
Right 952400780 3:32961340-32961362 AAGTGCAGGGTGGTAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr