ID: 952400783

View in Genome Browser
Species Human (GRCh38)
Location 3:32961372-32961394
Sequence AGACGTCAGCAACACGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952400776_952400783 27 Left 952400776 3:32961322-32961344 CCTGTGTGGGAAAGGGTGAAGTG No data
Right 952400783 3:32961372-32961394 AGACGTCAGCAACACGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952400783 Original CRISPR AGACGTCAGCAACACGCCAA AGG Intergenic
No off target data available for this crispr