ID: 952406370

View in Genome Browser
Species Human (GRCh38)
Location 3:33008637-33008659
Sequence CTGGAGGCTGGCAACAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952406363_952406370 7 Left 952406363 3:33008607-33008629 CCAAGGACTGCTGGGCAAATCTG 0: 1
1: 0
2: 1
3: 9
4: 171
Right 952406370 3:33008637-33008659 CTGGAGGCTGGCAACAATGAGGG 0: 1
1: 0
2: 1
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952406370 Original CRISPR CTGGAGGCTGGCAACAATGA GGG Intronic
900707702 1:4090699-4090721 CAGGAGGCTGGCAAGGACGATGG + Intergenic
901310711 1:8267503-8267525 CTGGATGCTGGCAATGGTGATGG + Intergenic
902188124 1:14740785-14740807 TTGGGGGCTGGCAAGAAGGAGGG - Intronic
903447165 1:23429914-23429936 CTGCAGGTTGGCATCACTGAAGG - Exonic
903645976 1:24896819-24896841 CTGACGGCTGGCAGCAATGTGGG - Intergenic
904314980 1:29654086-29654108 CTGGGGGCCGGCAACAGTGGGGG + Intergenic
904678980 1:32215747-32215769 CTGGAGGCTGGCCATACTCACGG + Intronic
905875524 1:41429704-41429726 CTGGAGAATGGCTACAATAATGG - Intergenic
907607444 1:55832306-55832328 CGGGAGGCTGGAAACGCTGAAGG + Intergenic
908427228 1:64018916-64018938 CTGGAAGATGGTAACAATGGAGG - Intronic
909959819 1:81825871-81825893 CTAGAGGCTGGCAAGATGGATGG + Intronic
916191187 1:162179959-162179981 CTGGCTGCTGGCAAGAATGTAGG + Intronic
916742446 1:167658184-167658206 CTGGAGGCTGGACACAGGGAGGG - Intronic
916979088 1:170113772-170113794 CTGTAGGCTGGCAGCCAAGATGG - Intergenic
917616889 1:176755053-176755075 CTGGAGCCTTGCAACACTGATGG - Intronic
917837735 1:178954125-178954147 CTGTGGGCTGGAAGCAATGACGG - Intergenic
918406432 1:184215574-184215596 GTAAATGCTGGCAACAATGAGGG - Intergenic
920180669 1:204130069-204130091 CAGGAGGCTGGAAACAAAGCTGG + Intergenic
922246709 1:223806106-223806128 CTGGAGCTTGGCACCAATAACGG - Intronic
922579666 1:226687602-226687624 CTTGAGGCTGGCAAAACTGAGGG + Intronic
922664505 1:227456979-227457001 CTGGGTGCTGGGAATAATGAAGG - Intergenic
922739859 1:228008778-228008800 CAGGAGGCTGGCGACATTTATGG - Intronic
1062977581 10:1696829-1696851 GTGGAGGCTGGGACCAAGGAAGG - Intronic
1066504094 10:36024054-36024076 CTGGAGGCTGGCAGAGATGGAGG - Intergenic
1067047250 10:42991605-42991627 CTGGAGCCTGGGGACAGTGATGG + Intergenic
1067400620 10:45970622-45970644 CTGGATGCTGGCAATAGGGAAGG - Intergenic
1067539963 10:47144063-47144085 CTGGAGGACGGCAACAAGCAGGG + Intergenic
1067539996 10:47144229-47144251 CTGGATGGTGGCAACACAGAGGG - Intergenic
1067868964 10:49940179-49940201 CTGGATGCTGGCAATAGGGAAGG - Intronic
1069058244 10:63866849-63866871 CTGGGGCCTGGCAGTAATGATGG + Intergenic
1069577439 10:69540955-69540977 CTGGAGGCTGGCACCACCCAGGG - Intergenic
1070280536 10:75044936-75044958 ATGGAGGCTGGAGACAACGAAGG + Intronic
1071231228 10:83588545-83588567 ATGGAGCCTGCCAACACTGAGGG - Intergenic
1071256678 10:83877873-83877895 TTGGAGGCTGGCTACTATGTAGG - Intergenic
1071808509 10:89151757-89151779 CTGGAGGCTTACAAAAATTAGGG + Intergenic
1073467795 10:103704418-103704440 CTGGTGGCTGGCAGCACTGGGGG + Intronic
1074357748 10:112801022-112801044 CTGGAGGCTGAAAAGGATGAGGG + Intronic
1074544701 10:114393572-114393594 CTGGAGGCTGGGGACAGGGAGGG + Intronic
1075449365 10:122538729-122538751 CTGGAAGCTGGCAGCAAAGATGG + Intergenic
1076669363 10:132111237-132111259 GTGGAGGGAGGCAGCAATGACGG + Intronic
1076707486 10:132309596-132309618 CTGGAGAATGGCAACTTTGAGGG - Intronic
1077498702 11:2899128-2899150 CTGGAGGCTGGGACCTCTGAGGG - Intronic
1078713539 11:13817779-13817801 GTGCACGATGGCAACAATGATGG + Intergenic
1078917999 11:15798803-15798825 CAGGAAGCTGGCAATCATGATGG + Intergenic
1080799312 11:35594863-35594885 CTGGAGACTGTCACCAATGCAGG + Intergenic
1080877620 11:36290860-36290882 CAGGAGGCTGGGATCATTGAGGG - Intergenic
1086876049 11:92096967-92096989 CCGGAGGATGGGAATAATGATGG - Intergenic
1088211251 11:107459099-107459121 CTGGAGGCTGGATAAAATCAAGG + Intergenic
1088222691 11:107586650-107586672 CTGGAGGCTGCCATCAGTAAAGG + Intergenic
1089436450 11:118472867-118472889 CTGGAGGCTGGCTGCAGTGGTGG - Exonic
1092234108 12:6795385-6795407 CTGGAGGCAGCTAACAAAGATGG + Intronic
1092576287 12:9786929-9786951 CAGGAGGCAGGCAAGAATGTGGG - Intergenic
1095628121 12:44342313-44342335 CTGGAAGCTGGCTAAAAAGAGGG - Intronic
1096475490 12:51906943-51906965 TAGGAGGCTTGCAGCAATGAGGG - Intronic
1097880175 12:64679703-64679725 TTGCTGGCTGGAAACAATGAGGG + Intronic
1100118443 12:91339256-91339278 CTGGAGGCTGGGAAGAGTCAAGG - Intergenic
1100536049 12:95510364-95510386 TTGGAGGCTGGGAAGATTGAGGG + Intronic
1102040362 12:109796876-109796898 ATGGAGGCTGGGAAAAACGAAGG + Intronic
1102540844 12:113618041-113618063 CTGGAGTCTGGTCACAGTGAAGG - Intergenic
1102545378 12:113650790-113650812 CTGGAGGCTGACATGAAGGAAGG - Intergenic
1103509005 12:121461387-121461409 CTGTATTCTGGCAACAGTGAGGG + Intronic
1106400136 13:29421849-29421871 CTTGAGCCTGACTACAATGACGG + Intronic
1106775009 13:33000221-33000243 CTGGAGTGGGGCAAGAATGAAGG + Intergenic
1107002205 13:35560853-35560875 GTGGATGCTGGGAGCAATGATGG - Intronic
1107344845 13:39448014-39448036 CTGGTGCCTGGCTACAATGAAGG - Intronic
1107356841 13:39576345-39576367 GTGGAGGCTGACATCAAAGATGG + Intronic
1108852515 13:54750652-54750674 CTGGAGGTTGGTTAGAATGAAGG - Intergenic
1112267481 13:97938267-97938289 CTGGAGGGAGGAAACTATGAAGG + Intergenic
1115932610 14:38513870-38513892 CTGGAGGCTGGGAAGAAGCAAGG - Intergenic
1116475466 14:45333976-45333998 CTAGAGGCTGGGAACAATAGGGG - Intergenic
1117272509 14:54159298-54159320 CAAAAGGCTGGGAACAATGATGG + Intergenic
1117534042 14:56687260-56687282 CTGAGGGCTGCAAACAATGAAGG - Intronic
1119286848 14:73462152-73462174 GTGGAGGCTGACAAAGATGAAGG + Intronic
1124494241 15:30176614-30176636 CTGGAGGAGGGGAGCAATGAGGG + Intergenic
1124749329 15:32362031-32362053 CTGGAGGAGGGGAGCAATGAGGG - Intergenic
1125740015 15:41955969-41955991 CTGGAGGCTGGTATGACTGAGGG + Intronic
1126781379 15:52141877-52141899 CTGGATCCTGGCGACAATCAGGG - Intronic
1126805106 15:52340229-52340251 CTGCAGGCTGGCCTCAATGCGGG + Exonic
1129688295 15:77698706-77698728 CTGGAGGCTGGAAAGGGTGAGGG + Intronic
1129790545 15:78338139-78338161 CTGGAGGAGGGCAGCAATGTTGG - Intergenic
1133034171 16:3025783-3025805 CTGGCGGCTGGCAACAATTACGG + Exonic
1133546542 16:6813304-6813326 CTGGAGGCTAGAAACGAAGAGGG - Intronic
1135862587 16:26070379-26070401 CTGGGAGCTGGCCACTATGAAGG - Intronic
1136035488 16:27536709-27536731 GTGGAGGTAGGCAGCAATGAGGG - Intronic
1136716629 16:32287763-32287785 CTGGACGCTGGCCACGGTGAGGG + Intergenic
1136835009 16:33494008-33494030 CTGGACGCTGGCCACGGTGAGGG + Intergenic
1139264835 16:65628960-65628982 CTGGAGGAAGGAAACAAAGAAGG + Intergenic
1140034016 16:71359307-71359329 CTGGAGGCTGGGATAAATTAGGG + Intronic
1140739971 16:77932788-77932810 CAGGAGGCAGGCAAGAATGCAGG - Intronic
1141384098 16:83603584-83603606 CTGGAGGTTGGAAGCATTGATGG - Intronic
1203009794 16_KI270728v1_random:230024-230046 CTGGACGCTGGCCACGGTGAGGG - Intergenic
1203145179 16_KI270728v1_random:1794329-1794351 CTGGACGCTGGCCACGGTGAGGG + Intergenic
1144423840 17:15122658-15122680 CTAGAGGGTGGCTACACTGAGGG - Intergenic
1151605055 17:75130723-75130745 CTGGAGGCTGCCAAGGATAACGG + Intronic
1151671006 17:75571687-75571709 CTGTGGGCTGGCACCAATGGGGG + Exonic
1152772779 17:82180317-82180339 CTCCAGGCTGGAATCAATGATGG - Intronic
1153887076 18:9476079-9476101 CTGGAGCCTGGCCACTATGCCGG - Intronic
1154312338 18:13277052-13277074 CTGTAGGCTCCCAACACTGATGG + Intronic
1155088124 18:22477280-22477302 ATGGAGGCAGCCAGCAATGATGG - Intergenic
1157320564 18:46630805-46630827 CTGGAGGCAAGCAAGAAAGAAGG + Intronic
1157461035 18:47894281-47894303 CTTGAGGCTGTCAAGAATGGAGG - Intronic
1157670175 18:49521582-49521604 CCTGAGGCTGGTAACAATGCTGG - Intergenic
1165116721 19:33533265-33533287 CAGGAGGCTGGAAACCAGGAAGG - Intergenic
1165860236 19:38905514-38905536 CTGGAGGCTGAAAACTACGAGGG + Exonic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
925240376 2:2320597-2320619 CTGTAGGCTGGCGTCAATGATGG - Intronic
926165167 2:10518027-10518049 CTGGAGGCTCCCAACAAGGCAGG - Intergenic
929812301 2:45200941-45200963 CTGGATGGTGGCAGCAATGGTGG - Intergenic
932830074 2:74980820-74980842 CAGCAGGCTGCCACCAATGAAGG - Intergenic
933291460 2:80442811-80442833 GAGGATGATGGCAACAATGATGG - Intronic
933934452 2:87190302-87190324 ATGGAGGCTGACAGCAATGCTGG - Intergenic
935874581 2:107493068-107493090 CTGGAGTCTGGGAACCAAGAAGG + Intergenic
936358690 2:111775593-111775615 ATGGAGGCTGACAGCAATGCTGG + Intronic
937314813 2:120925040-120925062 CCGGAGGCTGGGAACCCTGAGGG - Intronic
940091798 2:149928186-149928208 CTGGCAGCTGGCAGTAATGATGG - Intergenic
941516454 2:166486222-166486244 GGAGAAGCTGGCAACAATGAAGG - Intronic
942008969 2:171739400-171739422 ATGGAAGCTGGGAACAATAATGG - Intronic
945715185 2:213349450-213349472 CCAGAGGCTGGCAATAATGTAGG + Intronic
947024956 2:225727146-225727168 CTGGATCCTGGTAACAATCAAGG + Intergenic
947329743 2:229015958-229015980 CTGGAGGCTGAGAAGAATGGTGG + Intronic
1170815051 20:19706776-19706798 CTGGAGCCTGACAAGACTGATGG + Intronic
1172208705 20:33182462-33182484 CTGGAGGCTGGCAAGAGTAGCGG - Intergenic
1172445315 20:34990335-34990357 CTGGAGGCTGCCAAGAGGGAGGG - Intronic
1176296590 21:5076466-5076488 CTGGGGGCTGACAGCAATGAGGG + Intergenic
1177129343 21:17237420-17237442 CTGGAGGTTAGTAACAGTGATGG + Intergenic
1177422941 21:20884954-20884976 ATGGAGGGGGGCAACAATGGAGG + Intergenic
1178751504 21:35308558-35308580 CTAGAGGCTGAAAACAATGGAGG - Intronic
1179014754 21:37586991-37587013 CTGGACACTGGCGACTATGAAGG - Intergenic
1179293968 21:40044138-40044160 CTGGAGGCTGCCAACACCCAGGG - Exonic
1179860459 21:44185655-44185677 CTGGGGGCTGACAGCAATGAGGG - Intergenic
1180109417 21:45641171-45641193 CTGGAGGCCGGGCACCATGAGGG + Intergenic
1180906143 22:19413295-19413317 ATGGAGGCTGGCAACAAGTTTGG + Intronic
1181165454 22:20980649-20980671 CTTCAGGCTGGAAACAATGGAGG + Intronic
1182729118 22:32473620-32473642 CTGGAGGCTGGCTACCATAGAGG - Intergenic
1183638811 22:39081111-39081133 GTAGAGGCGGGCAACAAAGATGG - Exonic
1183700082 22:39446194-39446216 CTGGAGGCTGCCAGCAGTTAAGG - Intergenic
1184493454 22:44823845-44823867 CAGGTGGCTGGCAACACTGAGGG + Intronic
1185162573 22:49238694-49238716 CTGGGGGCAGGCAACAAAGAGGG + Intergenic
950669091 3:14514463-14514485 CTGGAGGCTAGCGACACTGTAGG + Exonic
950975657 3:17240513-17240535 CTATAGGCTGGCAACAGAGAAGG + Intronic
952185419 3:30962706-30962728 CTGGAAGCTCGCAATCATGATGG + Intergenic
952406370 3:33008637-33008659 CTGGAGGCTGGCAACAATGAGGG + Intronic
952573114 3:34741760-34741782 TGGGAGGCAGGCAACAATGGAGG - Intergenic
952978331 3:38715096-38715118 CTGGAGCCTTGCATGAATGAAGG - Intronic
959447747 3:106460937-106460959 CTAGAGGCTGGGAAGAATGGTGG - Intergenic
959971578 3:112416002-112416024 CCAGAGGCTGGGAAGAATGAGGG - Intergenic
960148288 3:114226337-114226359 CAGGAGGATGGCCATAATGAGGG + Intergenic
963850532 3:150206474-150206496 TTGGAGGCAGGCAAGGATGAGGG - Intergenic
963935201 3:151045329-151045351 CTAGAGGCTGGGAAGAATTAAGG + Intergenic
963959553 3:151293890-151293912 CTGGAGGATGGCCACAGTGCAGG + Intronic
964051813 3:152402905-152402927 CTGGAGGCTGTCACCAGGGAAGG + Intronic
964158120 3:153611757-153611779 CTTGAGGCAGGCAACACTCAAGG - Intergenic
966265349 3:178034923-178034945 CTAGAGGCTGGGAAGAATGGGGG - Intergenic
967845101 3:194036643-194036665 CTGGAGGCTGCAAACAGAGAAGG + Intergenic
968170573 3:196506346-196506368 CTGGAGACAGGCAAGACTGAGGG + Intergenic
968203043 3:196772510-196772532 CTGGAGGCTGGTAAAAAAGAAGG - Intronic
968690221 4:1986403-1986425 CTGGAGGACGGCAACAGTCAGGG + Intronic
970012759 4:11478533-11478555 CTGGAAGCTGGGAAGAAAGACGG - Intergenic
970326793 4:14934007-14934029 CTTGAGGCTGGCAAATAGGAAGG - Intergenic
972135938 4:35894051-35894073 CAGCTGGATGGCAACAATGAGGG + Intergenic
975895828 4:79089074-79089096 CTGGAGGTTGGAAAGAATGGTGG - Intergenic
977675020 4:99737932-99737954 CTAGAGGCTTGCAAGAATGGGGG - Intergenic
977891809 4:102321044-102321066 CTGGAGGATGACAACCAGGAAGG + Intronic
978663251 4:111153186-111153208 TATGAGGCTGGCAACAAAGATGG - Intergenic
979496737 4:121392383-121392405 CTGGAGGCTGTCACCGATCATGG + Intergenic
985720540 5:1486409-1486431 CTGGAGGCTGGGCCCAATGCGGG + Intronic
986510022 5:8494789-8494811 CTGAAGGCAGACAATAATGATGG + Intergenic
988135452 5:27165162-27165184 CTGGTGGCTGGAAAACATGATGG + Intergenic
991302782 5:65145313-65145335 CTGGAGAGTGGCATCAATCATGG - Intergenic
994375168 5:99010350-99010372 ATGGAGGCTGGCAAAACTTATGG + Intergenic
994552073 5:101247602-101247624 CTGGAGGCTGGGAAGTCTGAGGG - Intergenic
995004555 5:107175628-107175650 CTGGATGCTGGCAAGAATTCAGG - Intergenic
995564382 5:113418491-113418513 CTGGAGGTTGGCAGAAAAGAAGG - Intronic
1000025214 5:157352956-157352978 CTGGAGGCTGGCGGCAATCCCGG - Intronic
1002109180 5:176896623-176896645 CTAGAGGCTTGGAACAAAGAGGG + Intronic
1003982131 6:11399862-11399884 ATGGATGCTGGCAAGAATGTAGG + Intergenic
1004925785 6:20413822-20413844 AAGCAGGATGGCAACAATGATGG + Intronic
1005903975 6:30244371-30244393 GTGGAGGCTGGGAACCATGTAGG - Intergenic
1007106741 6:39288561-39288583 CTGGAGGCTGGCTTGAATGCTGG + Intergenic
1007202543 6:40122225-40122247 CAGGAAGCTGGAAAAAATGAAGG - Intergenic
1007472041 6:42097272-42097294 CTGGAGGCTGTGACCTATGATGG + Intergenic
1009758327 6:67970634-67970656 CTTGAAGCTGGCAGTAATGAAGG - Intergenic
1012445988 6:99307561-99307583 CTGGAGGCAGGCAAAGATCAAGG + Intronic
1012665313 6:101961526-101961548 CTGGTGCCTGGGAACAAAGATGG - Intronic
1012877679 6:104747592-104747614 CAGCAGACTGGCAACAGTGATGG + Intronic
1014017218 6:116547069-116547091 CTGGATGTTGGCAACAAGAAGGG + Intronic
1017020153 6:150133567-150133589 CTGGAGTCTGGGAACATTGTAGG - Intergenic
1022206688 7:28171330-28171352 CTGTAGGTTTGCATCAATGAGGG - Intronic
1022281158 7:28911150-28911172 CAGGAGGTTGGCATCACTGAGGG - Intergenic
1026440091 7:70436767-70436789 TTGGAGGCTGGCAGCAGAGAAGG - Intronic
1030210522 7:106991231-106991253 CTGGGAGCTGGGGACAATGATGG - Intergenic
1030877086 7:114826897-114826919 CTGTAGGCTGGATACAATCAAGG + Intergenic
1033226291 7:139565365-139565387 CTGGAGCCAGTCAACAAAGAAGG + Exonic
1034001910 7:147423680-147423702 CTGGAGGATGGTATCAATGGAGG - Intronic
1034135698 7:148766702-148766724 TTGGATGCTGACAAAAATGAAGG + Exonic
1034694518 7:153042021-153042043 TTGGCTGCTGGCAGCAATGAGGG - Intergenic
1035476757 7:159149332-159149354 TTGGAGGATGGCAACAGTCAGGG - Intergenic
1035634828 8:1136730-1136752 CTTGAGGCTGGCAAACATGGAGG + Intergenic
1038998552 8:32953522-32953544 TTGAAGCCTGGAAACAATGAAGG - Intergenic
1039914026 8:41846489-41846511 CTGAAGGCAGGCAACTCTGAAGG + Intronic
1041855319 8:62446542-62446564 CTGGAGGTTAGAGACAATGATGG - Intronic
1043697287 8:83236287-83236309 CTGCTGGCTGGGTACAATGATGG + Intergenic
1046800397 8:118420131-118420153 CTGGTGACTGGCCACAATCATGG + Intronic
1047447891 8:124936599-124936621 TTGGAAGCCGGCTACAATGAAGG - Intergenic
1050173198 9:2843882-2843904 CTGGAGCCTGGCAAGAAGGGCGG - Intronic
1052699702 9:31922652-31922674 ATGGAGGCTGGCAACAATCTGGG + Intergenic
1053157439 9:35791217-35791239 CTGGAGACTGGAACCACTGAGGG + Intergenic
1057427441 9:94964201-94964223 CTGGAGGCTGCCAGCGATGCTGG - Intronic
1057586105 9:96330226-96330248 CTGGTGCCTGCCAACCATGAGGG + Intronic
1060698459 9:125730222-125730244 CTGGAGGCTGGTCTCAAGGAGGG - Intergenic
1061776295 9:132967215-132967237 CTGGAGGCTGGGAAGATTGAGGG - Intronic
1186405850 X:9301747-9301769 CTGCAGACTGGAAAAAATGAGGG - Intergenic
1190789371 X:53684634-53684656 CTGGAGACAGGTAACAATGGGGG - Intronic
1192149684 X:68704485-68704507 CTGGAGGCTGGGAACTTGGAGGG + Intronic
1192424000 X:71059800-71059822 CTTGAGGCTGGCAACTATCCTGG - Exonic
1192510488 X:71718084-71718106 CTGGAGGGTGGCAAAAAGGCTGG - Exonic
1192516209 X:71763469-71763491 CTGGAGGGTGGCAAAAAGGCTGG + Exonic
1192546252 X:72017351-72017373 CTGCCAGCTGGCAACATTGAAGG - Intergenic
1192629768 X:72768384-72768406 CTGGAGGGTGGCACCAAAGATGG - Intergenic
1192651942 X:72952420-72952442 CTGGAGGGTGGCACCAAAGATGG + Intergenic
1192831197 X:74752347-74752369 TTGGTGGCTGCCAAAAATGAAGG - Intronic
1194491191 X:94551797-94551819 CTGGAGGCAGGGAACATAGACGG + Intergenic
1198092086 X:133341646-133341668 CTGGGGGCAGGGAAAAATGATGG - Intronic
1199299610 X:146197658-146197680 CTGGAGCCAGGGAACAATTATGG - Intergenic
1200161640 X:154012819-154012841 CTGAAGGCTGGGAACAAGGAGGG - Intronic
1201009993 Y:9541698-9541720 CTGAAGGGTGGGAATAATGATGG - Intergenic
1201906468 Y:19090851-19090873 CTGGATGCTGCCAACATTGTTGG - Intergenic