ID: 952406876

View in Genome Browser
Species Human (GRCh38)
Location 3:33013074-33013096
Sequence AGGTAGAGACTAGATTGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952406876_952406881 15 Left 952406876 3:33013074-33013096 CCGTCCCAATCTAGTCTCTACCT 0: 1
1: 0
2: 0
3: 32
4: 278
Right 952406881 3:33013112-33013134 CATTTTCCCCTCCAACCCCATGG 0: 1
1: 0
2: 3
3: 40
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952406876 Original CRISPR AGGTAGAGACTAGATTGGGA CGG (reversed) Intronic
906190539 1:43896467-43896489 AGGAAGAGAATGGAGTGGGAAGG - Intronic
906436505 1:45801436-45801458 AGGTAGAGGCCAGATTTGGATGG + Intronic
906787642 1:48629860-48629882 AGGGAGAGATAAGATTGGGGAGG + Intronic
907867193 1:58409862-58409884 AGTTGGAGACAAAATTGGGAAGG - Intronic
908011568 1:59783482-59783504 AGGAAGATACTAGATTGAAAGGG + Intergenic
908198618 1:61771074-61771096 GGGTAGAGATCAGATTGGAAGGG + Intronic
909201660 1:72696892-72696914 AGGTAGAAAATAGAGTGGGATGG + Intergenic
913122345 1:115753664-115753686 ATGAAGAGACTGGATTGGGTGGG - Intronic
913533874 1:119753063-119753085 ACTTAGAGACTAGATTGAAAAGG - Intronic
914436072 1:147660471-147660493 AGGGACATAGTAGATTGGGAAGG - Intronic
915031066 1:152880897-152880919 AGGGTGAGAGAAGATTGGGAGGG - Intronic
915872538 1:159576341-159576363 AGGCAGACACAGGATTGGGAGGG + Intergenic
915967415 1:160323169-160323191 AGATCGAGAGTAGAATGGGAAGG + Intronic
917429308 1:174949149-174949171 AGATAGAGACTAGATTCTGTAGG + Intronic
918461914 1:184785264-184785286 AGGTAGAGCGGAGAATGGGAGGG + Intergenic
918612059 1:186504197-186504219 AGGTAAAGAGTAGAAGGGGAGGG + Intergenic
918983182 1:191589981-191590003 AGGTAGAGAGAAGATTGTGGGGG + Intergenic
920347992 1:205318924-205318946 AGGTGGAGAGAAAATTGGGATGG + Intronic
921180763 1:212629691-212629713 GGGTAGAGACTTGATGGGCAAGG + Intergenic
921650384 1:217671536-217671558 AGGGAGAGACTTTATTGGAAAGG - Intronic
922497588 1:226070956-226070978 AGGAGGAGACTAGGCTGGGATGG + Intronic
922963574 1:229668417-229668439 AGGCAGAAACTAGAATGTGAAGG - Intergenic
923100180 1:230807978-230808000 ATGTAGAGGGTAGACTGGGAAGG - Intergenic
924525010 1:244838417-244838439 AGGAAGAGACTAGATTCCAAAGG + Intronic
1063137343 10:3229209-3229231 AAATAGAGGCTAGACTGGGAAGG - Intergenic
1064248856 10:13691496-13691518 AGGAAGAGACAAGCTTGGGGTGG - Intronic
1064986484 10:21215968-21215990 AGCTGGAAACTAGTTTGGGAGGG - Intergenic
1065979360 10:30876313-30876335 TGGAAGAGACTAGATGGGGCAGG + Intronic
1066008581 10:31171197-31171219 TGATAGAGACTATATTGGGTAGG + Intergenic
1066736894 10:38487904-38487926 AGGCATGGACTAGATTGGAACGG + Intergenic
1066740215 10:38512949-38512971 AGGTAGAGACTCAAATGGAATGG + Intergenic
1068623805 10:59216684-59216706 AGGTAGAAACTAGATTTGACTGG + Intronic
1069771459 10:70903209-70903231 AGGCAGAGGCAAGATTGGGCGGG + Intergenic
1069865522 10:71500522-71500544 AGGCAGAGACTTGGTGGGGATGG - Intronic
1070567138 10:77612463-77612485 TGGTGGAAACTAGATTTGGAGGG + Intronic
1071276827 10:84063323-84063345 AGGCAGAGGCAAGATGGGGATGG - Intergenic
1072200068 10:93150269-93150291 ATGTAAAGAAGAGATTGGGAGGG + Intergenic
1073189480 10:101640805-101640827 AGGAAGAGTCTAGGTTGGGCAGG - Intronic
1073299562 10:102462582-102462604 AGGTAAAGACTAGAAAGGGATGG - Intronic
1074534502 10:114319271-114319293 AGGTAGAGTCTACCTAGGGATGG - Intronic
1074706069 10:116133027-116133049 AGGGAGAGATTAGAGGGGGAGGG - Intronic
1078114293 11:8429944-8429966 AGATAGTGACTAGATTCTGAGGG - Intronic
1079114719 11:17633996-17634018 AGGGAGAGTCTAGCCTGGGAAGG + Intronic
1079538834 11:21547433-21547455 AGGTGGAGACCAGATTGTGAAGG + Intronic
1080708965 11:34727607-34727629 TTCTAGAGACTAGATAGGGAGGG - Intergenic
1080829317 11:35876700-35876722 AGGCAGAAACTAGACTGTGATGG - Intergenic
1080981915 11:37417823-37417845 AGGTAGAGTATAGATTGGTCTGG + Intergenic
1082216784 11:49580445-49580467 AGTTAGAGACTAAAGTGAGAGGG - Intergenic
1083022378 11:59520180-59520202 AGGTAGTGACTAGAAGGGCAGGG - Intergenic
1084722988 11:70920421-70920443 AGGAAGAGACAAGAGTGGAAAGG + Intronic
1086632767 11:89043630-89043652 AGTTAGAGACTAAAGTGAGAGGG + Intronic
1086761100 11:90632535-90632557 AGGTAGTGATTAGATATGGAAGG + Intergenic
1089553854 11:119303811-119303833 AGGAAGGCACTAGATTGGAAAGG - Exonic
1089918627 11:122185133-122185155 ATGTAGAGACTAGATGAGCAGGG - Intergenic
1091148333 11:133300834-133300856 AGGCAGAGACTGGATTGGTGCGG + Intronic
1092918554 12:13209960-13209982 AGGAAGTGGCCAGATTGGGAAGG + Intronic
1093193331 12:16100603-16100625 AGGTAGAGATGATATTGAGAAGG - Intergenic
1093821227 12:23620348-23620370 ATATGGAGAATAGATTGGGAGGG + Intronic
1094144196 12:27211779-27211801 AGGTAGAGACTAGATTACAAAGG - Intergenic
1094749592 12:33390482-33390504 ATGTAGAGACTAGATTAGTAGGG - Intronic
1099480170 12:83156134-83156156 ATGTAGAGATGTGATTGGGAGGG + Intergenic
1101550682 12:105758692-105758714 ATGTATAGACTAGATCAGGAAGG - Intergenic
1101720467 12:107346253-107346275 ATGGAAAGTCTAGATTGGGATGG + Intronic
1101787914 12:107902231-107902253 AGGAAGAGCCTAGAGTAGGAGGG - Intergenic
1104100160 12:125600005-125600027 AGGTGGGGGCTAGATTGTGATGG + Intronic
1105584783 13:21733890-21733912 AGGTAGAGACTGGATGGGGGAGG + Intergenic
1106530566 13:30586870-30586892 AGGTAGGGACAGGTTTGGGAGGG - Intronic
1106872922 13:34041260-34041282 AAGTAGAGACCACAGTGGGATGG + Intergenic
1108444525 13:50493952-50493974 GGGTGGAGAACAGATTGGGAAGG + Intronic
1108474017 13:50795508-50795530 AGGCTGAGGTTAGATTGGGAAGG + Intronic
1108538629 13:51413921-51413943 AAGGAGAGACTAGATGTGGACGG - Intronic
1110200031 13:72839104-72839126 ATGTAGAGAATAGATTGGAATGG + Intronic
1110202268 13:72866096-72866118 AGGCAGAGACTAGAGTGATACGG - Intronic
1110792955 13:79605731-79605753 AGGTATGGACTAGAGAGGGATGG + Intergenic
1112521974 13:100104350-100104372 AGGTCGAGATGAGATTTGGATGG - Intronic
1114219303 14:20682780-20682802 CGGAAGAGCCGAGATTGGGAGGG + Intergenic
1115322144 14:32093694-32093716 AGATATAGATTAGATTTGGAAGG + Exonic
1115488964 14:33940478-33940500 AAGAAGAGATTAGATAGGGATGG - Intronic
1117719048 14:58610615-58610637 AGGTAGAGAGTAGAATGGACAGG + Intergenic
1117858979 14:60069562-60069584 AGGTAGAGAATAGATCTGGAAGG - Intergenic
1119434614 14:74589794-74589816 AGGGAGGGAATAGAATGGGAAGG + Intronic
1119589087 14:75868184-75868206 AGGCAGAGAAGAGAGTGGGAGGG - Intronic
1124590851 15:31051657-31051679 AGGAAGAGAGTAGAGTGGAAAGG - Intronic
1124994691 15:34711906-34711928 AGGTAGAGACCAGCTTCTGAGGG + Intergenic
1125520838 15:40347077-40347099 AGGTACAGACCAGACTGGGGAGG + Intergenic
1126155852 15:45565144-45565166 AGGTAGGGACCAGATTGTGATGG + Intergenic
1126884380 15:53134011-53134033 AGGTAGAGGCAAGGTTGGGAGGG + Intergenic
1127286672 15:57539254-57539276 AGGTAGAGGCAAGAAAGGGACGG - Intronic
1128162888 15:65435979-65436001 AAGTACAGACTAGCATGGGATGG - Intergenic
1128334686 15:66778414-66778436 AGGGAGAGTCTAGCTGGGGAAGG - Intronic
1129028450 15:72601244-72601266 GAGTAGAGACTGAATTGGGAGGG - Exonic
1129197630 15:73979881-73979903 AGTTAGAGACCAGCTTGAGAAGG + Exonic
1131267439 15:90925379-90925401 AAGTAGAGACTAGTTCAGGATGG + Intergenic
1132038083 15:98503048-98503070 GGGTGGAGACTGGATTAGGATGG + Intronic
1132264401 15:100455284-100455306 TGATAGACACCAGATTGGGAAGG + Intronic
1132937146 16:2486925-2486947 AGGCAGAGTCTAGACCGGGAGGG - Intronic
1132975069 16:2706931-2706953 AGGGAGAGACTTAATTGGGGAGG + Intronic
1133240097 16:4409073-4409095 AGGTAGAGACTAGGCATGGAGGG + Intronic
1135939475 16:26809103-26809125 GGGTTGAGATTAGATTGTGAAGG - Intergenic
1135967611 16:27048991-27049013 AGGAGGGGACTATATTGGGAAGG - Intergenic
1138457665 16:57130740-57130762 TGGCAGAGACAAGATGGGGAGGG + Intronic
1138633839 16:58320666-58320688 AGGTGGAGAGTAGCTTGGAATGG + Intronic
1138731454 16:59199895-59199917 AGTTTGAGACCAGCTTGGGAAGG - Intergenic
1138816592 16:60210054-60210076 AAGTAGAGACTATTTTGGGGAGG - Intergenic
1139326119 16:66153888-66153910 GGGTAGAGGCCAGACTGGGAGGG - Intergenic
1139612479 16:68069049-68069071 AGGTAGAGGCTAGGTTGACAGGG + Intronic
1140806055 16:78533221-78533243 AGGAGGTGACTAGATTTGGAAGG + Intronic
1143080571 17:4378183-4378205 CCCTAGAGACTAGATTGTGAAGG - Intergenic
1144391856 17:14800820-14800842 GGGTAGAGAATAGATGGGAAGGG + Intergenic
1146008533 17:29177494-29177516 AGGTAGGAGCTGGATTGGGAGGG - Intronic
1146011880 17:29201140-29201162 AGGCAGAGACTAGATTAGAGAGG - Intergenic
1146118584 17:30167049-30167071 AGGTAGATAACAGACTGGGAAGG - Intronic
1147032321 17:37649398-37649420 AGGTAGGGACCAGCTTGTGACGG + Intergenic
1147631488 17:41935151-41935173 AGGTAGAAGCTGGAGTGGGAAGG - Intronic
1148568556 17:48647939-48647961 AGGAAGGGACTGGATTGTGAGGG - Intergenic
1149702994 17:58671049-58671071 AGATAGAGAATAGAATGAGAGGG - Intronic
1151012971 17:70522371-70522393 AGGCAGAGAGTGAATTGGGAGGG + Intergenic
1151551011 17:74822456-74822478 AGGTGGAGACCAGCTCGGGAAGG + Intronic
1203177397 17_KI270729v1_random:29146-29168 TGGAAGAGACTAGAATGGAATGG + Intergenic
1156245491 18:35293825-35293847 AGGTGGAGAGTAGATCTGGAGGG + Intergenic
1156843939 18:41641328-41641350 AGGTACAGAAAAGAGTGGGAGGG + Intergenic
1158107744 18:53904770-53904792 AAGAATAGACTAGATTTGGAAGG - Intergenic
1158357990 18:56641544-56641566 AGGTAGAGAGTAGATCTGGAGGG - Intronic
1159446369 18:68545646-68545668 AAGAAGAGACAAGAGTGGGAAGG + Intergenic
1159993098 18:74933686-74933708 GGGCAGAGATTTGATTGGGATGG + Intronic
1160147172 18:76375302-76375324 AGGTAGAGAGTGGACAGGGAAGG + Intronic
1160147196 18:76375404-76375426 AGGTAGACAATGGATGGGGAAGG + Intronic
1160184015 18:76660693-76660715 AGGGAGAGACCAGAATGGGGAGG + Intergenic
1160496591 18:79379645-79379667 AGGTAGAGACTGGAGGAGGAAGG + Intergenic
1161279635 19:3438817-3438839 AGGTAGGGACAAGAGTGGGTTGG - Intronic
1162747752 19:12808417-12808439 AGGGAGAGATTAGATGGAGACGG - Intronic
1163095640 19:15055183-15055205 AGGTGGAGATGAGATTGTGATGG + Exonic
1163130745 19:15271335-15271357 AAGTAGAAACCAGATTGCGACGG - Intronic
1163701997 19:18790742-18790764 AGGTGGAGAGGAGATGGGGAGGG - Intronic
1164813902 19:31179501-31179523 AGATAGAAAGTAGATTTGGAGGG + Intergenic
1165134010 19:33654003-33654025 AGGAAGAGAATAGAATGAGAGGG - Intronic
1167654749 19:50756196-50756218 AGGTTGAGACTAGACTGAGGGGG - Intergenic
1167656428 19:50767275-50767297 AGGTTGAGACTAGACTGAGGGGG - Intergenic
925250472 2:2432291-2432313 AGGTGGAGACTGGATTAGGATGG - Intergenic
925669420 2:6294768-6294790 AAATAGAGAATAGATTTGGAAGG - Intergenic
926594806 2:14778547-14778569 AGGAAGAGATTGCATTGGGAAGG + Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
929226487 2:39516378-39516400 AAGGAAAGAATAGATTGGGAAGG - Intergenic
929371699 2:41232735-41232757 AAGTAGAGAGTAGAATGGCAAGG + Intergenic
929373922 2:41260991-41261013 TGGATGAGACTAGCTTGGGAAGG - Intergenic
929395861 2:41521477-41521499 AGCTAGGGAACAGATTGGGAAGG - Intergenic
929466485 2:42149288-42149310 AGGTGTAGACTGGTTTGGGATGG + Intergenic
931155111 2:59619531-59619553 AGGTTGAAAGTAGATTGGAAAGG - Intergenic
931218006 2:60264125-60264147 AGGGTGAGAGTAGAGTGGGAGGG - Intergenic
933767569 2:85720502-85720524 AGGCAGGGGCTAGATTGGGCAGG + Intergenic
934020891 2:87950730-87950752 AGGAAGAGAGTTGATTGTGAGGG - Intergenic
934545676 2:95213381-95213403 ATGTAGAGACATGATTGGAATGG + Intronic
934739124 2:96706522-96706544 CTGAAGAGACTTGATTGGGAAGG + Exonic
937443098 2:121933614-121933636 AGGTGGAGAACTGATTGGGATGG - Intergenic
938217051 2:129526795-129526817 AAGTAGAGAGAAGAGTGGGAAGG + Intergenic
938998118 2:136702216-136702238 AGGTAGAGACTGGACTGTAAAGG - Intergenic
939017454 2:136919356-136919378 AGGTATAGACAAGAAAGGGAAGG - Intronic
939458639 2:142470002-142470024 ATGTAGAGACTATATTTTGAAGG - Intergenic
941612834 2:167682716-167682738 AGGGAGAGACTAGGTGGGGAGGG - Intergenic
942019352 2:171850882-171850904 AAGGAGAGAATAAATTGGGATGG - Intronic
942963521 2:181861597-181861619 AGGTAGAGACAAGGCTGGGAGGG - Intergenic
947954995 2:234181440-234181462 AGGGAGAGAGTAGATTTGGTTGG + Intergenic
948241101 2:236435696-236435718 AGGGAGAGACCTGATTGGGGTGG - Intronic
1169481164 20:5982292-5982314 AGGTATAGAGTAGATACGGAGGG + Intronic
1170205974 20:13799030-13799052 AGGTAAAGTTTGGATTGGGAAGG + Intronic
1170366696 20:15606129-15606151 AGGCGGAGAATAGATTTGGAGGG - Intronic
1170795939 20:19546748-19546770 AGGCAGAAACCAGGTTGGGAAGG - Intronic
1171915924 20:31062168-31062190 TGGTATAGAATGGATTGGGATGG + Intergenic
1171923876 20:31172955-31172977 TGGAATAGACTAGAATGGGATGG + Intergenic
1172083942 20:32363913-32363935 AGGCAGAGACCAGATTGTGAGGG + Intronic
1172411151 20:34724101-34724123 AGGCAGAAACTAGTTTGGAAGGG - Intronic
1177261107 21:18731793-18731815 AGGTAGAGGGGAGATGGGGATGG - Intergenic
1177867839 21:26534399-26534421 AGGTAGAGAGTAGATCAGGAGGG - Intronic
1179026328 21:37682076-37682098 AGGTAGACAATAGAAGGGGAGGG + Intronic
1179095785 21:38313544-38313566 GTGTGGAGAATAGATTGGGAAGG - Intergenic
1180645976 22:17339399-17339421 AGGCAGAGACAGGATTGGGCAGG - Intergenic
1183297230 22:37037523-37037545 AGGAAGAGGATAGCTTGGGAGGG - Intergenic
1184362451 22:44026468-44026490 AGGGACAGGCTGGATTGGGAAGG + Intronic
949206986 3:1452007-1452029 AGATAGAGATAAGTTTGGGACGG - Intergenic
952018759 3:28991353-28991375 TGGGGGAGACTTGATTGGGAAGG - Intergenic
952406876 3:33013074-33013096 AGGTAGAGACTAGATTGGGACGG - Intronic
952630809 3:35464204-35464226 AATTAGAGACGAGATTTGGATGG + Intergenic
952975785 3:38694642-38694664 AGGTAGAAACTAGATTTCCATGG - Intergenic
953124017 3:40073891-40073913 AGGTAGAGAGTAGAATTGAAAGG - Intronic
955890394 3:63644472-63644494 AGGCAGAGAGTGGAATGGGAGGG - Intergenic
956205996 3:66755180-66755202 AGCTAGAGACCAGGTTGGGCTGG - Intergenic
957532609 3:81460026-81460048 AGGTAGGGACTAACTTGAGAAGG + Intergenic
959547655 3:107615546-107615568 AGGTAGTGATTAGATCGTGATGG - Intronic
961822415 3:129581955-129581977 AGGAAGAGACGTGATTGAGATGG + Intronic
962812401 3:138970949-138970971 GGGGAGTGACTAGATTGGCATGG + Intergenic
963009110 3:140752784-140752806 AGGTCAGGACTAGATTGAGAGGG + Intergenic
964028591 3:152108664-152108686 AAGTAGAGTCTAAATTTGGAGGG + Intergenic
965447360 3:168791661-168791683 AGGTAGAGGGTAGACTGGGAAGG + Intergenic
966486672 3:180478921-180478943 AGGTGGAGAGTGGATTTGGAGGG - Intergenic
966941857 3:184752956-184752978 GTGTGGAGACTAGATGGGGAGGG + Intergenic
968422968 4:500314-500336 AGGTAGAAGCTAGATTGTGAAGG + Intronic
969853362 4:9979644-9979666 GGGTGTAGACTAGAGTGGGAAGG - Intronic
971610721 4:28722717-28722739 AGGTACAAATTAGATTAGGAAGG + Intergenic
971847390 4:31937021-31937043 AGGTGGGGAGGAGATTGGGAGGG + Intergenic
972235698 4:37131365-37131387 AGGTAGAGACGAGGCTGGAAGGG + Intergenic
972318936 4:37954556-37954578 AGGTTGAGGCCAGATTTGGAAGG + Intronic
972747546 4:41952671-41952693 AGATTGAGACTAGATTGTGGAGG + Intronic
977336781 4:95709406-95709428 GGGTAGAGCCTAGATTTGGATGG + Intergenic
978325225 4:107546163-107546185 AGATAGAAAGTAGATTGTGAAGG - Intergenic
978602447 4:110443199-110443221 GGGTAGAGACTGGATTGGAGAGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979628733 4:122876634-122876656 AAGTAGAGACTGGATTGGGCTGG + Intronic
980512240 4:133809547-133809569 AAGAAGAGAGTAGACTGGGATGG - Intergenic
982060693 4:151601316-151601338 AGGTGGAGAGTAGATTTAGAGGG + Intronic
983177754 4:164611363-164611385 GGGTAAAAACTAGAGTGGGAAGG + Intergenic
985025242 4:185733622-185733644 AGGTAGACACTACATGGGAAGGG + Intronic
986727721 5:10611839-10611861 TGGTTGAGACTTGATTGGGAAGG + Intronic
987715356 5:21561805-21561827 AATTAGAGAAGAGATTGGGAAGG + Intergenic
987964860 5:24859129-24859151 TGCAAGAGACTAGATTGGGGAGG - Intergenic
990781660 5:59371205-59371227 AGGTTGAGACTGGACTGTGAAGG + Intronic
992650814 5:78857989-78858011 AGGTAGAGACAAGCTTGGCATGG + Intronic
993277750 5:85883247-85883269 AGGTTGAGCCTAGAAAGGGATGG + Intergenic
993649353 5:90499502-90499524 AGGTAGAATCCAGATTGGAATGG + Intronic
995386882 5:111598215-111598237 AAGTAGAGAAGAGCTTGGGAGGG - Intergenic
997974365 5:138430991-138431013 GGAAAGAAACTAGATTGGGAAGG - Intronic
998533680 5:142909131-142909153 AGGGAGACAATAGAATGGGAAGG - Intronic
999122484 5:149219845-149219867 AGGTAGGGATGAGAATGGGAGGG - Intronic
999832119 5:155330722-155330744 AGGTAGAGACTATTTCAGGAAGG - Intergenic
999904782 5:156128544-156128566 AATTAGAGACGAGATTTGGATGG - Intronic
1003289944 6:4771743-4771765 AGGTAAAGACGATACTGGGATGG + Intronic
1003612588 6:7627052-7627074 AGGTGCAGACTAGACTGGAATGG + Intergenic
1003905795 6:10698582-10698604 AGTTAGAGACTGAATTGGGAGGG + Intronic
1006851576 6:37102503-37102525 AGGTGGAGACTGGGTGGGGAGGG + Intergenic
1007914113 6:45544925-45544947 AGGTAGAGGCTAGTTGAGGATGG + Intronic
1008050508 6:46895886-46895908 AGGTAGAGACCAGAGTTGGAAGG - Intronic
1008319995 6:50099697-50099719 ATCTAGAAACTAGATTGTGAAGG - Intergenic
1008734067 6:54520521-54520543 AGGAGGAAAGTAGATTGGGAAGG + Intergenic
1008890269 6:56480447-56480469 AGGTTCAGACTAGGTTGGAAGGG - Intronic
1009437825 6:63637000-63637022 TCCTAGAGACTAGATTGGGGTGG + Intronic
1009696370 6:67109205-67109227 AGGTGGTGACTAGATTGTGGGGG + Intergenic
1010295846 6:74194830-74194852 AGGTAGAGCCTTGAGAGGGAGGG - Intergenic
1011014822 6:82743400-82743422 AGGTTGGGACTAGATTGTGAAGG + Intergenic
1011098027 6:83688145-83688167 ATGGAGAGACTAGATTTGAAAGG - Intronic
1013313654 6:108920849-108920871 AGGTAGGGGCTGGACTGGGAGGG + Intronic
1013492738 6:110665154-110665176 AGGTCGAAAGTAGATTGGAAGGG + Intronic
1014403320 6:121017516-121017538 GGGTTTAGACTGGATTGGGAAGG - Intergenic
1014923802 6:127246403-127246425 AGATAGATAATAGATTGAGATGG + Intergenic
1014968479 6:127785109-127785131 AGGTAGATAATAGATTAGGTAGG - Intronic
1014968483 6:127785144-127785166 AGGTAGATAATAGATTAGGTAGG - Intronic
1014968487 6:127785179-127785201 AGGTAGATAATAGATTAGGTAGG - Intronic
1016604677 6:145906768-145906790 AGGCAGAAAGCAGATTGGGAGGG - Intronic
1016975795 6:149806341-149806363 ATGTAGAGACTAGCCTGGGAAGG + Intronic
1017830730 6:158126601-158126623 TGGTAAAGACTAGATCGGGCAGG + Intronic
1018613316 6:165662958-165662980 ATGTGAAGACTAGACTGGGAGGG - Intronic
1019276562 7:178889-178911 AGGTAGAGTCCAGATGCGGAGGG + Intergenic
1019806621 7:3131071-3131093 AGGTGGAGAGTAGATCTGGAGGG - Intergenic
1020878287 7:13726506-13726528 AGGTAGAGATTAGAGTGAAATGG - Intergenic
1021301092 7:18974048-18974070 AGGAAGAGTCTGGAGTGGGATGG - Intronic
1021989992 7:26131900-26131922 AGGTAGCGACTAGCTGGGGCTGG + Intergenic
1022838967 7:34144448-34144470 AGATAGAGAATAAATTGGAAGGG + Intronic
1022944723 7:35270919-35270941 AGGTAGAGATGAGAGAGGGAGGG - Intergenic
1023170746 7:37388040-37388062 AGTTAGAGACCAGCTTGGGCAGG - Intronic
1023550865 7:41368563-41368585 AGATAGAGACAGAATTGGGAAGG - Intergenic
1024114347 7:46178224-46178246 AAGTGGAGACTGGATTGGGGAGG - Intergenic
1028098377 7:86790467-86790489 ATGTAGAGAATAGATTGTGGAGG - Intronic
1031022590 7:116644267-116644289 AGGTAGAGGATAGAATAGGAAGG - Intergenic
1031411199 7:121441682-121441704 AGGGAGAGATGAGCTTGGGATGG + Intergenic
1032241522 7:130162901-130162923 AGGAAGACAGTAGATTGGGAGGG + Intergenic
1032575713 7:133052049-133052071 CAGTAGAGACTAAATTGGCATGG - Intronic
1034531939 7:151701217-151701239 AGGTAGAGACTGGAGGGAGAAGG - Intronic
1034579073 7:152026789-152026811 AGGTATAGACTAGTTCGGGCAGG - Intronic
1035036549 7:155899168-155899190 AAGTGGAGCATAGATTGGGAAGG - Intergenic
1035687813 8:1538569-1538591 AGGTACAGAACAGATAGGGAGGG + Intronic
1037200322 8:16244595-16244617 AGGGAGAAACTGGAATGGGAGGG - Intronic
1037585178 8:20271118-20271140 AGGTAGAGACTCGTTGGGAATGG - Intronic
1037647103 8:20802077-20802099 AGGAAAACACTAGAATGGGAGGG - Intergenic
1042520777 8:69709061-69709083 AGGTAGAAACCAGACTGCGATGG + Intronic
1043497474 8:80818046-80818068 AGGTAGAGAGTAAGGTGGGAAGG + Intronic
1044093286 8:88029095-88029117 AAGTAGAGAATAGATTTTGAAGG + Intergenic
1044492292 8:92833757-92833779 AGGAAGAGACAAGTTAGGGAAGG + Intergenic
1046628221 8:116597892-116597914 AGGCAGAGTCTAGATAGGGCTGG + Intergenic
1047006896 8:120630136-120630158 AGGTAGAGACTGGATCTGAAGGG - Intronic
1047360186 8:124162065-124162087 ACGGAGAGACTATATGGGGAAGG + Intergenic
1048321663 8:133405033-133405055 AGGCAGAGATTAGAGTGGGTGGG - Intergenic
1049216039 8:141408867-141408889 CGCTAGAGACTAGAGTGAGAAGG + Intronic
1051336720 9:16072283-16072305 AGGAAGACACTAAATTGAGAAGG - Intergenic
1051608575 9:18940090-18940112 AAGTAGAGACTCCATGGGGAGGG + Intronic
1052011390 9:23413828-23413850 AGGAAGAGACTAGAATGAGATGG - Intergenic
1052260012 9:26503855-26503877 AGGTAAAGAAGAGGTTGGGAAGG - Intergenic
1052300221 9:26945590-26945612 TGGTAGAGAATAGATTGAGAAGG - Intronic
1052454500 9:28678045-28678067 AGGTAGAGAATAGATTGAAAGGG - Intergenic
1053206134 9:36188143-36188165 AGATGGAGACTAGAGAGGGAAGG - Intergenic
1055870311 9:80869595-80869617 AAGTAGTGACTGGATTGGGAAGG - Intergenic
1057303895 9:93901648-93901670 GGGCAGAGACTCGATGGGGATGG + Intergenic
1058345544 9:103956787-103956809 GGGTAGAGAGTAGATCAGGAAGG - Intergenic
1058645319 9:107126831-107126853 AGGTTGAGACCAGATTGTTAGGG - Intergenic
1059907581 9:119005382-119005404 AGGAGGAGACTAGACTAGGAAGG - Intergenic
1060959966 9:127673426-127673448 TGGTAGGGACTAGATTGGTCTGG + Intronic
1186072599 X:5838593-5838615 AGCTAGAGACTAGATGGGAGTGG - Intergenic
1186232853 X:7474703-7474725 AGATAGAGACTAGATTAGATAGG - Intergenic
1186814707 X:13225086-13225108 AGGTAGAGACTGGAGTGATAGGG - Intergenic
1187751227 X:22467244-22467266 AGCTAGAGAGTAGAATGGGCTGG - Intergenic
1187981758 X:24764910-24764932 GGGTTGAGAATAGATTGGGGGGG - Intronic
1187998639 X:24956972-24956994 ATGAAAAGACCAGATTGGGATGG + Intronic
1189554699 X:42130070-42130092 GGGTAGAGAATGGATTGGAAGGG + Intergenic
1189670665 X:43404908-43404930 GGGTATAGAATATATTGGGAAGG + Intergenic
1190571714 X:51789247-51789269 ACGTTGAGACTAAATTTGGATGG + Intergenic
1191015461 X:55805228-55805250 TGGCAGAGACTGGATAGGGATGG - Intergenic
1191834264 X:65447110-65447132 AGAGGGAGATTAGATTGGGAAGG - Intronic
1192615796 X:72620821-72620843 AGGTAGGGGCTAGTTTAGGATGG + Exonic
1193211864 X:78816303-78816325 AGGCAGGGACCAGGTTGGGAAGG + Intergenic
1196823416 X:119721886-119721908 GTGTAGAGAATAGATTGGCAGGG - Intergenic
1196834159 X:119799349-119799371 AGCTGGAGAGTAGATGGGGATGG + Intergenic
1197503874 X:127277519-127277541 ATGTAGAGAAGAGATTGGGGAGG - Intergenic
1199123633 X:144088397-144088419 AGGAAGAGAGTTGATTGTGAGGG + Intergenic
1200830918 Y:7688337-7688359 GGTTAGAGAGTAGAGTGGGAAGG - Intergenic