ID: 952407220

View in Genome Browser
Species Human (GRCh38)
Location 3:33015421-33015443
Sequence CTGCTCTATTTGTTCCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952407218_952407220 -2 Left 952407218 3:33015400-33015422 CCTCAGACCTGAATTCAGAAGCT 0: 1
1: 0
2: 3
3: 20
4: 237
Right 952407220 3:33015421-33015443 CTGCTCTATTTGTTCCACACAGG 0: 1
1: 0
2: 0
3: 5
4: 114
952407219_952407220 -9 Left 952407219 3:33015407-33015429 CCTGAATTCAGAAGCTGCTCTAT 0: 1
1: 0
2: 1
3: 9
4: 183
Right 952407220 3:33015421-33015443 CTGCTCTATTTGTTCCACACAGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952407220 Original CRISPR CTGCTCTATTTGTTCCACAC AGG Intronic
901305148 1:8227375-8227397 CTGCCCTAACTGTTCCCCACAGG - Intergenic
909232798 1:73113220-73113242 CTGCTCTTTTTTTTCCTTACTGG - Intergenic
909745192 1:79086874-79086896 TTACTCTATTTTTTCCCCACTGG + Intergenic
919527909 1:198677919-198677941 CAGCTTTTTTTTTTCCACACAGG + Intronic
921670812 1:217921888-217921910 CTGCTCTATCTGTTCCCGGCAGG - Intergenic
922178705 1:223216797-223216819 AGGCTCTAAATGTTCCACACAGG + Intergenic
924786002 1:247200467-247200489 CTGCTCTATTTACCTCACACAGG + Intergenic
924904754 1:248440596-248440618 CAGCTCTTTTTATTCAACACAGG + Intergenic
924923133 1:248651453-248651475 CAGCTCTTTTTATTCAACACAGG - Intergenic
1063525365 10:6779587-6779609 CTGCTTTATTTTAGCCACACTGG - Intergenic
1064513219 10:16117839-16117861 CAGCTGTATTTGATACACACAGG - Intergenic
1071054169 10:81490122-81490144 TGGCTCTAATTGTTCTACACTGG - Intergenic
1073680933 10:105702784-105702806 TTGCTCTTTTTTTTTCACACTGG - Intergenic
1074671189 10:115794044-115794066 CTTGTCTACTTGTTCAACACTGG - Intronic
1074749166 10:116567260-116567282 TTCCTTTATTTGATCCACACAGG + Intronic
1079470846 11:20776131-20776153 GTGCTATATTTATTCCCCACTGG - Intronic
1081297511 11:41410116-41410138 CTGCTTTATTTATTCTGCACCGG + Intronic
1083784640 11:64936894-64936916 CTGATCTATTTGTCCAACTCTGG + Intergenic
1084873157 11:72111187-72111209 CAGCTCTGTCTCTTCCACACAGG + Exonic
1085546811 11:77326677-77326699 CTGCTCTGTTTTTTCGAGACAGG - Intronic
1085810289 11:79673957-79673979 CTGCTCCATGTTTTCCATACAGG + Intergenic
1085821219 11:79795635-79795657 CTCCTCTATTTGTTCAACCTTGG - Intergenic
1088689310 11:112311654-112311676 CTGGTCTATTTGTTTCCCTCAGG - Intergenic
1089291352 11:117439495-117439517 CAGCTCTCTTTGTCACACACCGG - Intronic
1090241404 11:125184575-125184597 CTGCTTTCTTCTTTCCACACTGG - Intronic
1092511209 12:9158627-9158649 CTGCTCTGTTTTGTACACACAGG + Intronic
1098907956 12:76180841-76180863 CTGCTCTTCTTGGCCCACACTGG - Intergenic
1099171837 12:79374267-79374289 CTACTTTATTTTTTCCACACTGG + Intronic
1101508852 12:105374878-105374900 CTGCTCTAGATGTTCCTTACAGG - Intronic
1106029055 13:25982891-25982913 CTGTTCTTTTTGTTCCATATAGG + Intronic
1106563906 13:30869532-30869554 CTGCTTTAATTGGTCCTCACTGG - Intergenic
1109155851 13:58907808-58907830 CTGCTTTATTTGTTCAAATCAGG + Intergenic
1109687169 13:65836020-65836042 CTGCTCCAATTGCTCCACATTGG + Intergenic
1110552608 13:76825838-76825860 GTGCTCTTCTTGTTCCACAGAGG - Intergenic
1110940513 13:81342977-81342999 CTGGTCTTTGTGCTCCACACTGG - Intergenic
1111945580 13:94661627-94661649 CTGCTCTCCTTTTTCCAAACAGG - Intergenic
1118530288 14:66697095-66697117 CTCCTATATTTGTCCCTCACAGG + Intronic
1119950182 14:78737168-78737190 ATCCCCTATTTGTTCCACAAAGG + Intronic
1124064634 15:26330188-26330210 CTCCTCTGTTTGCTCCACTCTGG + Intergenic
1125378800 15:39064073-39064095 CTGCTCTACTTGTTTCCTACTGG - Intergenic
1127204885 15:56705409-56705431 CTGCTCTCTTTGCTCCAGACTGG - Intronic
1130450215 15:84043429-84043451 CTGCTCTGTTTTTTCCCCATTGG - Intergenic
1131863587 15:96681471-96681493 CTGTTATATTTGTATCACACTGG + Intergenic
1134810036 16:17159509-17159531 CAGCTGGATTTGTTCAACACTGG + Intronic
1135382157 16:22004305-22004327 CTCCTCTATATGTTTCCCACAGG + Intergenic
1136449078 16:30342597-30342619 CTGCTTAATTTTCTCCACACTGG + Intergenic
1137300727 16:47144792-47144814 CTGCTTTATTTTCTCCACAGCGG + Intergenic
1137595873 16:49723323-49723345 CTGATCCATTGGTGCCACACTGG - Intronic
1139318479 16:66093630-66093652 CTGCTTCAGTAGTTCCACACTGG + Intergenic
1142046349 16:87927462-87927484 CTGCTTAATTTTCTCCACACTGG - Intronic
1145203719 17:20969334-20969356 CTGCTCTGTTTGTACCCCATGGG + Intergenic
1146829772 17:36058440-36058462 CAGCTCTATTTATTTCCCACTGG - Intergenic
1148481171 17:47960380-47960402 CTGTTCTCTTGGCTCCACACTGG + Intergenic
1150200685 17:63353929-63353951 CTCCTCCATTTGTTCCAATCAGG - Intronic
1156339367 18:36197343-36197365 CTGTTCTACATGTTCCAGACAGG - Intronic
1157446952 18:47753306-47753328 CTGCTCATTTTGTTCCAGCCAGG + Intergenic
1158988451 18:62843727-62843749 CGGCTCTGTTTGTTCAACATAGG + Intronic
1162392156 19:10396180-10396202 CTGCTCCATGCGTTCCACCCGGG + Exonic
1163068352 19:14816405-14816427 CTGCTCTATTCTAGCCACACTGG - Intronic
1163961811 19:20703684-20703706 CTTCTCTTTCTGTTGCACACAGG + Intronic
926558424 2:14387907-14387929 CTTCTGTATTTGTCCCAAACTGG - Intergenic
927892499 2:26760680-26760702 CTTCTCTCTTTGTTACAAACAGG + Intergenic
931792637 2:65678618-65678640 CTGCTTTATTCTTCCCACACGGG - Intergenic
935908786 2:107871370-107871392 ATGCTCTATCTGATCCAGACAGG - Exonic
938179790 2:129170038-129170060 TGGCTCTTTTTTTTCCACACTGG - Intergenic
941274310 2:163471439-163471461 CTGCTCTCTTTCTTCAGCACTGG + Intergenic
942543404 2:177038027-177038049 CTGCTCCAGCTGGTCCACACTGG + Intergenic
945873028 2:215247580-215247602 TTTCTCTATCTGTTCCAAACTGG + Intergenic
946901509 2:224377359-224377381 CTGCTCTATTTTAGCCACGCTGG - Intergenic
947966774 2:234288817-234288839 CATCTCTATGTGTTCCCCACAGG - Intergenic
948057627 2:235020489-235020511 CTGCTCTTTTTTTTCCAGACAGG - Intronic
948485252 2:238276687-238276709 CTGCACCCTCTGTTCCACACAGG - Intronic
1173721333 20:45260691-45260713 CTGCTCTGTTTGGGCCACAGAGG - Intergenic
1173787505 20:45805126-45805148 CTTCTCTATTTTTTGCACAGTGG + Exonic
1174288393 20:49488845-49488867 CTGCTCTATTTCAGCCACACTGG - Intergenic
1178217770 21:30620807-30620829 CTGCTCTAGGTGTTCCTCAGTGG - Exonic
1182452562 22:30429947-30429969 CTACTCTTATTGTCCCACACTGG + Intergenic
950573741 3:13818212-13818234 CCTCTCTATTTATTCCAAACTGG + Exonic
951849746 3:27125990-27126012 CTTCTCTACTTGTTCAAAACAGG + Intronic
952407220 3:33015421-33015443 CTGCTCTATTTGTTCCACACAGG + Intronic
956213539 3:66825740-66825762 CTGCTCTATATGCTGCACAGTGG + Intergenic
957655831 3:83074225-83074247 CTCCTATATTTGTTTCACAAGGG - Intergenic
960629200 3:119712001-119712023 CTGCTCTATGTGTTCTATCCAGG - Intronic
963341586 3:144041038-144041060 CTCATCTATCTGTTCCACAAGGG - Intronic
968696868 4:2034891-2034913 CTGTTCTATGGTTTCCACACAGG + Intronic
969246833 4:5940135-5940157 CTGTTCTCTTTGTCCCTCACTGG + Intronic
975366969 4:73540744-73540766 CTACTCTATTTGTTTGAGACAGG - Intergenic
977203959 4:94148990-94149012 CTGCTCTATTCTTGCCACTCTGG - Intergenic
985684626 5:1275540-1275562 CTGTTCTGTTTCTTCCACTCTGG - Intronic
990121539 5:52460153-52460175 CTTCTCTATTTGTTTCCCAATGG - Intergenic
991437764 5:66614080-66614102 CTGCCCTAATTGTTCCATCCTGG - Intronic
996437847 5:123455242-123455264 CATTTCTAATTGTTCCACACTGG - Intergenic
997318755 5:132960502-132960524 CTGTTTTATTTGTTCCTCTCAGG + Intronic
1004976396 6:20972247-20972269 ATACTCTTCTTGTTCCACACTGG + Intronic
1011722269 6:90169724-90169746 CTGCTCTCTTTGTTCCCTTCTGG + Intronic
1019181885 6:170192531-170192553 CTGCTCTCTTGGGACCACACAGG + Intergenic
1019317953 7:399923-399945 CTGCTGTATCTCCTCCACACAGG + Intergenic
1025222646 7:57128436-57128458 GTGCTCTATTAGTTCCATGCAGG - Intronic
1025720228 7:64003898-64003920 GTGCTCTATTAGTTCCATGCAGG + Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030106723 7:105993773-105993795 TTGCTCTGTTTCTTCCACAATGG - Intronic
1030153517 7:106428980-106429002 CTCATCAACTTGTTCCACACAGG + Intergenic
1030450243 7:109700079-109700101 CTGCTTTATTTTAGCCACACTGG - Intergenic
1033287713 7:140056863-140056885 CTCCTCTTTTTGTCCCACAGGGG - Exonic
1038395329 8:27242066-27242088 CTGGTCTAGATGTTCCCCACAGG + Intronic
1042782128 8:72503232-72503254 CTGCACTGTTTGTCCCACACTGG + Intergenic
1044132103 8:88536322-88536344 CTGCTCAATTTATTGCCCACAGG + Intergenic
1044493880 8:92852959-92852981 TTCCTCTTTTTGTTACACACAGG - Intergenic
1044651614 8:94501476-94501498 TTGCTCAATTTGTTTCCCACAGG + Intronic
1045966989 8:108036295-108036317 CTGCTCCATTTATAGCACACAGG - Intronic
1048482129 8:134807807-134807829 CTGCTCTATTTATTTAACATTGG - Intergenic
1048804067 8:138223080-138223102 CTTCTCTACTTGTGTCACACAGG + Intronic
1051107671 9:13598395-13598417 CTGCTCTATTTGTCAGTCACTGG + Intergenic
1051352685 9:16213349-16213371 CTACTCTATTTGTCCATCACAGG + Intronic
1059623979 9:116040935-116040957 ATGCTCTATTTATTCCTCTCTGG - Intergenic
1188176334 X:26995344-26995366 CTGCTGTGCTTGTTCCACAGTGG - Intergenic
1196384691 X:115136672-115136694 CTGCTCTTTGTTTTCTACACAGG - Intronic
1197017266 X:121640886-121640908 CTGCTATATTAGTTCTACTCAGG - Intergenic
1197265199 X:124362060-124362082 CTGTTCTCTTTGGTCCAAACTGG - Intronic
1200082837 X:153587621-153587643 CTGGTCTATTTCTTACCCACTGG + Intergenic