ID: 952408580

View in Genome Browser
Species Human (GRCh38)
Location 3:33026749-33026771
Sequence CTGAGAGGATGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2154
Summary {0: 1, 1: 0, 2: 16, 3: 216, 4: 1921}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952408580 Original CRISPR CTGAGAGGATGGAGGGAGGA TGG Intronic
Too many off-targets to display for this crispr