ID: 952412856

View in Genome Browser
Species Human (GRCh38)
Location 3:33064935-33064957
Sequence TAGAAGAAGGAGAATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 0, 2: 4, 3: 78, 4: 741}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952412850_952412856 -2 Left 952412850 3:33064914-33064936 CCTTGCAGAGCCAAGAACACATA 0: 1
1: 0
2: 4
3: 20
4: 209
Right 952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG 0: 1
1: 0
2: 4
3: 78
4: 741
952412849_952412856 13 Left 952412849 3:33064899-33064921 CCACAGTATATTAGTCCTTGCAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG 0: 1
1: 0
2: 4
3: 78
4: 741
952412847_952412856 15 Left 952412847 3:33064897-33064919 CCCCACAGTATATTAGTCCTTGC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG 0: 1
1: 0
2: 4
3: 78
4: 741
952412848_952412856 14 Left 952412848 3:33064898-33064920 CCCACAGTATATTAGTCCTTGCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG 0: 1
1: 0
2: 4
3: 78
4: 741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952412856 Original CRISPR TAGAAGAAGGAGAATGGGGC AGG Intronic
901076198 1:6556165-6556187 TAGAAGAGGGAAAAAGCGGCTGG - Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901335408 1:8444758-8444780 TGGAAGAAGGAGCAAGGGGGTGG - Intronic
901757499 1:11450251-11450273 AAGAAGAAGGAGACAGGGACAGG + Intergenic
902192851 1:14775729-14775751 TTGAAGCAGGAGAAAGGGGCAGG + Intronic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902594506 1:17499592-17499614 TAGAAGAATGAAACTGGGCCAGG - Intergenic
903448672 1:23438053-23438075 TGGAAGCAGGAGAGTGGGTCTGG - Intronic
903772170 1:25770805-25770827 GAGAAGAAAGAAAATGGGGGTGG - Intronic
903790576 1:25890210-25890232 CAGAAGAAGGAGCTTGGGGAAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904537181 1:31207594-31207616 AAGAAGAACAAGAGTGGGGCAGG - Intronic
904679035 1:32216027-32216049 TAGGAGCAGGAGAACGGGGAGGG - Exonic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
904941735 1:34168399-34168421 CAGGAGGAGGAGGATGGGGCTGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906390326 1:45409794-45409816 AAGAAGAAAGGGAATGCGGCAGG + Intronic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
907088438 1:51701233-51701255 TAGAAGAATTACAATGGGCCGGG - Intronic
907163596 1:52390498-52390520 TAGAAGAATGAAACTGGGGCCGG + Intronic
907166819 1:52419371-52419393 AAGAAGAAGAAGAATGGGTTTGG + Exonic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907430623 1:54409191-54409213 TAGAAGAAGGGAACTGAGGCAGG - Intronic
907632385 1:56095670-56095692 GAAAAGAAGCAGGATGGGGCAGG - Intergenic
907659745 1:56381055-56381077 TAGAAGAAGGAGAAAGGAATGGG + Intergenic
908125877 1:61029835-61029857 AAGAAGAAGAAGTATGGGCCAGG + Intronic
908909474 1:69056393-69056415 TTGAAGAAGTAAAAAGGGGCCGG + Intergenic
909347032 1:74602424-74602446 TAGAAGAAGGCAAATGGGATGGG - Intronic
910080419 1:83334910-83334932 TAGCAGAACTAGAATGGGCCAGG + Intergenic
910793269 1:91072989-91073011 AAGAAGAAGAAGAATGTGACTGG + Intergenic
910867613 1:91802654-91802676 TAGAAAAAGAAGTATGGGCCAGG - Intronic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911483949 1:98482352-98482374 AAGAGGGAGGGGAATGGGGCTGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912436601 1:109666534-109666556 TGAGAGAAGGAGAATTGGGCAGG - Intronic
912438660 1:109681000-109681022 TCAGAGAAGGAGAATTGGGCAGG - Intronic
912441181 1:109699445-109699467 TCAGAGAAGGAGAATTGGGCAGG - Intronic
913300042 1:117360846-117360868 TAGAGGAAGGAGAAAGGGCATGG - Intergenic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
914724092 1:150312887-150312909 TAAAATAAGGATAATGGGGCCGG + Intergenic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
915404214 1:155647041-155647063 TACAAGAAAGTGAATGAGGCTGG + Intergenic
915415294 1:155737338-155737360 TTCAATAAGGAGAATGTGGCAGG - Intronic
915672637 1:157503378-157503400 TATAAGAAAGAGAACTGGGCCGG + Intergenic
916740045 1:167639787-167639809 TAAAACAATGAGAATGGGCCGGG - Intronic
917345326 1:174022750-174022772 TGGAAGAAGAAAAATGGGGTGGG - Intergenic
917829654 1:178866929-178866951 TAGCAGAAGTAGAATGGGTAAGG + Intronic
918202856 1:182283492-182283514 TAGAAGAAGGAGCATAGATCAGG + Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920530359 1:206697519-206697541 GAGAAGAGGGAGCATGGGGGTGG + Intronic
920550623 1:206857670-206857692 TTGAGGATGGAGAATGTGGCAGG - Intergenic
920708299 1:208271408-208271430 TGGCACAAGGAGCATGGGGCTGG + Intergenic
920870245 1:209788172-209788194 TAGTAGAAGGAGATTTGGCCTGG - Exonic
921595447 1:217049297-217049319 TCCAAGAAGGAGAATGAAGCCGG + Intronic
921595724 1:217051758-217051780 TAAAAAAAGGAGTATGGGGATGG - Intronic
921604686 1:217139197-217139219 TATAGGCAGGAGAATGAGGCGGG + Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922029829 1:221787215-221787237 AAGAAAAAAGAGAATGGGACTGG + Intergenic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
923023741 1:230187935-230187957 TACAAGATGGAGGGTGGGGCGGG + Intronic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923227303 1:231949956-231949978 GAGGATAAGGAGACTGGGGCTGG - Intronic
923329267 1:232907481-232907503 AAGAAGAAGAAGTAAGGGGCTGG + Intergenic
923436017 1:233968810-233968832 TAGAAGAGGGAGAGTGGGAGGGG - Intronic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923688935 1:236174683-236174705 TAGAAGAGGGACACTGGGGCTGG + Intronic
924015035 1:239711927-239711949 TAGCTAAAGGGGAATGGGGCTGG - Intronic
924196955 1:241618115-241618137 TAGTAGAATGTGAATGGGTCTGG - Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924683373 1:246260725-246260747 TTCAAGAAGGAAAATGGGGCTGG - Intronic
1062764495 10:50387-50409 AAGAAGAACGAAAATGGGCCAGG - Intergenic
1062858183 10:789995-790017 GCGAACAAGGAGCATGGGGCTGG - Intergenic
1062900404 10:1140929-1140951 TTGAAAAAAGAGAATGGGGCTGG + Intergenic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1064452225 10:15452964-15452986 TGGAGGAAGAAGAATGGGGCTGG + Intergenic
1064708298 10:18095521-18095543 CAAAAGAAAGAGAATAGGGCCGG - Intergenic
1065858973 10:29854843-29854865 TGGAAGAAGGAGAAAGGGCGTGG - Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1066364179 10:34760625-34760647 TATTAGAAGTAGAATGGGGCTGG - Intronic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1067521211 10:47007773-47007795 TTGAAGAAAGAAAATGGGGAGGG + Intergenic
1069473114 10:68710632-68710654 AAGAAGAAGAAGAAAGGGCCAGG - Intergenic
1069739514 10:70678637-70678659 TGGAAGAAGGGGTGTGGGGCAGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072145881 10:92636734-92636756 TAAAAAATGGAGAATGGGGCCGG + Intronic
1072456907 10:95584454-95584476 TAGAACAAGGAGTATGGGCCAGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073012848 10:100374709-100374731 TAGAATAAGAAGATTTGGGCAGG + Intergenic
1073255619 10:102149154-102149176 TAGTAGGAGGAGAGTGAGGCAGG - Intronic
1073546523 10:104353945-104353967 TAGGAGAGGGACAATGGGGAGGG - Intronic
1073998329 10:109341424-109341446 TAGGAGGAGAAGAATGGGGCGGG + Intergenic
1074411839 10:113235403-113235425 TTGAACAAGGAGAATGGGGGTGG + Intergenic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074856099 10:117474664-117474686 TAGGAGATGGAGGATGGGGATGG + Intergenic
1075148042 10:119899992-119900014 GAGAAGCAGGAGGAAGGGGCAGG - Intronic
1075980739 10:126737017-126737039 GAGAAGGAGGAGAATGGAGAGGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076131213 10:128015245-128015267 TATCAAGAGGAGAATGGGGCCGG + Intronic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076241768 10:128914033-128914055 GAGTAGAGGGAGAACGGGGCAGG + Intergenic
1076475458 10:130748666-130748688 TATAAACAGGAGAACGGGGCAGG + Intergenic
1076749113 10:132533385-132533407 TAGGAGGAGGAAAATCGGGCAGG + Intergenic
1077346038 11:2054483-2054505 TAAAAAAATGAGAATGGGCCAGG - Intergenic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1077778648 11:5300341-5300363 GGGAAGAAGGAAAACGGGGCTGG + Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078738178 11:14041185-14041207 GGGAAGAAGGAGGATGGGGGAGG - Intronic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1079795918 11:24802895-24802917 TAGAAGAAGGAGAAAGGATGAGG - Intronic
1079841414 11:25404820-25404842 TAGAAGAAAGAATATGGGGAGGG + Intergenic
1079841473 11:25406036-25406058 TAGAAGAAAGAATATGGGGAGGG - Intergenic
1080386069 11:31811817-31811839 TGGAAGAAGAGGAAAGGGGCGGG + Intronic
1080700091 11:34637324-34637346 GAGAAGCAGGCGCATGGGGCTGG + Intronic
1080708132 11:34718769-34718791 TAAAAGAAGGCCAATGTGGCTGG + Intergenic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1082783567 11:57304225-57304247 AAGCAGGAGGAGAGTGGGGCAGG + Intronic
1083244960 11:61419747-61419769 TAGAAGAAAGAGCATTGTGCTGG - Intronic
1083570606 11:63760121-63760143 TAGAAGAATGAGGAGGGGTCAGG + Exonic
1084171964 11:67405176-67405198 TACAAGAAGGTGAGGGGGGCAGG + Exonic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084427056 11:69090001-69090023 TAAATGAAAGAGAAAGGGGCAGG - Intronic
1085047314 11:73360998-73361020 GGGAGGAAGGGGAATGGGGCAGG + Intronic
1085129290 11:74024054-74024076 TAGAAGCAGGGGAATGGGATAGG - Intronic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1085843217 11:80037557-80037579 AGGAAGAAAGAGAATGGGGTAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087204244 11:95377399-95377421 GAGAAGGAGTAGAAAGGGGCAGG - Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088572067 11:111231880-111231902 TAGAAAAGAGAGAACGGGGCAGG - Intergenic
1088591957 11:111411226-111411248 GAGTAGAAGGAGAAAGGAGCAGG - Intronic
1088822881 11:113471474-113471496 GAGAAGAGGGAAAATGGTGCTGG + Intronic
1089370011 11:117948660-117948682 TAGAAGAAGGATGTTAGGGCCGG + Intergenic
1089372097 11:117968389-117968411 TAGAAAAAGGACATTAGGGCTGG - Intergenic
1089553759 11:119302877-119302899 TAGATTATGCAGAATGGGGCTGG - Exonic
1089715216 11:120352928-120352950 AAGAAGAAGGGGAATGGGCTGGG - Intronic
1089798956 11:121007804-121007826 TAACAGAAGGAGAAAGGGGCTGG + Intergenic
1089855616 11:121541795-121541817 TCGAAGAAGGAGAAGAGGGACGG - Intronic
1089910946 11:122100478-122100500 TAGAGGACGGAGAACGGGGGCGG + Intergenic
1090017803 11:123101516-123101538 GAGATGAAGAAGAATGGAGCAGG + Intronic
1090093231 11:123718019-123718041 TAAAAGAAGGCTGATGGGGCCGG - Intergenic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090893655 11:130950178-130950200 TCAAATATGGAGAATGGGGCAGG - Intergenic
1090920112 11:131199370-131199392 TTGAAGCAGGATAATGAGGCTGG - Intergenic
1091311758 11:134579879-134579901 GGGAAGAGGGACAATGGGGCTGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091828569 12:3533502-3533524 TAGAAGAAGAAGAATGGTCTTGG - Intronic
1091918862 12:4288623-4288645 TAAACGAAGGAGACTGAGGCAGG - Intronic
1092033387 12:5309001-5309023 TAGAGGCAGAATAATGGGGCTGG - Intergenic
1092091859 12:5810209-5810231 TAGAGGAGGAGGAATGGGGCAGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092239706 12:6829141-6829163 GAGCAGAATGGGAATGGGGCGGG + Intronic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092930614 12:13312137-13312159 TGGAAGCAGGAGAATTGGGTGGG - Intergenic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1093251514 12:16810508-16810530 TAAAAGGAAGAGAATGGGGAAGG - Intergenic
1094192602 12:27712237-27712259 GGGAAGAAGGACAATGTGGCAGG + Intronic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1094676502 12:32626146-32626168 TAAAAGATTGAGAAAGGGGCTGG + Intronic
1095114044 12:38331172-38331194 TTGAGGCAGGAGAATCGGGCAGG + Intergenic
1095307281 12:40653010-40653032 TAGGAGAAGCAGGTTGGGGCAGG - Intergenic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096263579 12:50107363-50107385 TCGAGGAGGGAGTATGGGGCAGG + Intronic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096925055 12:55135236-55135258 TAGAAGAGGGATCATTGGGCTGG - Intergenic
1096995148 12:55833632-55833654 TTGAGGAAGGAGAGTGGGGGAGG + Intergenic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098434862 12:70457873-70457895 TAGAAGAAAGAAAATTTGGCTGG + Intergenic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098523531 12:71460743-71460765 GAGAGGAGGAAGAATGGGGCTGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099202934 12:79695922-79695944 TAAAAGAAAGAGAATAGGCCAGG - Intergenic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1100904639 12:99283856-99283878 TAAAAGCAGGAGATTGTGGCAGG - Intronic
1101711497 12:107271202-107271224 TAGAATTAGGAGAGTGGGGAGGG - Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101833514 12:108278227-108278249 TGGAAGAAGGGGAATGGGTTAGG - Intergenic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102570000 12:113821618-113821640 TAAAAGCTGGAGAATGTGGCTGG + Intronic
1102575615 12:113854453-113854475 TGGGGGAAGGAGAATGGGGGTGG - Intronic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103139959 12:118539943-118539965 TAGAAGAAAGGGAATGGTGCTGG + Intergenic
1103276423 12:119715526-119715548 TAGTGGAAGGAGAATGGCGGGGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103858857 12:123995550-123995572 TTGGAGAAGGAGAATGGAGGTGG + Intronic
1104402421 12:128487240-128487262 TAGAACAAGGAGGATGGGTGAGG - Intronic
1104604331 12:130176940-130176962 TAAGAGAAAGAAAATGGGGCTGG + Intergenic
1104706359 12:130950527-130950549 TAGAAAAAAGAAAATCGGGCCGG + Intergenic
1104792096 12:131489747-131489769 AAGAGAAGGGAGAATGGGGCAGG + Intergenic
1105300379 13:19128605-19128627 TAGAAGGAGGAGAATTGGCCTGG - Intergenic
1105401695 13:20101928-20101950 TGGAAGCAGGAATATGGGGCAGG - Intergenic
1105544124 13:21339456-21339478 CTGAAGAATGAGGATGGGGCGGG - Intergenic
1105585216 13:21737294-21737316 AAGAAGCAGGAGAAAGGAGCAGG - Intergenic
1106207987 13:27617252-27617274 TAGAATTAGAAGACTGGGGCAGG - Intronic
1106319588 13:28625064-28625086 TGGAAGAAGGAGAAAGGGAGGGG + Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1109295867 13:60530059-60530081 TGTAAGTAGGAGGATGGGGCAGG - Intronic
1110208122 13:72942049-72942071 TAGAGGCAGAAGAATGGGTCAGG - Intronic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111590058 13:90334602-90334624 TAGAAAAAGAAATATGGGGCGGG - Intergenic
1111942773 13:94630630-94630652 TTGATGAAGGACAATGAGGCTGG - Exonic
1112066900 13:95802749-95802771 CAGAAGAATGAGAGTGGGGTGGG - Intronic
1112268658 13:97948778-97948800 TAAAAGAAGAGAAATGGGGCCGG - Intergenic
1112465897 13:99644641-99644663 TAGAGGAAGGAAACTGGGGATGG - Intronic
1113190338 13:107738467-107738489 TAGAAGAATGAGAAAGTGTCTGG - Intronic
1113499649 13:110763347-110763369 GAGAGGAAGTAGAATGGCGCTGG - Intergenic
1113801228 13:113087391-113087413 AAGAGGGAGGAGAATGGGGAGGG + Exonic
1113878438 13:113608853-113608875 TAGAAAAAGGCGAGTGGGTCTGG - Intronic
1114158900 14:20140413-20140435 TAGCAGGAAGAGAATGGGGAAGG + Intergenic
1114411437 14:22504385-22504407 TAGAAGAAGGAAGCTGGGGCCGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114684398 14:24514272-24514294 TAGAAGTAGAAGAAAGGGGATGG + Intergenic
1115275658 14:31606046-31606068 AAGAAGAAGAAGAATGGAGGAGG - Intronic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1116317317 14:43415188-43415210 TAAAAGAAAGAAAATGGGGCTGG + Intergenic
1118263018 14:64265826-64265848 TAAAAGAAGCAGGATGGTGCAGG + Intronic
1118620427 14:67609785-67609807 GAGAAGAAGGGGAAGGGGGTGGG + Intergenic
1118652918 14:67916880-67916902 TAGAGGACGGAGGATGGGGGAGG + Intronic
1118779270 14:68995791-68995813 TAGAGGAAAGAGAATTGGGAGGG - Intergenic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1119213136 14:72847804-72847826 TAAAGAAAGGAGAATGAGGCTGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120361109 14:83503371-83503393 TGGAAGATGGAAAATGTGGCTGG - Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121494364 14:94381725-94381747 CAGAAGGAGGAGACTGGGGCTGG + Intronic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122359934 14:101153112-101153134 GGTAAGAAGGACAATGGGGCAGG - Intergenic
1123458981 15:20451139-20451161 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1123659081 15:22549279-22549301 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124312945 15:28643771-28643793 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124505213 15:30266794-30266816 TAAAAGATACAGAATGGGGCCGG + Intergenic
1124738339 15:32271841-32271863 TAAAAGATACAGAATGGGGCCGG - Intergenic
1124872126 15:33553589-33553611 TAGAATAAGGAGCAAGGAGCAGG + Intronic
1124915447 15:33966622-33966644 TGGATGAAAGAGAATGGGGGTGG - Intronic
1125441909 15:39711981-39712003 TAGAAGAAGTAGGAATGGGCTGG - Intronic
1126336146 15:47588231-47588253 CAGAGGAAGGATAGTGGGGCAGG - Intronic
1128186483 15:65647179-65647201 TAAAAGAGAGAGAATCGGGCCGG + Intronic
1129735901 15:77963074-77963096 TAGAAGAAGAAACCTGGGGCTGG - Intergenic
1130115867 15:81003365-81003387 TGGAAGAAGGGGTATGGGGGTGG - Exonic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130406311 15:83605213-83605235 TAGAAGAAGCAGCCTGGGACAGG - Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1131202770 15:90414212-90414234 TGGGAGATGGAGAAGGGGGCGGG + Intronic
1132533438 16:465477-465499 TGGAGGAGGGAAAATGGGGCAGG + Intronic
1132861037 16:2071926-2071948 TTGAAGCAGGTGAGTGGGGCCGG + Exonic
1132906893 16:2287085-2287107 TAGGAGAAGGGTGATGGGGCGGG - Intronic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133346581 16:5075197-5075219 TAAAAGAAACAGAATGGGCCAGG - Intronic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133900907 16:9973479-9973501 TACAAGAAAGAGAATGGAGAAGG + Intronic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1134148624 16:11787995-11788017 TAAAAAAAGGAGTATGGGGCTGG - Intronic
1134287181 16:12872035-12872057 AAGAAGAAGGAGGAGGGGGGAGG - Intergenic
1134509817 16:14836999-14837021 TAAAATAAGTAAAATGGGGCCGG - Intronic
1135380424 16:21991693-21991715 TAGATAAAAGATAATGGGGCTGG + Intronic
1135505037 16:23029020-23029042 GAGAAGAAGGAGACCTGGGCAGG - Intergenic
1136703408 16:32164418-32164440 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1136764291 16:32763181-32763203 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1136803807 16:33107205-33107227 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1137354145 16:47743121-47743143 AAGAAGGAGAAGAATGGGGCTGG - Intergenic
1137552208 16:49445367-49445389 TGGAAGAAGGAGAAGGTGTCAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1138176181 16:54900237-54900259 TAGAAGGAGAAGCATGGGACTGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1139477615 16:67210504-67210526 TTGCAGAAGGAGAACTGGGCGGG + Exonic
1139623951 16:68170094-68170116 TAGAAAATGCAAAATGGGGCTGG + Intronic
1140017560 16:71202844-71202866 TACCAGAAGGAGAATAGGGGAGG - Intronic
1140304483 16:73790118-73790140 TAGAGGAGGGAGAATTGGGTTGG + Intergenic
1140779598 16:78282578-78282600 TAGAACAGGGAAAATGTGGCCGG + Intronic
1141198329 16:81878278-81878300 TAAAAGAGGGAGATTTGGGCCGG - Intronic
1141206356 16:81935841-81935863 TAGAAGAGGGAGAATGGGAATGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141533549 16:84663168-84663190 TAGAAGCAGAAAACTGGGGCAGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203066648 16_KI270728v1_random:1025305-1025327 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1143385160 17:6524898-6524920 TTGAAGAAGGAGTATATGGCTGG - Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1145240319 17:21237126-21237148 TTGAAGAAGGAGATGTGGGCTGG - Intergenic
1145994453 17:29097409-29097431 GAGGGGAAGGAGGATGGGGCAGG + Intronic
1146801500 17:35827408-35827430 AAGAAGAAGGGGCATGGGCCAGG + Intronic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147547870 17:41417192-41417214 TGGTAAAAGGAAAATGGGGCCGG - Intergenic
1147775511 17:42898097-42898119 TGGAGGAAGCAGAAAGGGGCTGG + Intergenic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148549637 17:48542909-48542931 TAGAAGAAGAAGAAAGGGAGTGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148706447 17:49637645-49637667 TAGAAGAACTAGCTTGGGGCTGG - Intronic
1149107184 17:52983528-52983550 GAGGAGAAGGATTATGGGGCAGG + Intergenic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151410819 17:73927221-73927243 AAGAAGAAGGAGAGAGGGACGGG + Intergenic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152439199 17:80295164-80295186 TAAAAGGAGGAAAATGGGGGAGG - Intronic
1152478787 17:80536423-80536445 AAGAAAAAGAAAAATGGGGCCGG - Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1153021891 18:636921-636943 TTTAAAAAGGAGAAAGGGGCTGG - Intronic
1153440311 18:5110459-5110481 AAGAAGCAGGAGGATGGGGTGGG + Intergenic
1153720128 18:7893394-7893416 TAGAACAAGTAGAATGGGAAAGG - Intronic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155398469 18:25412773-25412795 TAGAATAAGGAGATTTGAGCAGG + Intergenic
1156659333 18:39328178-39328200 AAGACGAAGGAGAATAGGGAAGG - Intergenic
1156920270 18:42513887-42513909 TAGAGGAAGGGGAATTGAGCAGG - Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1157357643 18:46950071-46950093 TAGATTAGGGAGAATGTGGCTGG - Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157707147 18:49816694-49816716 TAGAAAAAGAATAATGGGCCAGG - Intronic
1158605797 18:58895033-58895055 GAAAAGAAGGAGAATGGCTCAGG - Intronic
1159664709 18:71144165-71144187 TAGAAGTAAGAGAATGAGGAAGG - Intergenic
1160055657 18:75477532-75477554 GACAAGGAGGAGAATGGGGTGGG - Intergenic
1160209360 18:76863254-76863276 TAGGAGAAAGAGTGTGGGGCTGG + Intronic
1160280332 18:77484352-77484374 TAGCAGCAGGAGAAAGGGACTGG + Intergenic
1160413545 18:78690648-78690670 TAGAAGCAGGGGGATGAGGCAGG + Intergenic
1160444104 18:78914010-78914032 GAGAAGAATGAGCCTGGGGCAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160983431 19:1827035-1827057 GAGGAGGAGGAGGATGGGGCGGG + Exonic
1161485146 19:4531548-4531570 TAGACCAAGGAGGATGGGACAGG + Intronic
1161912864 19:7207626-7207648 TAAAGAAAGGAGAATGGGCCGGG + Intronic
1162082980 19:8230123-8230145 GAAAGGAAAGAGAATGGGGCAGG - Intronic
1162831733 19:13288849-13288871 TAAAATGAGGAGAATGGTGCTGG - Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1164039851 19:21484543-21484565 CAGAAACAGGAGGATGGGGCCGG - Intronic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164148742 19:22530559-22530581 GAGAAGCGGGAGAATGGGTCTGG - Intronic
1164264552 19:23601716-23601738 TATAAGAAGTAGAATTGGCCAGG - Intronic
1164973023 19:32548755-32548777 AAGAAAAAGGTGAATGTGGCCGG + Intergenic
1165279719 19:34785722-34785744 GAGAAGCGGGAGACTGGGGCAGG + Intergenic
1165669331 19:37662239-37662261 TTGGAGTAGGAGAGTGGGGCAGG + Intronic
1165836359 19:38759049-38759071 TAAAAGATGGAAAATGGGCCAGG - Intronic
1167230222 19:48278230-48278252 TTTAAGAAGGTGAATTGGGCCGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167786633 19:51643212-51643234 AAGTAGAAGGGGTATGGGGCAGG + Exonic
1168164701 19:54538677-54538699 TAGAAGATGGACAATAAGGCTGG - Intronic
1168172452 19:54597550-54597572 TAGAAGAGGGAGAACAGGTCGGG + Intronic
1168259894 19:55187439-55187461 TAGGAGAAGGGGACTGGGGTGGG + Intronic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925188027 2:1862891-1862913 GAGAAGAAGGAGAAAGGAGGAGG + Intronic
926109373 2:10172268-10172290 GAGATGAAGGAGGCTGGGGCTGG + Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926802903 2:16676149-16676171 GAGAAGAATGGCAATGGGGCTGG - Intergenic
927070766 2:19526975-19526997 TAGAATAGGGAGAATGGGCCAGG + Intergenic
927372623 2:22374373-22374395 TAGAAGATGCAGATTTGGGCAGG - Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927715654 2:25350511-25350533 AAGAAGAAGAAGAATGGCACTGG - Intergenic
928177810 2:29046882-29046904 TAGAGGAAGAAGAATGGAGAAGG - Intronic
928218394 2:29381666-29381688 TTGAAGGAGGTGAATAGGGCTGG - Intronic
928387321 2:30881480-30881502 TACACGAAGGAGGAAGGGGCCGG + Intergenic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
929043149 2:37766049-37766071 TAGAAGAAAGAAACTGGTGCTGG - Intergenic
930932858 2:56909686-56909708 TAGAAAAACCAGAATGGGCCGGG + Intergenic
932157538 2:69432276-69432298 TATAAGAAACAGAATTGGGCTGG + Intronic
932299216 2:70653935-70653957 AAGAAGCAGGAGAATGGTTCAGG - Intronic
932790779 2:74653167-74653189 TTGAAGAAGGAGCTAGGGGCCGG + Intergenic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933883162 2:86692219-86692241 TATAAAAAGGATAATGTGGCTGG + Intronic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934904859 2:98190941-98190963 TAGAAGAAGGAGAAGAGAGGGGG - Intronic
935312830 2:101802445-101802467 TAGAAGGAGGAGAGGAGGGCTGG - Intronic
936538881 2:113334080-113334102 TAGGAGAAGGACAAGGGGTCAGG + Intergenic
937249554 2:120514987-120515009 AAGAAGAGGGGGAATGGGGGAGG - Intergenic
937250876 2:120522914-120522936 AAGAACAAGCAGCATGGGGCTGG + Intergenic
937272842 2:120664836-120664858 GATAAGAGGGAGAATGGAGCAGG + Intergenic
937426796 2:121806654-121806676 TTGAAGATGGAGGAAGGGGCTGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938232935 2:129677617-129677639 TAGGAGAATGAGGGTGGGGCTGG - Intergenic
939166438 2:138645950-138645972 GAGAAAAGGGAGACTGGGGCTGG + Intergenic
939566366 2:143790646-143790668 GAGAAGAAAGATAATGGAGCAGG + Intergenic
939985600 2:148826947-148826969 TGGACCAAGGAGAATGGAGCTGG + Intergenic
939987010 2:148839421-148839443 GAGAAGAAAGAGAAAGGAGCAGG - Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940135014 2:150425797-150425819 CAGAGGAAGGAAACTGGGGCAGG - Intergenic
940253721 2:151707514-151707536 TAGGAGGAGGAGGATGGAGCAGG + Intronic
940311384 2:152282638-152282660 TAGAAGAAGGCTAGTGGGGCTGG - Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941718338 2:168787023-168787045 TAGAAGAAAGAATTTGGGGCCGG - Intronic
941749570 2:169120479-169120501 TAGAAGAACCAAAATAGGGCTGG + Intergenic
942020505 2:171863228-171863250 TATAAGAAGAAAAATGGGCCAGG + Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
942863683 2:180646930-180646952 TCCAAGAAGAAGAAAGGGGCAGG + Intergenic
943503415 2:188721596-188721618 TAGAGGAAGCAGGATTGGGCAGG - Intergenic
943577909 2:189653047-189653069 TTGAAGCAGGAGAATCAGGCAGG - Intergenic
943621711 2:190155522-190155544 TAGAGGAAGCTGAATGGGGTGGG + Intronic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944165682 2:196717593-196717615 AAGAAGCAGGATAAAGGGGCGGG + Intronic
944896016 2:204165645-204165667 TAGAATCAGGAGAGTGGGCCTGG + Intergenic
945041917 2:205749536-205749558 TAGTAGAATGAGAATGGTCCTGG - Intronic
945061795 2:205915812-205915834 TTGAAGATGGAGGAAGGGGCAGG - Intergenic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945528927 2:210925926-210925948 TAGCACAAGGAGACTGTGGCAGG - Intergenic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946094180 2:217258257-217258279 TAGAATAAAGATAAAGGGGCTGG + Intergenic
947142145 2:227029288-227029310 AAGAGGAAGGAGGAAGGGGCTGG - Intronic
947707422 2:232287686-232287708 ATTAAGAAGGAAAATGGGGCTGG - Intronic
948040249 2:234895988-234896010 TACAAGAAGGTGAGTAGGGCAGG + Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948229742 2:236341363-236341385 TAGGAGGAGGAGAAAGGAGCGGG + Intronic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
949050463 2:241895030-241895052 TAGAAGTTGGAGAGTGGGGTGGG + Intronic
1168731132 20:82021-82043 TAAAAGAAGGAGAAATAGGCTGG + Intergenic
1168763862 20:368577-368599 AAGAAGATGAAGAATGGGCCGGG - Intronic
1169004223 20:2193496-2193518 TAGATTGAGTAGAATGGGGCTGG + Intergenic
1169046823 20:2539870-2539892 AAGAAGAAAGAGGTTGGGGCAGG + Intronic
1169187363 20:3630014-3630036 TCCAAGAAGGGGAAAGGGGCTGG - Intronic
1170045877 20:12084942-12084964 TTGAAGATGGAGGAAGGGGCCGG - Intergenic
1170140719 20:13122991-13123013 TAGAACTGGGAGCATGGGGCGGG - Intronic
1170456862 20:16541729-16541751 GAAAAGAAGGAGACTGAGGCAGG + Intronic
1171188106 20:23137663-23137685 GAGAAGGAGGCTAATGGGGCAGG + Intergenic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172387175 20:34542201-34542223 TCCAAGAAGGATAATGGGGAAGG + Intergenic
1174197842 20:48786047-48786069 CAGCAGGAAGAGAATGGGGCTGG + Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174543278 20:51306451-51306473 TTGAAGCAGGAGCATGGGGCTGG + Intergenic
1175152723 20:56947665-56947687 TGGAAGTAGGAGGAAGGGGCTGG + Intergenic
1175530363 20:59670752-59670774 TAGAAGATGGAACATGGAGCAGG - Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1179182971 21:39061245-39061267 TAGAAGCAGGAGGACGGAGCAGG + Intergenic
1180207138 21:46267898-46267920 TAAAAAAAAGACAATGGGGCTGG + Intronic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1180907683 22:19426331-19426353 GGCAAGAGGGAGAATGGGGCTGG - Intronic
1181289178 22:21777762-21777784 TAGAAGAATGAGATTGTGGCCGG - Intronic
1181642009 22:24206609-24206631 TAGAAATAGGTGAATTGGGCCGG - Intergenic
1181817287 22:25448110-25448132 GAGAAGAAGGAAAGCGGGGCCGG + Intergenic
1182043432 22:27256133-27256155 TGGAAGCAGGAGAGTGAGGCAGG - Intergenic
1182463079 22:30495824-30495846 AAGAAACAGGAGAATGGGACAGG + Intronic
1182970331 22:34567768-34567790 TAGAAGAAAGAGGACAGGGCAGG + Intergenic
1183001389 22:34862460-34862482 TGGAAGAGGGGGAATGTGGCCGG - Intergenic
1183068105 22:35377592-35377614 TTGAAGATGGAGGATGAGGCTGG - Intergenic
1183325096 22:37187123-37187145 TAGCAGCAGGAGAAGGGGGCTGG + Intronic
1183491202 22:38116557-38116579 TAGAAAAAGGAGAATCGGCTGGG + Intronic
1183567552 22:38626565-38626587 TCTAAGAAGTAAAATGGGGCCGG + Intronic
1183778819 22:39985410-39985432 CCGAAGAAGGAGAAAGGTGCAGG - Intergenic
1184042340 22:41951560-41951582 TAGATGAGGCAGAATGGGGAGGG + Intergenic
1184264450 22:43339659-43339681 TAGAGTGAGGAGAATGGGGGAGG - Intronic
1184264463 22:43339706-43339728 TAGAATGAGGAGAGTGGGGGAGG - Intronic
1184264489 22:43339800-43339822 TAGAATGAGGAGAGTGGGGGAGG - Intronic
1184441563 22:44519817-44519839 TAGAAGCAGGGGAGAGGGGCTGG - Intergenic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184987885 22:48147762-48147784 CAGAAAAAAGAGAATGGAGCTGG - Intergenic
1185093917 22:48795517-48795539 TGGTAGAAGGAGGAAGGGGCAGG - Intronic
1203324979 22_KI270738v1_random:4862-4884 GAGAAGAAGGAGAGTGGTGGCGG - Intergenic
949890720 3:8731993-8732015 AAGAAGAAAGAGGAAGGGGCAGG - Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952086605 3:29829572-29829594 TAGCTGAAGCAGAATGGGGGAGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952500171 3:33954276-33954298 GAGGAGAAAGAGATTGGGGCAGG + Intergenic
952887749 3:38021976-38021998 TGGAAGCAGGAGACTGGGGAAGG - Intronic
953435079 3:42871602-42871624 TAGAAGGAGGAGAAATGGGCTGG - Intronic
953650789 3:44801326-44801348 TAAAAGAATGAGACTGTGGCCGG - Intronic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
953785293 3:45906864-45906886 GAGAGGCAGGGGAATGGGGCAGG - Intronic
953865012 3:46576367-46576389 TTGAGGCAGGAGAATGAGGCAGG + Intronic
953910719 3:46891584-46891606 AAGAAGAAGGATAGTGGGGAGGG + Intronic
954103687 3:48397821-48397843 AAGAACAAGGAGACTGGGGTGGG + Intronic
954158861 3:48705380-48705402 TATAAGAAGGAAGATGGGGCCGG + Intronic
955740138 3:62081639-62081661 TACAAGAAAGACAAAGGGGCCGG - Intronic
955867186 3:63397485-63397507 TAGAAAAAGGAGAATGCAGGAGG - Intronic
955902668 3:63774093-63774115 TATAAGAAGGAGAAACTGGCCGG + Intergenic
955927198 3:64019007-64019029 AAGAAGGAGGAGACTGGGACAGG - Exonic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956351091 3:68337281-68337303 AGGAAGAGAGAGAATGGGGCAGG + Intronic
956672712 3:71706206-71706228 TAAAAGAAAGAGAATTGGACTGG + Intronic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957785176 3:84873511-84873533 TAGAAAAAGGAGTATTAGGCTGG + Intergenic
958814942 3:98904095-98904117 TACAAGAAGGAGAATTGGTTTGG + Intergenic
959017259 3:101149044-101149066 TGGAAGGAGGAGAATGTGCCAGG - Intergenic
959133296 3:102385254-102385276 TGGAAGAGGCAGAATGGGGGTGG - Intronic
960016806 3:112900204-112900226 TAGAAAAAGGAGTATGTGGAGGG + Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960247156 3:115412476-115412498 CAAAGGAAGGACAATGGGGCTGG - Intergenic
960622189 3:119647762-119647784 TAAAAGAAAAAGAATGTGGCAGG - Intronic
960739282 3:120815109-120815131 TGGAAGAAGCAGGATTGGGCAGG - Intergenic
962246397 3:133797923-133797945 TAGAAGAGGGAGAAGGGGAAGGG + Intronic
962300879 3:134242003-134242025 TATAAGAATGAGAATGAGGCCGG + Intronic
962420756 3:135226613-135226635 CAAAAGTAGGTGAATGGGGCTGG - Intronic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
963362306 3:144289940-144289962 TCCAAGGGGGAGAATGGGGCTGG + Intergenic
964212745 3:154246307-154246329 TTGAACATGGAGAATGTGGCTGG + Intronic
964700801 3:159563977-159563999 TAGGAACGGGAGAATGGGGCAGG - Intronic
964724981 3:159805189-159805211 TAAAAGAAGGAGAGTGGTGTTGG + Intronic
964854499 3:161131662-161131684 TACAAAAAAGAGGATGGGGCTGG - Intronic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965529515 3:169757199-169757221 TAGAAGATGGTGAACTGGGCTGG + Intergenic
965703742 3:171484907-171484929 TAGAGGAAGGAGACTGGGTGCGG - Intergenic
966207663 3:177421473-177421495 AGGAAGAAGAGGAATGGGGCAGG + Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967105976 3:186255400-186255422 TATAAGAAGGTGACTGAGGCTGG + Intronic
967217141 3:187220304-187220326 TGGGAGAAGGAGACTTGGGCTGG - Intronic
967950177 3:194834565-194834587 TGGTAAAAGGAGCATGGGGCCGG + Intergenic
968076277 3:195817425-195817447 AAGAAGAAGGAGGCTGGGCCGGG - Intergenic
968261525 3:197328667-197328689 TCGAATTAGGAGAATGGAGCAGG + Intergenic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969846771 4:9925537-9925559 TGGAAGAACAAGCATGGGGCGGG - Intronic
970694673 4:18663537-18663559 TAGAAGGAGAAAAATGGGCCAGG + Intergenic
971410813 4:26369866-26369888 GAGAAGAGAGAGAAAGGGGCTGG - Intronic
971788296 4:31134164-31134186 TAAAAGAAGTAGAATGGGCCAGG + Intronic
971859450 4:32086006-32086028 TAGCAGAAGGCAGATGGGGCAGG - Intergenic
971897087 4:32610811-32610833 TATAAGAATGAAAATGGGGAAGG + Intergenic
972961529 4:44459059-44459081 TAGAGGAAAGAAAATGTGGCTGG + Intergenic
973992640 4:56425763-56425785 TCCATGAAGGAGAGTGGGGCTGG + Intronic
974941625 4:68476324-68476346 TAGAAGAGGGTGAATGGCCCTGG + Exonic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976022514 4:80646259-80646281 TAAAAGAAAAAGAAAGGGGCAGG + Intronic
976036685 4:80831574-80831596 TAGAAGAATGGGAATAGGTCTGG - Intronic
976376251 4:84348898-84348920 TATCAGAAGGAGACTGGGCCAGG + Intergenic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
977243746 4:94604663-94604685 TAGAAACAGTAGAATGGTGCTGG + Intronic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
979264002 4:118680814-118680836 TAGATAAAGGAGAATAGAGCAGG + Intergenic
979827733 4:125260014-125260036 GAAAAGAAGGAGAATGGAACAGG - Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
982464265 4:155710695-155710717 AAGAAGCAGGAAAAAGGGGCAGG + Exonic
982520682 4:156413043-156413065 AACAAGCAGGATAATGGGGCAGG - Intergenic
982855352 4:160375376-160375398 TCTAAGAAGGATAATGAGGCTGG - Intergenic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984884765 4:184440461-184440483 TGTGGGAAGGAGAATGGGGCCGG - Intronic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
986134757 5:4966011-4966033 TAGAAAAAGGCTCATGGGGCTGG + Intergenic
986362441 5:6993221-6993243 AAGAAGAAGAAGAAAGGAGCGGG - Intergenic
986713890 5:10508464-10508486 TAGAAAAAGGATATTAGGGCCGG - Intronic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
986854560 5:11853655-11853677 GAGAAGAAAGTGAGTGGGGCAGG - Intronic
987183695 5:15392526-15392548 TAGAAAAAGGAGAAATCGGCCGG + Intergenic
987353215 5:17039914-17039936 GAGAAGGAGGAGGATGGGGGGGG - Intergenic
987473123 5:18356944-18356966 TAAAAGAAGGATAATAGGCCAGG + Intergenic
989126534 5:38058519-38058541 CAAAAGAAGTACAATGGGGCAGG + Intergenic
990119724 5:52436134-52436156 TAGTAGAAGGAGAACTGGACTGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990736571 5:58869938-58869960 TTGAAGAAGGAGAATGGCATGGG + Intergenic
990797905 5:59565173-59565195 AAAGAGAAGGAGAATGGGACAGG + Intronic
991423149 5:66462232-66462254 CAGAAAAAGGAGAATAGAGCTGG - Intergenic
991425770 5:66490080-66490102 TAGAAGAAGTAGAAGACGGCAGG - Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
993873726 5:93281616-93281638 TAGAAGCAGGAGCATGGGCAGGG + Intergenic
993905427 5:93618364-93618386 TAGAACAAGTAGAATGGGAAAGG - Exonic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994802255 5:104393872-104393894 TAGAAGGACAAGAATGGGGCAGG + Intergenic
995078066 5:108011505-108011527 GAGAAGAAAGTTAATGGGGCTGG + Intronic
995133232 5:108652815-108652837 TAAAAGAAGTAGAATGGGTCAGG - Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995516585 5:112960211-112960233 TACATGAATGAGAATGGGGGAGG + Intergenic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
996220569 5:120927094-120927116 TAGAAGATATGGAATGGGGCCGG - Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
999291184 5:150427597-150427619 ACCAAGAAGGAGAATGGGGAAGG - Intergenic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999694751 5:154179120-154179142 TAATAGGAGGAAAATGGGGCAGG + Intronic
999991920 5:157057828-157057850 TAGAAGCCAGAGAATGGGGTAGG - Intronic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1000886493 5:166753569-166753591 TAGAAGAATGTTAATGAGGCCGG - Intergenic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1001578400 5:172780612-172780634 TAAAAAAAGGCAAATGGGGCTGG + Intergenic
1001716731 5:173822591-173822613 TAGAAGACAGAGAATGAGTCAGG + Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1001989481 5:176104491-176104513 TTGAGCAAGGAGAGTGGGGCAGG + Intronic
1002257181 5:177966621-177966643 TAGAGCAAGGCGTATGGGGCTGG + Intergenic
1002795097 6:465638-465660 AAGGAGAAAGAGGATGGGGCAGG - Intergenic
1002804248 6:557321-557343 TAAAAGAAGTAGAATTTGGCCGG + Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003023768 6:2535046-2535068 TAGAAGGAGGAGGTTGGGGAAGG + Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003270403 6:4602958-4602980 TACAAGAAGGAGAGTTTGGCCGG + Intergenic
1003390612 6:5709826-5709848 TGGAAGGTGGAGAATAGGGCTGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003723593 6:8733746-8733768 TAGAAGAAGAGGCGTGGGGCAGG + Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1005344900 6:24879608-24879630 TAAAAGGAGGAGGTTGGGGCAGG + Intronic
1005913095 6:30327394-30327416 AAGAAGATGGAGAACGGGGGTGG + Intronic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006690236 6:35877545-35877567 TAGAAGACTGAAAATGGGCCGGG + Intronic
1006706589 6:36026304-36026326 TCGAGTAAGGAGAATAGGGCAGG - Intergenic
1007066765 6:38998155-38998177 GAGAAGAGGGAGATTTGGGCAGG + Intronic
1008768377 6:54948067-54948089 TAGAAAAAAGAGCATGGAGCAGG + Intergenic
1010179140 6:73065106-73065128 TGGTAGATGGTGAATGGGGCTGG - Intronic
1011115142 6:83881471-83881493 TACAAGAAGCAGTATGAGGCTGG - Intronic
1011130400 6:84046483-84046505 TATAAAAAGGAGAATTTGGCTGG + Intronic
1011353369 6:86447094-86447116 TACAGGATGGAGAGTGGGGCAGG + Intergenic
1012099095 6:95007560-95007582 TAGAAGTAGCAACATGGGGCAGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012581479 6:100875248-100875270 TTAAAGAAGGAGAAAGGAGCAGG + Intronic
1013235332 6:108193611-108193633 TAGTAGAAGGAGCATTGGTCAGG + Intergenic
1014244996 6:119058497-119058519 TAAGAGAAGGAGAATTGGGCTGG - Intronic
1014401762 6:120998465-120998487 TATAAGAATGGGAAAGGGGCCGG - Intergenic
1014613240 6:123569661-123569683 TAGAAGGAGGAGAGAGGAGCAGG + Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015411062 6:132894425-132894447 TAGAGGAAGGAGGAGGGGGTTGG + Intergenic
1016031939 6:139346904-139346926 TAAAAGACGGAGATTGGGCCAGG + Intergenic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1017256868 6:152343453-152343475 AAAAAGAAAGAGAATGGGGCCGG - Intronic
1017689179 6:156946059-156946081 TAAAAGAAGAATAATGGGCCAGG + Intronic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019681419 7:2352206-2352228 TAGAAGAAGGAAATTATGGCCGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020079859 7:5281609-5281631 GAGTAGAGGGAGAATAGGGCGGG + Intronic
1020711990 7:11618503-11618525 AAGAAGGAGAAGAATAGGGCGGG + Intronic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021555964 7:21918316-21918338 TAGAAGAAGGGGAGTTGGGTCGG - Intronic
1021972696 7:25981176-25981198 TGGAAGAAGGAGAAGGGAGAGGG + Intergenic
1022417677 7:30191948-30191970 TAGAGGAAAGACAAGGGGGCGGG + Intergenic
1022790735 7:33686557-33686579 TAGAAACAGGAGAATGGGCCTGG + Intergenic
1022992271 7:35720272-35720294 TAGATGGAGGAGAATGGGGGTGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023379103 7:39588213-39588235 TAGAAGAAGGAAAAATGGGCCGG + Intronic
1023468521 7:40486835-40486857 TAGTACAAGGAGGCTGGGGCAGG - Intronic
1024582060 7:50808488-50808510 TCGAAGAAGGGGGATTGGGCTGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025199051 7:56950607-56950629 GAGTAGAGGGAGAATAGGGCGGG - Intergenic
1025672896 7:63626326-63626348 GAGTAGAGGGAGAATAGGGCGGG + Intergenic
1026494414 7:70890139-70890161 TAAAATAAGGGGAATGGAGCAGG + Intergenic
1026560350 7:71443578-71443600 CAGAAGGTGGAGGATGGGGCAGG - Intronic
1026809344 7:73449313-73449335 AAGAAGACAGAGAATGTGGCTGG + Intronic
1026828137 7:73596560-73596582 AAGAAGAAGGGGACTGGGTCTGG - Intronic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1027298196 7:76800175-76800197 TAGCAGAACTAGAATGGGCCAGG + Intergenic
1027398012 7:77776414-77776436 TGGAAGATGGAGAATTGGGGAGG - Intronic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028746829 7:94336895-94336917 GAGAACAAGGAGAATGTAGCAGG - Intergenic
1028988601 7:97026518-97026540 TGGGAGAAGGAGAATGCTGCTGG - Intergenic
1029286979 7:99472561-99472583 TAAAAGAAGAAAAATGGGCCAGG - Intergenic
1029549672 7:101231046-101231068 GAGATGAAGGAGAAAGGGGAGGG + Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1030096586 7:105906234-105906256 TATAAAAAGGAGACTGAGGCAGG + Intronic
1030287195 7:107838787-107838809 TAGAAGAAGAAGAATGGTCTTGG - Intergenic
1030485343 7:110159200-110159222 TGGAAGAAGAAGAATGGTCCTGG - Intergenic
1031061088 7:117052227-117052249 TACAAAAAGGAGAATGATGCTGG - Intronic
1031417062 7:121507534-121507556 TAGAAGGAGGAGAAAGGGAAGGG + Intergenic
1031528622 7:122850670-122850692 TAGAAGCTGGAGGATGGGGATGG - Intronic
1031730345 7:125292626-125292648 TAGAAAAAGGAAAAAAGGGCTGG - Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032458112 7:132088629-132088651 TGGAAGAAGGAGATTTGGGTGGG + Intergenic
1032817577 7:135492934-135492956 TAGAAGAATGACAATGAGCCAGG + Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033078194 7:138269177-138269199 GAGAAGAATAAAAATGGGGCTGG + Intergenic
1033218621 7:139512782-139512804 TAGAAGAAGCAGAAAGGGCTGGG - Intergenic
1033354374 7:140587583-140587605 AAGGGGAGGGAGAATGGGGCTGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1035105855 7:156441066-156441088 ATGAAGCAGGAGAATGGGTCTGG - Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036956768 8:13196175-13196197 TAGGGGAAGGAGAATAGGACTGG + Intronic
1037748588 8:21665274-21665296 TAGAAGAAGGTGGAAGGAGCAGG + Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037951017 8:23018863-23018885 GAGAAGAGGGAGAATGGAGCAGG + Intronic
1037965975 8:23134562-23134584 AAGAAGAGGGAGAATGGAGAAGG + Intergenic
1038516787 8:28194128-28194150 TAGAAGAGGAAGAGTGGGGCCGG - Intergenic
1039014934 8:33136804-33136826 TAGAAGGAGGAGAAAGGGAGGGG - Intergenic
1039530128 8:38253782-38253804 TAGAAAAAGGAGGATAGGCCAGG + Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041279222 8:56194777-56194799 TAGGAGAAAGAGAATGGAGATGG + Intronic
1041362334 8:57066746-57066768 AAGAATGACGAGAATGGGGCTGG - Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1043044617 8:75306027-75306049 TAGAAGAAACAGAATAGGGATGG + Intergenic
1043064666 8:75553338-75553360 TAGAACAAGGTGAATGGGTAAGG - Intronic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1045855146 8:106756446-106756468 TAGAAAAAAGAGAATTCGGCCGG - Intergenic
1045891682 8:107165219-107165241 TAAAAGATGGAGGATGGGCCAGG - Intergenic
1045930837 8:107624611-107624633 TAGAAAAATGATAACGGGGCTGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046261234 8:111771140-111771162 TTGATCAAGGAGAATGAGGCAGG - Intergenic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046901766 8:119531049-119531071 TAGAAAAAGGAGGTTGGGGCTGG - Intergenic
1046930417 8:119836409-119836431 TATAAGAAGGAGAAAGGAGAAGG + Intronic
1046991243 8:120457832-120457854 TTGAGGCAGGAGAATGAGGCAGG + Intronic
1047099374 8:121659347-121659369 TAGAAGAAAGAAAACTGGGCTGG + Intergenic
1047508260 8:125496779-125496801 TGGGAGAAGGAGATTGGGGGTGG + Intergenic
1048516562 8:135116765-135116787 GAGAAGAAGGAGAAAGGAGCCGG - Intergenic
1048736224 8:137504909-137504931 TACAAGAATGAGGCTGGGGCAGG - Intergenic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1049056430 8:140240834-140240856 TTTAAGAAGGTGAGTGGGGCTGG - Intronic
1049454849 8:142681631-142681653 TGGAAGATGGAGGATGGGGAGGG - Intronic
1050293409 9:4180292-4180314 TGGAAGAATGTGAATGGGGTAGG - Intronic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050716027 9:8526697-8526719 GAGAAGAAGGAGGCTAGGGCTGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053242379 9:36506620-36506642 TAAGAGAAGAAGAAAGGGGCTGG - Intergenic
1053453739 9:38214713-38214735 TAGAGGAAGGAGAAGGGGAAAGG + Intergenic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1053587364 9:39473582-39473604 TAGAAGCAGCAAAATGGTGCTGG - Intergenic
1054578937 9:66891654-66891676 TAGAAGCAGCAAAATGGTGCTGG + Intronic
1055011642 9:71572990-71573012 TAAAAGAAGGAGAATTGAGGTGG + Intergenic
1055254980 9:74358668-74358690 AAGAAGAAGGACATAGGGGCAGG - Intergenic
1055306964 9:74939765-74939787 TACAAGAAGAAGAAAGCGGCCGG - Intergenic
1055897816 9:81199586-81199608 TAGACGCAGGAGAGTGGAGCAGG + Intergenic
1056291567 9:85148824-85148846 TATAATAAAGAAAATGGGGCAGG - Intergenic
1056328016 9:85497166-85497188 AAGAAGAAGAAGAAAGGAGCGGG + Intergenic
1056764509 9:89436590-89436612 TAAAAGGAAGAGAATGGGACAGG - Intronic
1056795280 9:89654935-89654957 TGGAAGAAGGGTAATGTGGCAGG - Intergenic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057585319 9:96323628-96323650 TAGAAGAAGTAAGACGGGGCCGG + Intronic
1057759418 9:97860575-97860597 CAGAAGAGGGAGTGTGGGGCTGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059239607 9:112792720-112792742 TAGAAAAAGGAAAATGGCCCAGG - Intronic
1059744451 9:117186446-117186468 CTGAAGCAGGAGAATGGTGCGGG + Intronic
1060619271 9:125048561-125048583 AAGAAGAAGAAGAAAAGGGCAGG + Intronic
1060676979 9:125523955-125523977 TATTAGAAGGAAGATGGGGCAGG - Intronic
1061337856 9:129953811-129953833 GAGAAGGAGGGGAATGGGGGTGG + Intronic
1061462053 9:130747707-130747729 TATAAGAGGAAGACTGGGGCTGG - Intronic
1061546342 9:131306944-131306966 TTGAAAAATGGGAATGGGGCTGG + Intronic
1061808728 9:133150277-133150299 GACAAGAAGGAGACTGCGGCTGG - Intergenic
1062740749 9:138173870-138173892 AAGAAGAACGAAAATGGGCCAGG + Intergenic
1185617549 X:1432531-1432553 AAGAAAAGGGAGAAAGGGGCCGG + Intronic
1185725775 X:2420446-2420468 TAAAATAAAGAGAATGGGGCCGG + Intronic
1186247888 X:7633527-7633549 TAAAAGACACAGAATGGGGCCGG + Intergenic
1186420154 X:9419225-9419247 TAGAAAATTGAGGATGGGGCCGG - Intergenic
1187023931 X:15413173-15413195 TGGAAAAAGAAGAAAGGGGCAGG - Intronic
1187120460 X:16400861-16400883 CAGAAGATAGAGTATGGGGCTGG - Intergenic
1187632707 X:21192683-21192705 CAGAAGAGTGGGAATGGGGCAGG + Intergenic
1188802008 X:34543911-34543933 TATAAGAAGAAGAAACGGGCCGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189351437 X:40278716-40278738 CACAAGAAGGAAAATGGGGCTGG + Intergenic
1189551621 X:42099417-42099439 GAGAAGAAGGAGAAAGGAGGAGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189880760 X:45489271-45489293 TAGAGGCAGGAAAATGTGGCGGG + Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190096903 X:47488760-47488782 TAAAATAAAGAGACTGGGGCTGG - Intergenic
1190556109 X:51637362-51637384 TGGCAGAAGGTGAATTGGGCTGG - Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191892154 X:65955179-65955201 TATAAGAAACAAAATGGGGCTGG - Intergenic
1191962385 X:66718283-66718305 TATAAGAAGGAGAAGAGGGGTGG + Intergenic
1192030168 X:67502325-67502347 TAGAAGAGGGAGAAAGGGAAGGG - Intergenic
1192036146 X:67565031-67565053 TAGATGAAGGAAAATGGCGGTGG - Intronic
1192317212 X:70062357-70062379 GAGAAGAATGCGAATGGGGGAGG + Intergenic
1193054878 X:77139307-77139329 TAGTAGAAGGAGAACTGGGTTGG + Intergenic
1193277371 X:79604913-79604935 CAGAAGAAGGAGCGTTGGGCTGG - Intergenic
1194128771 X:90053305-90053327 CAGAAGGGGGAGAATGGGACGGG + Intergenic
1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1194701655 X:97120681-97120703 TAGAAGAAGGAGAATTGTCTTGG - Intronic
1194973834 X:100373289-100373311 TAGGAGAAGGAGGCTGGGGGAGG - Intronic
1195054433 X:101129524-101129546 AAGAAGAAGAAGAATTGGCCTGG - Intronic
1196764482 X:119230388-119230410 TAGAAGAAGCAATCTGGGGCCGG - Intergenic
1196903332 X:120408514-120408536 TAGAAACAGGAGCATGGGACTGG + Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1198111763 X:133508470-133508492 TAGCAGAAGGCTGATGGGGCTGG + Intergenic
1198435173 X:136609989-136610011 TAGAAAGAGGAGAATGGAGCAGG - Intergenic
1198634380 X:138679373-138679395 TAAAAAATGGAGTATGGGGCTGG - Intronic
1198752450 X:139949282-139949304 TAGAAGTAGGACAAAAGGGCCGG - Intergenic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199974484 X:152884943-152884965 TGGGAGCAGGAGAATGGCGCAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200225819 X:154416837-154416859 TAGAAGAATGATCAGGGGGCTGG + Intronic
1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1201069230 Y:10129245-10129267 AAGAAGAAGAAAAATGGGCCAGG + Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic