ID: 952415008

View in Genome Browser
Species Human (GRCh38)
Location 3:33082186-33082208
Sequence TTATCACTCTTAGGGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952415000_952415008 7 Left 952415000 3:33082156-33082178 CCAGGGAACCTGAAATGCCATCA 0: 1
1: 2
2: 0
3: 19
4: 208
Right 952415008 3:33082186-33082208 TTATCACTCTTAGGGAGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
952415001_952415008 -1 Left 952415001 3:33082164-33082186 CCTGAAATGCCATCACTCTCCCT 0: 1
1: 0
2: 3
3: 26
4: 234
Right 952415008 3:33082186-33082208 TTATCACTCTTAGGGAGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112
952415002_952415008 -10 Left 952415002 3:33082173-33082195 CCATCACTCTCCCTTATCACTCT 0: 1
1: 0
2: 2
3: 49
4: 574
Right 952415008 3:33082186-33082208 TTATCACTCTTAGGGAGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952415008 Original CRISPR TTATCACTCTTAGGGAGGCC AGG Intronic
901717630 1:11169293-11169315 TTCCCACTCTTAGGGATGCATGG - Intronic
902917897 1:19649651-19649673 TTATAATTCTATGGGAGGCCAGG - Intronic
903644004 1:24879930-24879952 TTTTCACTCTTTAGGAGGCCAGG + Intergenic
905066749 1:35191492-35191514 TTGTCTCTCTTGAGGAGGCCTGG - Exonic
907810933 1:57869019-57869041 TAACAAGTCTTAGGGAGGCCAGG - Intronic
909526333 1:76626815-76626837 TAATCACTGTTATGGAGGCTGGG - Intronic
910284047 1:85533406-85533428 TAATCACACTTTAGGAGGCCAGG - Intronic
913118728 1:115720213-115720235 TTCTCACTGTTATGGAGGCTGGG + Intronic
913406887 1:118504258-118504280 ATATTTCCCTTAGGGAGGCCCGG - Intergenic
914205972 1:145529579-145529601 TAATCACACTTTAGGAGGCCAGG + Intergenic
914259237 1:145985054-145985076 TTTTGACTGTGAGGGAGGCCTGG - Intergenic
915465586 1:156096016-156096038 GCATCACTCTCAGGGAGCCCTGG - Intronic
919792104 1:201298636-201298658 TTCTCACTCTTAGGCATGCCAGG - Intronic
921125192 1:212171514-212171536 TCCTCACACTTTGGGAGGCCAGG + Intergenic
924568593 1:245218339-245218361 TTGTCACTCTGAGGGAGGGAAGG + Intronic
1065402970 10:25327604-25327626 TTATGACTCTTAGGGAAGACAGG + Intronic
1065871212 10:29957913-29957935 TCATCACTCTCAGGGAAGGCTGG + Intergenic
1066973488 10:42341307-42341329 TTCTAACACTTTGGGAGGCCAGG + Intergenic
1070681433 10:78451909-78451931 TTTTCACTCAGAGTGAGGCCTGG + Intergenic
1076249519 10:128974467-128974489 TACTCAGGCTTAGGGAGGCCTGG - Intergenic
1076481527 10:130788218-130788240 CTTTCTCTCTTAGGGAGTCCCGG + Intergenic
1079289569 11:19175091-19175113 TTATAAGGTTTAGGGAGGCCGGG + Intronic
1080629066 11:34055620-34055642 TTATGACTTTAGGGGAGGCCCGG - Intronic
1083261251 11:61524270-61524292 TTGTCAACCTTAGGAAGGCCAGG - Intronic
1083337566 11:61933481-61933503 TTCTCACCATTCGGGAGGCCAGG - Intergenic
1086164034 11:83756787-83756809 TTAGCAGTCTTAGGGAGTCTTGG + Intronic
1086200750 11:84198706-84198728 TTATCACTATTGGGGAGACAAGG + Intronic
1089677041 11:120097101-120097123 AAATCACTCTCAGGGCGGCCTGG + Intergenic
1090405191 11:126472307-126472329 TTCTCACTGTTCTGGAGGCCGGG + Intronic
1091668544 12:2436389-2436411 TTACAGCTCTTAGAGAGGCCGGG - Intronic
1093074262 12:14741359-14741381 TAATCACACTTTTGGAGGCCAGG + Intergenic
1094408844 12:30148321-30148343 TTATGTTTCTTAGGAAGGCCTGG + Intergenic
1095305007 12:40628371-40628393 TTATCACTTTTAGAGATGCAAGG + Intergenic
1096335305 12:50750840-50750862 TTCTCACACTTCTGGAGGCCAGG - Intergenic
1099858039 12:88193967-88193989 TCCTAACACTTAGGGAGGCCAGG + Intronic
1101793128 12:107948900-107948922 TCAACACTCTCCGGGAGGCCTGG + Intergenic
1102325115 12:111974389-111974411 TTCTAACACTTTGGGAGGCCGGG + Intronic
1103451411 12:121031893-121031915 TCAATACTCATAGGGAGGCCGGG + Intronic
1106421399 13:29589112-29589134 TTAACACTCTCAGAGAGGCTGGG - Intronic
1107213446 13:37886680-37886702 TTATGACTCTTAAGAAAGCCTGG + Intergenic
1112412990 13:99179774-99179796 TTCTCATTGTTAGGGAGGCTGGG - Intergenic
1113358029 13:109601817-109601839 TTATCACAGTTCTGGAGGCCAGG + Intergenic
1113628037 13:111860855-111860877 TTATCATTCTTTGGGGGGCAGGG + Intergenic
1124953717 15:34346142-34346164 GTATCACACTTGGGGAGGCTAGG + Intronic
1125669914 15:41463775-41463797 TTATCACAAAAAGGGAGGCCAGG - Intronic
1127180380 15:56409790-56409812 GTAAAAATCTTAGGGAGGCCAGG - Intronic
1127761752 15:62146446-62146468 TTGTCACTGTTGGGGAGGGCTGG - Intergenic
1132633795 16:932898-932920 TGAGCACTCTAGGGGAGGCCTGG + Intronic
1137313232 16:47287331-47287353 TAATCCCCCTTTGGGAGGCCAGG - Intronic
1140796281 16:78441394-78441416 TTATCCCTCTGAGGTAGGCAAGG + Intronic
1143407288 17:6685927-6685949 TTATCTCTGTGAGGGAGGCCAGG - Exonic
1145891280 17:28417800-28417822 TCTTAACTCTTTGGGAGGCCGGG + Intergenic
1153995555 18:10438800-10438822 TTAAAATTCTTAGTGAGGCCAGG + Intergenic
1154169305 18:12038927-12038949 TCCTCACTCTCAGGGAGCCCTGG + Intergenic
1160904991 19:1447761-1447783 TTATCCCTCTGGGGGTGGCCAGG - Intronic
1167848715 19:52185679-52185701 TTCTCACAGTTTGGGAGGCCAGG - Intergenic
1167971528 19:53190636-53190658 TTATAACAATTAGGTAGGCCGGG + Intronic
924995510 2:357159-357181 TTGTCACTCTGTGGGAGGGCAGG + Intergenic
928398813 2:30963537-30963559 TAAACACTGTTAGGGAGGCCTGG + Intronic
931223634 2:60310402-60310424 CTTTCCCTCTCAGGGAGGCCTGG - Intergenic
931917209 2:66969301-66969323 TTTTGGCTCTTAGGGAGGACAGG + Intergenic
935608402 2:104994703-104994725 TTCTCATTGTTAGGGAGGCTGGG + Intergenic
940421921 2:153488962-153488984 TTATCACAGTTCTGGAGGCCAGG - Intergenic
947142274 2:227030562-227030584 TCAACACTCCCAGGGAGGCCTGG + Exonic
948050366 2:234975307-234975329 CTATCACTCGTGGGGAAGCCAGG + Intronic
1170552488 20:17489742-17489764 TTCTCACTCTTCTGGAGGCTGGG + Intergenic
1170892134 20:20385023-20385045 TTATCAGTCTTAGGGAGATGGGG + Intergenic
1170953775 20:20959683-20959705 CCATCACTCTTGGTGAGGCCTGG + Intergenic
1173394354 20:42664718-42664740 ATATGACACTTTGGGAGGCCAGG - Intronic
1178200122 21:30394033-30394055 TTATCACTCCTGGGGAGACTGGG + Intronic
1182508164 22:30800331-30800353 TTCTGACACTTCGGGAGGCCTGG - Intronic
1182647742 22:31824097-31824119 TGCTCACCCTTTGGGAGGCCAGG + Intronic
1183867067 22:40712455-40712477 TTCTCACACTTTGGGAGGCCGGG - Intergenic
949658153 3:6245610-6245632 TTATCAATGTTAGGTAGGGCAGG - Intergenic
950127453 3:10518714-10518736 TCATGCCTCTGAGGGAGGCCTGG + Intronic
951287504 3:20832736-20832758 TTATCACTTTTTGGGAGTCCTGG + Intergenic
951421225 3:22487971-22487993 TTATCAATCCTAGAGAGACCTGG - Intergenic
952415008 3:33082186-33082208 TTATCACTCTTAGGGAGGCCAGG + Intronic
955473192 3:59308466-59308488 TTATTAGCCTCAGGGAGGCCAGG + Intergenic
960754481 3:120995639-120995661 TTTTTACTCTTAGTGAGGCATGG + Intronic
962020409 3:131494213-131494235 TTATCACTCTTGTGGAGGAAAGG - Intronic
964532375 3:157682422-157682444 TTCTCACTGTTATGGAGGCTGGG + Intergenic
974202020 4:58655051-58655073 TTATCACTGTTCTGGAGGCTGGG + Intergenic
975201950 4:71601503-71601525 TTATCACTCTTACGGACAACTGG + Intergenic
975475949 4:74823476-74823498 TTCTCACTCTTCTGGAGGCTGGG + Intergenic
979484302 4:121253568-121253590 TTCTCACTCTTCTGGAGACCAGG + Intergenic
986311437 5:6553787-6553809 CTTTCACACTTTGGGAGGCCAGG - Intergenic
990356791 5:54975687-54975709 TCATTACTCCTAGGGAGACCAGG + Intergenic
998696451 5:144645669-144645691 TTCTCACACTTCTGGAGGCCAGG - Intergenic
1000317018 5:160102154-160102176 TTGTAACACTTTGGGAGGCCAGG + Intronic
1001238097 5:170046520-170046542 TTAGCCCACTTAGAGAGGCCAGG + Intronic
1003307685 6:4944533-4944555 TGATCGCTCCTGGGGAGGCCTGG - Intronic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1010623565 6:78107049-78107071 TTCTCACACTTTTGGAGGCCGGG - Intergenic
1012459544 6:99445187-99445209 TTAGAAGTTTTAGGGAGGCCAGG + Intronic
1013016016 6:106161089-106161111 TGATCACTCTCAGGGTGGCCTGG + Intergenic
1016956252 6:149629443-149629465 TTCTCACACTTCTGGAGGCCGGG - Intronic
1018896038 6:168018000-168018022 TTATCAATCAGAGGGTGGCCAGG - Exonic
1022687598 7:32611060-32611082 TTGTTACTCTTTGGGAGGGCGGG + Intergenic
1024989513 7:55222049-55222071 TGATCGCTCTCAGGGAGCCCTGG - Intronic
1026646731 7:72177337-72177359 TCATGACTCTTAAGCAGGCCTGG + Intronic
1029971490 7:104793950-104793972 GAATCACTCTTAGAGAGGCTCGG + Intronic
1031237262 7:119192028-119192050 TTCTCACTCTTTTGGAGGCTGGG + Intergenic
1034539882 7:151750718-151750740 TTAACACTGTTAAGGTGGCCAGG + Intronic
1036934911 8:12992401-12992423 TTCTAGCTCTTTGGGAGGCCTGG + Intronic
1037415404 8:18644214-18644236 TTATCATTCTTTGTAAGGCCAGG + Intronic
1037502711 8:19500840-19500862 TTCTCACAATTACGGAGGCCGGG + Intronic
1040649044 8:49429548-49429570 TTATCACCCTTACTGAGCCCTGG + Intergenic
1041931366 8:63291161-63291183 TTCTCACTGTTTGGGAGGCTGGG + Intergenic
1043188721 8:77189734-77189756 TTATCATTCATGGGGAGTCCAGG + Intergenic
1047735420 8:127760968-127760990 GTCTCACTCCTAGGGAAGCCTGG + Intergenic
1049657768 8:143806297-143806319 TTGGAACTCTTGGGGAGGCCGGG + Intronic
1052794207 9:32908116-32908138 TAATGACTCCTAGGGTGGCCGGG + Intergenic
1055872063 9:80892759-80892781 TTATAACCCTTATGAAGGCCAGG + Intergenic
1058633881 9:107018023-107018045 TTGTGACTCATAGGGAGGCAGGG - Intergenic
1059190615 9:112322331-112322353 TTTTCCCCCTTAGGTAGGCCAGG - Intronic
1187586004 X:20662471-20662493 TTATTTCTCTGAGGGAGGACTGG + Intergenic
1196123088 X:112071025-112071047 TCTCCACTCTTTGGGAGGCCAGG + Intronic
1198138225 X:133776289-133776311 TTGTCATTCTTGGGAAGGCCAGG - Intronic
1200012664 X:153131224-153131246 TGATCTCTCTTAAGGAGGCATGG - Intergenic
1200026936 X:153268693-153268715 TGATCTCTCTTAAGGAGGCATGG + Intergenic