ID: 952420027

View in Genome Browser
Species Human (GRCh38)
Location 3:33122289-33122311
Sequence CTGGTTCTGCAGAAGCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952420027_952420031 -9 Left 952420027 3:33122289-33122311 CCCCGCTGCTTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 952420031 3:33122303-33122325 CAGAACCAGCTGTCTGGAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 216
952420027_952420034 20 Left 952420027 3:33122289-33122311 CCCCGCTGCTTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 952420034 3:33122332-33122354 ATTGACCCATTCTTCAGGAAAGG 0: 1
1: 0
2: 1
3: 6
4: 172
952420027_952420033 15 Left 952420027 3:33122289-33122311 CCCCGCTGCTTCTGCAGAACCAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 952420033 3:33122327-33122349 TACTTATTGACCCATTCTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952420027 Original CRISPR CTGGTTCTGCAGAAGCAGCG GGG (reversed) Intronic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
901173398 1:7280439-7280461 AGGTTTCTGCAGAAGCAGCTTGG + Intronic
901880766 1:12192542-12192564 TTGGTTCTGGAGGAGCAGGGAGG + Intronic
902082902 1:13833465-13833487 CTGGCTCAGCAGGTGCAGCGTGG - Intergenic
902718699 1:18290232-18290254 CCTGTGCTGCAGAAGCAGCCAGG + Intronic
905996411 1:42385094-42385116 CTGGTTCTTCAGAGGGAGGGGGG - Intronic
907105476 1:51878696-51878718 CTGGTGCTGCCGCAGCCGCGGGG + Exonic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
907939832 1:59076976-59076998 CTGGATCTACAGAATGAGCGAGG + Intergenic
908331426 1:63074558-63074580 CTGATTTTGCAGAAGCAGATAGG + Intergenic
912460749 1:109829362-109829384 TTGTTTCTGGAGAACCAGCGGGG - Intergenic
913529257 1:119721892-119721914 CTGTTTCTGCAGAAACACAGGGG + Intronic
915201977 1:154237033-154237055 CTGGCTCTGCATAATCAGCTGGG - Exonic
917598892 1:176556294-176556316 CTGGTTCTGTAGAAAGAGCTAGG + Exonic
921707202 1:218336542-218336564 CTGGTTCTGCAAATGCAAAGAGG - Exonic
922082785 1:222313835-222313857 CTGGTTCTGCCCCAGCAGGGAGG + Intergenic
1064218822 10:13422057-13422079 TTGGTTCTGCAGAAGCCAGGAGG - Intergenic
1064431870 10:15278318-15278340 TTGGTGCTGCAGAAACAGCCTGG + Intronic
1065828641 10:29595059-29595081 CTGGTTTTGCAGATGTAGAGTGG - Intronic
1066640567 10:37550852-37550874 CTGGGACTGCAGAAGGAGCTTGG - Intergenic
1067344533 10:45428001-45428023 GAGGTGCTGCAGAAGCAGAGGGG - Intronic
1069781913 10:70962240-70962262 CAGGTGCTGCAGGAGCAGTGTGG - Intergenic
1070401493 10:76056805-76056827 CTGGGTCTGCAGCTGCAGCTGGG + Intronic
1072536721 10:96369919-96369941 CACGTTCTGCAGAAGCGGAGTGG - Intronic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1076520167 10:131076343-131076365 CTGGCTCTGTAGAAGCAGTCCGG - Intergenic
1077141710 11:1027694-1027716 CTGGGGCTGGAGAAGCAGTGTGG - Exonic
1078539265 11:12200210-12200232 CTGGTTCTGGGGAAGCAGAAAGG + Intronic
1078660249 11:13279784-13279806 CTGGTTCTGTAGAAGCATTTTGG + Intronic
1080333817 11:31174074-31174096 CTGGGTCTGCAGCTGCAGCTGGG - Intronic
1080333838 11:31174164-31174186 CTGGGTCTGCAGCTGCAGCTGGG - Intronic
1083593123 11:63906784-63906806 CTAGTTCTGCAGGAGCTGCCAGG - Intronic
1084512705 11:69616113-69616135 CTGGTCCTGCAGAAGCCCCTGGG + Intergenic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1088336863 11:108714977-108714999 CTGGCTTTGCAGAAACAACGTGG + Intronic
1089021514 11:115220285-115220307 GTGGTACTGAAGAAGCAGGGTGG - Intronic
1089161077 11:116437819-116437841 CTGATTCTGCAGAAACACTGTGG - Intergenic
1090238629 11:125166549-125166571 CTGGGTCTGCGGGCGCAGCGCGG + Intronic
1091078316 11:132641776-132641798 TTGGTTCTGCAACAGCAGGGTGG - Intronic
1091127482 11:133114020-133114042 CTGTTTCTGAAGAAGCAGGGAGG - Intronic
1091316749 11:134619260-134619282 CCTTTCCTGCAGAAGCAGCGTGG + Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1094755313 12:33462572-33462594 CTGGTTGAGCCGAAGCAGGGTGG + Intergenic
1096075459 12:48801103-48801125 TTGGTCCTGCGGAAGCTGCGTGG - Intergenic
1096245418 12:49982355-49982377 CTGGTTCTGGAGCAGCAGGCTGG + Intronic
1100437418 12:94584359-94584381 CTGGTTCTGGGGAGGCTGCGGGG - Intronic
1100681463 12:96927410-96927432 GGAGTTCTGCAGAAGCAGCAAGG - Intronic
1104843186 12:131834336-131834358 CGGGTGCTGCAGCAGCAGCAGGG - Intronic
1105843074 13:24272285-24272307 CTGTTTCTCCAGCAGCACCGAGG - Intronic
1106169037 13:27272879-27272901 CTGCTTCTGCAGAAGCTGGGTGG + Intronic
1109470549 13:62799076-62799098 CTGGGTCTGCAGTCGCAGCTTGG - Intergenic
1109837360 13:67877388-67877410 CTGAGTCTGCAGCAGCAGCTGGG - Intergenic
1111736017 13:92140255-92140277 ATGGTTCTGCAGTAGAAGCTGGG + Intronic
1112052776 13:95660211-95660233 CTGGTTCTGTAGTATCAGCCTGG - Intergenic
1112337057 13:98524497-98524519 TGGGTTCAGCAGAGGCAGCGAGG - Intronic
1114197212 14:20489413-20489435 CTAGTTCTACAGAAGGAGGGTGG + Intergenic
1118233237 14:63974266-63974288 CTGCTTCTGTACAAGAAGCGTGG + Intronic
1119618022 14:76111658-76111680 CTGGGTCTGCAGTAGCAGTTTGG - Intergenic
1119806320 14:77484720-77484742 CTGGAGCTGCAGAAGCTGCCGGG - Exonic
1120745365 14:88146936-88146958 CTGGATCTGCAGCTGCAGCTTGG - Intergenic
1122268146 14:100556344-100556366 GTGGTTCTGCAGAAAGAGGGGGG - Intronic
1122405194 14:101496626-101496648 CCGGCTCTGCAGAAGCATCTCGG - Intergenic
1126649759 15:50908821-50908843 CTCTTTCTGCAGAACCAGCCCGG + Exonic
1128965170 15:72051492-72051514 CTGGGTCTGCAGCTGCAGCTTGG - Intronic
1130849115 15:87776676-87776698 CTGGGTCTACAGAAGCAGATAGG + Intergenic
1131188259 15:90293525-90293547 CAGAGTCTGCAGCAGCAGCGAGG + Intronic
1131622326 15:94081210-94081232 CCGGTTCTGAAATAGCAGCGCGG + Intergenic
1132338248 15:101062557-101062579 CTGGTCCTGCAGAGGCAGACAGG - Exonic
1132774129 16:1582409-1582431 CTGGGGCTGCAGAGGAAGCGTGG + Intronic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1135260354 16:20975181-20975203 CTGGTGCTGCCGAATGAGCGTGG - Intronic
1135511044 16:23083394-23083416 CTGGTACTGAAGAAGTAGCAGGG - Intronic
1137410479 16:48223658-48223680 CTGGTTGGCCAGAAGAAGCGGGG - Intronic
1140223420 16:73059853-73059875 CTGGTTCTTTAGAAGGAGAGAGG + Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141525881 16:84611371-84611393 CTGGTATTGCAGAAGAAGAGGGG + Intronic
1142153390 16:88522454-88522476 CCGGTCCTGCAGAAGCCCCGTGG - Intronic
1142478317 17:202788-202810 CAGGTTCTGCAGGAGCCGCTGGG + Intergenic
1143735744 17:8911076-8911098 CTGATTCTGAAAAAGCAGCTGGG - Intronic
1146354880 17:32125538-32125560 CAGGTGCTGCAGAAGCAGCAGGG - Intergenic
1147562105 17:41515624-41515646 CTGGATCTGCTGCAGCTGCGTGG + Exonic
1149138687 17:53402662-53402684 CTGGGCCTGCATAAGCACCGAGG + Intergenic
1151576320 17:74954171-74954193 CTGGCTCTGCAGGGGCAGCGGGG + Exonic
1151802461 17:76386026-76386048 CTGGTGCTGCTGAACCCGCGCGG + Exonic
1151855446 17:76718276-76718298 CAGGTTCTGCAGAAGATGCCGGG + Intronic
1151959811 17:77399754-77399776 CTGATTCTGCAGAAGCCCCAGGG - Intronic
1152495593 17:80669120-80669142 CTGGCTCAGCAGGAGCAGCCAGG + Intronic
1152920699 17:83065121-83065143 CTGGTTCTGCTGAAGCTGGAGGG - Intergenic
1153010245 18:532172-532194 TTGGCACAGCAGAAGCAGCGTGG + Intergenic
1158606632 18:58901762-58901784 AGGGTTCTCCAGAAGCAGCCAGG - Intronic
1164860060 19:31555638-31555660 CTGGTTCTAAAGATGCAGAGAGG - Intergenic
1165942518 19:39422250-39422272 CTGGAACTGCTGAATCAGCGAGG + Exonic
925334173 2:3080748-3080770 GAGGAGCTGCAGAAGCAGCGTGG + Intergenic
926684069 2:15685069-15685091 CTGACTCTGAAGAAGCAGCTGGG - Intergenic
927827189 2:26317050-26317072 CTGATTCTACAGGAGCAGAGGGG + Exonic
928666136 2:33552098-33552120 CTGATTCTGTAGGAGCAGCAAGG + Intronic
928942324 2:36739254-36739276 CTTGTTCTCCAGAAGCAATGTGG + Intronic
929579641 2:43073659-43073681 CGGGTTTTGGAGAAGCAGCGTGG + Intergenic
930511010 2:52345596-52345618 CTGGTTCTGGAGACGCAAGGGGG - Intergenic
930774916 2:55161984-55162006 CTGGGTCTGCATAGGGAGCGAGG - Intergenic
933703107 2:85270052-85270074 CTGGGCCTGCAGGAGCCGCGGGG + Intronic
934662092 2:96148495-96148517 AAGGCTCTGCAGCAGCAGCGAGG - Intergenic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
936957664 2:118039744-118039766 CTGGTTCTGCAGAAGAGTCTTGG + Intergenic
945946633 2:216001523-216001545 CTGGGTCTGGAGAGGCAGAGGGG - Intronic
946420607 2:219562508-219562530 TTCCTTCTGCAGGAGCAGCGCGG + Exonic
947668998 2:231925165-231925187 CTGCTTCTCCAGAAGAAGCCAGG + Intronic
947714815 2:232334152-232334174 CCGGTGCTGCAGAAGCTGCATGG + Intronic
948398679 2:237666656-237666678 CTGGTACTGCAGAAGCCACACGG + Intronic
948657252 2:239484268-239484290 CAGCTCCTGCAGAAGAAGCGAGG + Intergenic
1170221447 20:13946686-13946708 CTGGGTCTGCAGCCGCAGCTGGG - Intronic
1174186614 20:48710785-48710807 CTGTTCCTGCAGACGCAGTGTGG - Intronic
1174454897 20:50642010-50642032 CAGGTTCTGCGGAAGCAGAAGGG - Intronic
1174471905 20:50767720-50767742 CAGGTTCTGCGGAAGCAGAAGGG + Intergenic
1175037623 20:56015172-56015194 CTGGTGCTGCAGCAGGAGCTGGG + Intergenic
1176545452 21:8195672-8195694 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
1176564403 21:8378717-8378739 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
1176873448 21:14102678-14102700 CTGATTCTGCAAAAGCAGATGGG - Intergenic
1177404229 21:20645409-20645431 CTGGGTCTGCAGCTGCAGCTGGG - Intergenic
1179022934 21:37656407-37656429 CTGGGTCTGCAGCTGCAGCCCGG - Intronic
1179381090 21:40899840-40899862 CTGGTTTTGGAGATGAAGCGGGG - Intergenic
1179913829 21:44463860-44463882 GTGGTTCTGCTGAAGCAGCCTGG + Intergenic
1180671195 22:17554873-17554895 GTGTTTGTGCAGAAGCAGGGAGG + Intronic
1180709161 22:17828136-17828158 CTGGGCCTGCAGAAGCAGGCTGG - Intronic
1183725994 22:39590018-39590040 CTGGGCCTGCAGAAGGAGGGTGG + Intronic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1185242144 22:49752296-49752318 CTTGTTCTGCAAACCCAGCGTGG + Intergenic
1185313974 22:50170843-50170865 CTTCAGCTGCAGAAGCAGCGCGG - Exonic
1203250322 22_KI270733v1_random:111910-111932 CTGATTCTGCAAAAGCAGGTGGG + Intergenic
949694749 3:6681383-6681405 CTGGTTCAGCAGACGAAGGGTGG + Intergenic
952420027 3:33122289-33122311 CTGGTTCTGCAGAAGCAGCGGGG - Intronic
952877027 3:37954694-37954716 CTGCTTCTGCAGCAGCGGCTTGG + Intronic
953392980 3:42544638-42544660 CTGCCTCTGCAGAAGCAGCCTGG + Intergenic
953688600 3:45098051-45098073 CAGGGACTGCAGAAGCAGAGGGG - Intronic
954678918 3:52330995-52331017 CTGGCTCTGCTGGAGCAGAGGGG + Intronic
954806859 3:53225581-53225603 CAGGTTCTGGGGAAGAAGCGTGG - Intronic
955040261 3:55309877-55309899 CAGGTTCTGGAGATGCAGAGGGG + Intergenic
956239133 3:67109394-67109416 GTGTTTCTGCAGAAGCAACAAGG + Intergenic
958529594 3:95309532-95309554 CAGGCCCTGCAGAAGCAGCTAGG - Intergenic
960764588 3:121111799-121111821 CAGGTTCTGCAGAGCCATCGGGG + Intronic
961265155 3:125635630-125635652 CTGGGTCCACAGAAGCTGCGTGG - Intergenic
961885128 3:130091971-130091993 CTGGTGCTGCTGATGCAGCCGGG + Intronic
962065528 3:131975568-131975590 CAGGGCCTGCAGAAGCAGTGTGG - Intronic
963805034 3:149714310-149714332 CTGGTTCTGCAGTCGCAGCTCGG - Intronic
967557045 3:190872322-190872344 CTGGTTTTGCAGAAGCATTTGGG - Intronic
968566575 4:1316619-1316641 CTGGTTAGACAGAAGCAGGGAGG - Intronic
969544032 4:7812140-7812162 CTGGGTCTTCAGAAACAGCTGGG - Intronic
970455526 4:16219996-16220018 CTGGCAGAGCAGAAGCAGCGAGG - Intronic
972025686 4:34373857-34373879 CTGTATCTGCAAAAGCAGCATGG - Intergenic
975285518 4:72614148-72614170 CTGGCTCTGAAGAAGTAGAGTGG + Intergenic
978593927 4:110356363-110356385 CTGGATCTGCAGCAGCATCTAGG - Intergenic
980859561 4:138482826-138482848 CTGGCTCTGCAGAGGTAGAGAGG - Intergenic
980871288 4:138614047-138614069 TTGGTTAGGAAGAAGCAGCGAGG - Intergenic
982831445 4:160066058-160066080 CTGGTTCTGCAGAATGAGTTGGG + Intergenic
984196585 4:176664688-176664710 CTGTTTCTGCAGAAACACCTGGG - Intergenic
985077399 4:186229823-186229845 CTGGTTCAGCAGAAGAATCAGGG - Intronic
985713884 5:1445293-1445315 CGGGGTCTGCGGAAGGAGCGGGG + Intronic
985849010 5:2374891-2374913 CGGGTGCTACAGAAGCAGAGGGG - Intergenic
985889519 5:2704996-2705018 CTGGTTCTGGGGTAGCAGCATGG + Intergenic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
986875067 5:12097366-12097388 CTGGTTCTCCAGAATCACTGTGG + Intergenic
988202130 5:28082768-28082790 CATGTTCTGCAGAACCAGCAGGG + Intergenic
990401338 5:55440523-55440545 ATGTTTCTGCAGATGCAGCATGG - Intronic
991094371 5:62723809-62723831 TTGGATCTGCAGGAGCAGCTGGG - Intergenic
991457239 5:66817030-66817052 CTGGTGGGGCAGAAGCACCGAGG - Intronic
992151535 5:73909454-73909476 CTGGTTCTCCAGCAGCAGGAGGG + Exonic
997101689 5:130976271-130976293 CTGGTTGTGCAGCAGCACAGTGG + Intergenic
999190187 5:149741478-149741500 CTGCTTCTGCAAAGGCAGGGTGG - Intronic
1000986827 5:167869640-167869662 CTGCTAGTGCAGAAGCTGCGAGG - Intronic
1001912759 5:175534582-175534604 CAGGTTCTGCAGGAGCACGGAGG + Intergenic
1002283274 5:178145901-178145923 CTCATCCTGCAGAAGCAGCCTGG + Intronic
1002321250 5:178377407-178377429 CTGATTCTCCAGAAGCAGTGGGG - Intronic
1003508527 6:6759864-6759886 CAAGCTCTACAGAAGCAGCGCGG - Intergenic
1006989107 6:38198274-38198296 TTGGTCCTGCAGTAGCAGTGTGG + Intronic
1014322098 6:119942758-119942780 CTTGTTCTGGAGAAGCATAGAGG - Intergenic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1017311613 6:152982901-152982923 CTGGCGCTGCAGGAGCAGCGGGG + Exonic
1018103585 6:160463093-160463115 TTTGTTCTGCAGAAGCATCTTGG - Intergenic
1018131379 6:160735151-160735173 CTTTTTCTGCAGAAGCATCTTGG + Intronic
1018380032 6:163250408-163250430 CTAATTCTGCAGAAGCAGTGTGG - Intronic
1019080454 6:169426070-169426092 CTGGGTCTTCAGGAGCAGTGTGG - Intergenic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019546623 7:1580617-1580639 CTGGCTCTGCAGAGGTAGCCAGG + Intergenic
1020397816 7:7736979-7737001 CAGCTTCTGGAGAAGCAGTGGGG - Intronic
1021287216 7:18795385-18795407 CTGGTTCTGCACAATCATCTAGG + Intronic
1022221191 7:28315498-28315520 CTTGTTCTGCAAAAGCAGACAGG + Intronic
1023602991 7:41898886-41898908 CTGGTTCTGAAGCATCAGCATGG + Intergenic
1024563841 7:50665682-50665704 CTGCTTCTGTAGAAGCACCTGGG + Intronic
1024607946 7:51038278-51038300 CAGGTGCTGCAGCAGCAGCGAGG + Intronic
1025177828 7:56810892-56810914 CTGGTCCTGCAGAGGCTGCCGGG + Intergenic
1025177986 7:56811538-56811560 CTGGTCCTGCAGAGGCTGCCGGG + Intergenic
1025181093 7:56824314-56824336 CTGGTCCTGCAGAGGCTGCCGGG + Intronic
1025181967 7:56827898-56827920 CTGGTCCTGCAGAGGCTGCCGGG + Intergenic
1025690391 7:63750924-63750946 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1025690839 7:63752747-63752769 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1025691279 7:63754522-63754544 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1025691718 7:63756346-63756368 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1025692165 7:63758169-63758191 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1025692612 7:63759992-63760014 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1025693027 7:63761671-63761693 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1025693473 7:63763494-63763516 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1025693920 7:63765333-63765355 CTGGTCCTGCAGAGGCTGCTGGG - Intergenic
1026517808 7:71087839-71087861 CTTGTTCTGCAGAGGCAACAGGG + Intergenic
1035049422 7:155990126-155990148 CTGGCCCTGGAGAAGCAGCTGGG + Intergenic
1035049535 7:155990532-155990554 CTGGTCCTGGAGGAGCAGCTGGG + Intergenic
1039663020 8:39487748-39487770 CTTGTTCTGCAGAAGGAAGGGGG - Intergenic
1040346754 8:46509354-46509376 CTGGTTTTGTAGAATCTGCGAGG - Intergenic
1040347033 8:46514157-46514179 CTGGTTTTGTAGAAACAGTGAGG + Intergenic
1043745480 8:83869206-83869228 CTGGGTCTCCAGCAGCAGCAGGG - Intergenic
1043783301 8:84363829-84363851 ATGATTCTTCAGCAGCAGCGGGG - Intronic
1046821030 8:118634555-118634577 CAGGTTCTGCAGCAGCATCCAGG + Intergenic
1048346598 8:133580540-133580562 GAGGCTCTGCAGAAGCAGTGAGG - Intergenic
1048548061 8:135405194-135405216 CTGGGTCTGCAGCTGCAGCTAGG + Intergenic
1049420015 8:142512283-142512305 CTGGTTCTGCAGACAGAGCCTGG + Intronic
1049823871 8:144654704-144654726 CTGGGTCTGCAGCAGCAGCTTGG - Intergenic
1056434384 9:86561348-86561370 TTGGTTCTGCAGGAGAAGTGAGG + Intergenic
1056681082 9:88719755-88719777 CTGGTGGTGTAGAAGCAGTGTGG + Intergenic
1056814361 9:89791051-89791073 TTGTTTCTGCAGAACCAGCAAGG + Intergenic
1056841363 9:90000226-90000248 CTCTTTCTGCAGGAGCAGCAGGG - Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1057510916 9:95678831-95678853 CTGGGTCTGCAGTGGCAGCTTGG + Intergenic
1057642220 9:96835571-96835593 CTGTTTCAGCTGAAGCAGCTAGG - Intronic
1058419210 9:104818757-104818779 CTGTTTCTGAAGAACCAGCTGGG - Exonic
1058419214 9:104818762-104818784 CTGGTTCTTCAGAAACAGGGAGG + Exonic
1058545906 9:106059969-106059991 TTGGGTCTGCAGCAGCAGCCAGG + Intergenic
1059413837 9:114151125-114151147 GTGGGTCTTCAGAAGCAGCTTGG + Intergenic
1060496859 9:124125598-124125620 CTGGCTCTTCAGGAGCAGCTTGG + Intergenic
1061178219 9:129009774-129009796 CTGGACTTGCAGAAGCAGCTGGG - Exonic
1061442507 9:130615837-130615859 TTGGTTATGAAGAAGAAGCGTGG + Intronic
1062292241 9:135801325-135801347 CTGGTTTTGCAGATGGAGGGAGG - Intergenic
1203466724 Un_GL000220v1:95181-95203 CTGATTCTGCAAAAGCAGATGGG + Intergenic
1188830040 X:34885237-34885259 CTGGTTCTGGAGAAGCTCTGGGG - Intergenic
1191962370 X:66718173-66718195 CTGGTGTTGGAGAAGCAGCCTGG + Intergenic
1192321659 X:70095020-70095042 CTGCTTTTGCAGAAACAGCAAGG + Intergenic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1194835228 X:98673115-98673137 CTGGTGGTGCAGGAGCAGGGTGG + Intergenic
1201769055 Y:17600029-17600051 CTGATTCTGCAAAAGCAGATGGG - Intergenic
1201832499 Y:18305956-18305978 CTGATTCTGCAAAAGCAGATGGG + Intergenic