ID: 952420234

View in Genome Browser
Species Human (GRCh38)
Location 3:33123768-33123790
Sequence TACAAGCATGTGACTACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952420229_952420234 25 Left 952420229 3:33123720-33123742 CCTAGGTTCAAGTGATTCTTGTG 0: 816
1: 5243
2: 36132
3: 104883
4: 155356
Right 952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG 0: 1
1: 0
2: 6
3: 30
4: 194
952420228_952420234 28 Left 952420228 3:33123717-33123739 CCTCCTAGGTTCAAGTGATTCTT 0: 106
1: 6260
2: 57547
3: 127196
4: 166589
Right 952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG 0: 1
1: 0
2: 6
3: 30
4: 194
952420233_952420234 -4 Left 952420233 3:33123749-33123771 CCTCGTGAGTAGCTGGGACTACA 0: 133
1: 43740
2: 165943
3: 225873
4: 208175
Right 952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG 0: 1
1: 0
2: 6
3: 30
4: 194
952420231_952420234 2 Left 952420231 3:33123743-33123765 CCTCAGCCTCGTGAGTAGCTGGG 0: 291
1: 98515
2: 207581
3: 240402
4: 153724
Right 952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG 0: 1
1: 0
2: 6
3: 30
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952420234 Original CRISPR TACAAGCATGTGACTACACC TGG Intronic
900940712 1:5796813-5796835 TTCAAGCATCTGACTATTCCTGG + Intergenic
901505437 1:9682377-9682399 TACAGGCATGCCACTACACTTGG + Intronic
901760831 1:11470156-11470178 TACAGGTATGAGACCACACCTGG - Intergenic
901925314 1:12562243-12562265 TACAGGCATGTCACCACTCCTGG - Intergenic
904371864 1:30052860-30052882 TACAGGCAAGTCACCACACCCGG + Intergenic
904588494 1:31593739-31593761 TACAGGCATATCACCACACCTGG + Intergenic
906340864 1:44979515-44979537 TACATGCATGCCACCACACCTGG - Intronic
906483331 1:46215755-46215777 TACAGGCATGTACCTACACCTGG - Intronic
907075768 1:51576666-51576688 CACAAGCATGCCACTACACCTGG + Intergenic
908370821 1:63475412-63475434 TACAGGTATGTTACTACCCCTGG - Intronic
911674441 1:100643234-100643256 TAGTAGCATGTGGCTACACGAGG - Intergenic
911786543 1:101956757-101956779 TAAAAACATGTAACTACAACTGG + Intronic
915968318 1:160331803-160331825 CAGATGCATGTGACCACACCTGG - Intronic
916702828 1:167315661-167315683 TACCAGCATGTCACCACACCTGG - Intronic
916723244 1:167501193-167501215 TACAGGCATGCCACCACACCTGG + Intronic
917331978 1:173890137-173890159 TACAGGCGTGTGACCACACCTGG + Exonic
917996698 1:180446763-180446785 TACAGGCATGAGACTGCACCTGG - Intronic
919704095 1:200659826-200659848 TACAGGCATGCCACCACACCTGG + Intronic
920411612 1:205765923-205765945 TACACGCATGCCACCACACCTGG - Intergenic
921011140 1:211142885-211142907 TACGGGCATGGGACTACATCTGG - Intergenic
921443308 1:215214683-215214705 TACAGGCATGCCACCACACCAGG - Intronic
922238375 1:223738299-223738321 TAGAAGCATGACACCACACCTGG + Intronic
924602850 1:245506819-245506841 TACAACCATGTAATTACACTCGG + Intronic
1064983315 10:21185637-21185659 TACAGGCATGCCACCACACCTGG + Intergenic
1066170178 10:32834393-32834415 TACAAGCATATCCATACACCAGG - Intronic
1069549900 10:69356289-69356311 TACAGGCATACGACCACACCTGG - Intronic
1071684236 10:87737680-87737702 TACAAGCATGCCACCACACCTGG - Intronic
1073297832 10:102451533-102451555 TACCAGCGTCTGTCTACACCTGG + Exonic
1073385068 10:103119821-103119843 TACAGGCATGAGACTGCAACTGG - Intronic
1074187638 10:111110688-111110710 TACAGGCATGAGACTGCACCTGG + Intergenic
1075471489 10:122693629-122693651 TACAGGCATGTCACCACACCCGG + Intergenic
1075812957 10:125240388-125240410 TACAGGCATGCCACCACACCTGG + Intergenic
1076594661 10:131618155-131618177 AACAAGCATGCCACCACACCCGG - Intergenic
1077032623 11:476410-476432 AACAAGCACGTAACTGCACCAGG - Intronic
1078929188 11:15900416-15900438 TAGAAGCATTTGGCTATACCAGG + Intergenic
1081143984 11:39538016-39538038 TACAGGCGTGAGACCACACCTGG + Intergenic
1082045995 11:47728017-47728039 TACAGGCATGCGACCACGCCTGG + Intronic
1083848383 11:65350522-65350544 TACAGGCATGCCACCACACCCGG + Intronic
1084761801 11:71277751-71277773 TACTAGCATGTTACCACGCCCGG - Intergenic
1088281871 11:108143161-108143183 TACAGGCATGCTACCACACCTGG - Intronic
1090392543 11:126398474-126398496 TGCAAGCATGAGACTCCAACCGG - Intronic
1091432190 12:445855-445877 TACAAGCATCCCACTGCACCTGG + Intergenic
1092278174 12:7078352-7078374 TACAGGCATGTGCCACCACCTGG + Intergenic
1093750090 12:22788259-22788281 TACAAGCATGCCACCACACTTGG - Intergenic
1093837080 12:23845685-23845707 GACAAGCAGGTGACTATTCCCGG + Intronic
1095711985 12:45299709-45299731 TACAGGCGTGCCACTACACCTGG - Intronic
1096334383 12:50742254-50742276 TACAGGCATGCCACCACACCTGG - Intronic
1096872137 12:54599718-54599740 TACAATCTTGTTACTACCCCTGG - Intergenic
1097390092 12:59000212-59000234 CAGATGCATGTCACTACACCTGG + Intergenic
1100498633 12:95151409-95151431 TACAGGCATGCCACCACACCTGG + Intronic
1101137030 12:101754284-101754306 TACAGGCATGCCACCACACCCGG - Intronic
1102831544 12:116006371-116006393 ACCAAGGATGTCACTACACCAGG - Exonic
1104223112 12:126805196-126805218 TAGAAGCACGTGACTAAAACTGG - Intergenic
1106039138 13:26073094-26073116 AAGAAGAATCTGACTACACCCGG + Intergenic
1106202189 13:27548452-27548474 CACAATCATGTCACCACACCTGG + Exonic
1106332637 13:28753695-28753717 TACAGGCATGTGAGTACGCCAGG - Intergenic
1106498314 13:30303422-30303444 TTCAGGCATGTGGCCACACCCGG - Intronic
1107366793 13:39687778-39687800 TTAAAGCATGTAACTACACAAGG + Exonic
1107526628 13:41239123-41239145 TACAGGCATGCCACTATACCTGG - Intronic
1109955496 13:69559841-69559863 TACAAGCTTGTAACCACACCTGG + Intergenic
1111337065 13:86838667-86838689 TACAAGGCTGTGGCTACACCAGG + Intergenic
1111790101 13:92844367-92844389 AACAAGCATGGGAATAAACCAGG + Intronic
1115207953 14:30933136-30933158 CACAGGCGTGTGACCACACCTGG - Intronic
1115251139 14:31349245-31349267 TACAGGCATGTGCCACCACCCGG - Intronic
1116377088 14:44216619-44216641 TACAGGCATGCCACCACACCTGG - Intergenic
1117151165 14:52889851-52889873 TACAAGCATGAGCCAACACCTGG - Intronic
1117231556 14:53724581-53724603 TACAGGCATGAGCCTACCCCTGG + Intergenic
1117404911 14:55392504-55392526 TAGATGCATGTCACCACACCTGG - Intronic
1118475380 14:66111549-66111571 TGCAAGCATGTGACTGAAGCAGG - Intergenic
1119683232 14:76608678-76608700 TACAGGCATGCCACCACACCTGG - Intergenic
1120931685 14:89855198-89855220 TACAGGCATGCCACCACACCTGG - Intronic
1120999035 14:90438144-90438166 TACAAGTGTGTGATTACAGCTGG + Intergenic
1121339156 14:93094692-93094714 GACGAGCATGTGTCCACACCTGG + Intronic
1122993894 14:105252197-105252219 TACAGGCATGAGACCGCACCTGG - Intronic
1123793709 15:23750352-23750374 TACAACCATGAGACTCCACTGGG + Intergenic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1128842393 15:70860553-70860575 TACAGGCATGCCACCACACCTGG + Intronic
1129910665 15:79223389-79223411 TAGATGCCAGTGACTACACCAGG + Intergenic
1134584782 16:15400489-15400511 TACAGGCACGCTACTACACCTGG + Intronic
1135257660 16:20954080-20954102 TACAAGCATGCCACCACACCCGG - Intronic
1138566385 16:57836253-57836275 TACAGGCATTCCACTACACCCGG + Intronic
1138814432 16:60188019-60188041 TACAAGCATGCAACCACACCAGG + Intergenic
1139441224 16:66968441-66968463 TACAGGCATGAGGCTGCACCCGG + Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1140051596 16:71486223-71486245 TACAGGCGTGTGCCCACACCTGG - Intronic
1140795319 16:78432246-78432268 TACAGGCATGCCACCACACCTGG + Intronic
1142829813 17:2540228-2540250 TACAGGCATGAGACTGCACACGG - Intergenic
1142950416 17:3473771-3473793 TACAAGCATGAGACCACACCTGG + Intronic
1144470500 17:15536047-15536069 TACCAGCCTGCCACTACACCTGG - Intronic
1147247267 17:39130701-39130723 TACAAGCATGCCACCACGCCCGG + Intronic
1147737965 17:42653049-42653071 TACAGGCATGTGCCACCACCCGG + Intergenic
1147930996 17:43981143-43981165 TACAAGCATGAGACCATGCCTGG + Intronic
1148651512 17:49253428-49253450 TACAAGCATGCCACCACATCTGG - Intergenic
1150035224 17:61788951-61788973 CACAAGCATGCCACCACACCTGG - Intronic
1150180953 17:63120536-63120558 TACAAGCATGAGTCACCACCTGG - Intronic
1150712723 17:67545433-67545455 TACAGGCATGCCACCACACCTGG - Intronic
1150758137 17:67934577-67934599 TAGAAGTATGTGAGTACAGCTGG + Intronic
1153209333 18:2742817-2742839 TAGACGCATGCCACTACACCTGG + Intronic
1153669394 18:7395714-7395736 TAAAAGCATGGCACTCCACCAGG + Intergenic
1154228824 18:12534832-12534854 TACAGGCATGAGCCTGCACCTGG + Intronic
1155210608 18:23597510-23597532 TCCTAGCAAGTCACTACACCTGG + Intergenic
1156068329 18:33173323-33173345 TACAAGCATGAGACTGTGCCTGG + Intronic
1156298578 18:35815621-35815643 TATAAGCATGTGACCACACCAGG + Intergenic
1158283630 18:55854605-55854627 GACCAGCATGTGAATACACAGGG - Intergenic
1159294682 18:66469234-66469256 GGCAAGCATGTGACTACAAATGG - Intergenic
1161095116 19:2385708-2385730 TACAGGCATGCCACCACACCCGG - Intergenic
1162664357 19:12197005-12197027 TACAGGCATGTGCCTCCACACGG + Intergenic
1163794042 19:19325752-19325774 TACAGGCATGCCACCACACCCGG + Intronic
1163816906 19:19472019-19472041 TAGATGCATGCTACTACACCTGG + Intronic
1165251447 19:34539699-34539721 TGCAGGCATATGCCTACACCTGG + Intergenic
1165503410 19:36208340-36208362 CACAGGCATGCCACTACACCTGG + Intronic
1166040818 19:40201631-40201653 TACAGGCATGCCACCACACCAGG + Intronic
1166890725 19:45991027-45991049 TACAGGCATGCCACTGCACCTGG + Intergenic
925570279 2:5303172-5303194 TACAGGCATGTGCCACCACCAGG - Intergenic
925929036 2:8693161-8693183 AACATGCATGGGACTACGCCAGG + Intergenic
926118328 2:10227157-10227179 TAGAAGCATGCTACTACGCCCGG - Intergenic
926529418 2:14024307-14024329 TACCAGCATGTGACAAGACTAGG + Intergenic
928707463 2:33965711-33965733 TGCAATCAAGTGACTACAGCTGG + Intergenic
930156028 2:48108399-48108421 TACAGGCATGCCACTGCACCCGG + Intergenic
931431327 2:62211211-62211233 TACAGGCATGTCACCACACCTGG - Intronic
932391908 2:71399624-71399646 AACAAACCTGTGACTATACCAGG + Exonic
932550394 2:72763936-72763958 TACAGGCATGCCACCACACCCGG - Intronic
932668313 2:73715670-73715692 TACAGGCATGTGCCACCACCCGG + Intergenic
935804608 2:106733348-106733370 TAAAAGCTTGTGACTGCACCAGG - Intergenic
936710392 2:115124081-115124103 TACAAGCATACCACCACACCTGG + Intronic
937306231 2:120872660-120872682 AACCAGCAGGTGACGACACCTGG - Intronic
937332387 2:121039712-121039734 TGCAAGCATGTCACTAGACAGGG + Intergenic
938297563 2:130187901-130187923 TACAAGCATGGGGCCACACCTGG - Intronic
938459207 2:131486763-131486785 TACAAGCATGGGGCCACACCTGG + Intronic
939159254 2:138566853-138566875 TACAAGCACTTGACTAACCCTGG + Intronic
943431561 2:187809268-187809290 TACAGGCATGAGTCTGCACCTGG - Intergenic
945303990 2:208241363-208241385 TATAGGCATGCGACCACACCTGG + Intronic
948406070 2:237720523-237720545 TACAGGCATGACACCACACCTGG + Intronic
1169379245 20:5092573-5092595 TACAGGCATGTGCCACCACCTGG - Intronic
1169485662 20:6029500-6029522 TACAGGCATGCCACCACACCTGG + Intronic
1170363507 20:15574142-15574164 TCCAAGCATGTGCAGACACCAGG + Intronic
1173907594 20:46640220-46640242 TACAAGAAAGTGCCGACACCTGG - Intronic
1174883316 20:54304379-54304401 TACAAGCATGCCACCACACTGGG + Intergenic
1175538908 20:59736102-59736124 TGCAAGCATGTGACATCAGCAGG + Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1179318212 21:40265048-40265070 TAGATGCCTGTCACTACACCTGG - Intronic
1181087110 22:20445902-20445924 TACAGGCATGCAACCACACCTGG + Intronic
1181867729 22:25872622-25872644 TACAAGCAAGTGGCAACACCAGG - Intronic
1182194328 22:28499035-28499057 CACAGGCGTGTGCCTACACCTGG - Intronic
1183755308 22:39756473-39756495 TACAGGCATGTCACCACACCTGG + Intronic
952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG + Intronic
953503100 3:43457261-43457283 TACAAGCATGTTTCTGCAGCAGG - Intronic
954544697 3:51423214-51423236 TACAGGCATGAGACCACGCCTGG - Intronic
960315311 3:116168923-116168945 TACAGGCATGTGCCTAGCCCTGG - Intronic
961811472 3:129524202-129524224 TACAGGCATGCCACCACACCTGG - Intergenic
962638181 3:137353296-137353318 TACAAGCATGCCACCACAACAGG - Intergenic
965588811 3:170343233-170343255 TACAGGCATGCCACCACACCCGG + Intergenic
966167044 3:177031472-177031494 TACAGACATGTCACCACACCTGG + Intronic
967873479 3:194250934-194250956 TGCACGCATGTGTCTGCACCCGG + Intergenic
973666507 4:53164649-53164671 TACAGGCATGCCACCACACCCGG - Intronic
974366107 4:60951464-60951486 TATAAGCATATGACTGAACCAGG - Intergenic
974732978 4:65894115-65894137 CTCAAGCATGTGACTACATTAGG - Intergenic
975055084 4:69920060-69920082 TCCATGCATTTGACTACTCCAGG + Intergenic
976555108 4:86441771-86441793 GACAAGCATCTGTCTACTCCAGG + Intronic
976731211 4:88263811-88263833 TACATGCATGCCACCACACCTGG + Intronic
978030014 4:103929897-103929919 TACAAGCACGCCACCACACCCGG + Intergenic
979020736 4:115493971-115493993 TACAGGCATGTCACCACGCCTGG + Intergenic
981109042 4:140914482-140914504 TAGAATCTTGTGAATACACCAGG + Intronic
981947476 4:150365147-150365169 TACAAGCATGCCACCACACCCGG + Intronic
983083710 4:163417773-163417795 TACAGGCATGTGACCACACCTGG - Intergenic
986981515 5:13453322-13453344 TTCACTAATGTGACTACACCTGG - Intergenic
988879131 5:35481555-35481577 TCAAAGCATGAGACTAAACCTGG + Intergenic
990162362 5:52956309-52956331 AACAATAATGTGACTGCACCTGG - Exonic
991661175 5:68952169-68952191 TACAGGCATGCCACCACACCAGG + Intergenic
993705356 5:91163305-91163327 GACAGGCATGTGAGAACACCTGG - Intronic
995232456 5:109784006-109784028 TAGGTGCATGTCACTACACCTGG + Intronic
996263408 5:121503268-121503290 GACAAGCATCTGACTACCCCAGG + Intergenic
997486302 5:134233866-134233888 TACAAGCGTGTGACCCCACCTGG + Intergenic
997998969 5:138609147-138609169 TACCACCATATGCCTACACCTGG + Intergenic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
998448329 5:142215565-142215587 TACAGGCATGCTACAACACCTGG - Intergenic
998469010 5:142368786-142368808 TACAAGCATGTCACCACACCTGG + Intergenic
1001873330 5:175177454-175177476 TACAGGCATGCCACCACACCTGG - Intergenic
1003545821 6:7057499-7057521 TACAAGCATATCACTGCTCCCGG - Intergenic
1004654994 6:17651161-17651183 TACAGGCATGCCACTGCACCTGG - Intronic
1005645480 6:27833865-27833887 TACAGGCATGTGACACCACCTGG - Intergenic
1006891766 6:37434749-37434771 TACAGGCATGTGCCACCACCCGG + Intronic
1007549340 6:42717080-42717102 TACAAGCATGAGCCCGCACCTGG + Intronic
1007930848 6:45689270-45689292 TACAGGCATGCCACCACACCTGG + Intergenic
1008914535 6:56773045-56773067 AACAAGCATGTGAGTAAGCCTGG + Intronic
1009427950 6:63535321-63535343 TACAAGCATGCCACTATGCCTGG - Intronic
1009441613 6:63687139-63687161 TACAGGCATGCGACTGCGCCTGG - Intronic
1009870756 6:69450145-69450167 TGCAAGAATGTGGCTAGACCAGG + Intergenic
1011590650 6:88967133-88967155 TACAGGCACGTCACCACACCTGG - Intergenic
1011608724 6:89129732-89129754 TACATGCATGTCACTGTACCTGG + Intergenic
1013398960 6:109772595-109772617 TACAAGCATGTGCCACCACCTGG + Intronic
1016960644 6:149669482-149669504 TGCAAGCATGAGCCTGCACCTGG - Intronic
1019169974 6:170128391-170128413 TACAAGTGTGTCACCACACCTGG - Intergenic
1019842725 7:3464378-3464400 TACAGGCATGCCACTACACTGGG - Intronic
1023439896 7:40174398-40174420 CACAAGCATGCCACCACACCTGG + Intronic
1023545572 7:41314842-41314864 TACAACCACGCCACTACACCCGG + Intergenic
1023974842 7:45021113-45021135 TACAGGCATGTCGCCACACCTGG - Intronic
1025039279 7:55626169-55626191 TAGAAGCATGCCACTACGCCTGG + Intergenic
1025194953 7:56925396-56925418 GACAAGCATGTGACCCCATCAGG - Intergenic
1025676999 7:63651547-63651569 GACAAGCATGTGACCCCATCAGG + Intergenic
1028887311 7:95948400-95948422 TACAAGCATGGGTCTACTCGAGG - Intronic
1033292210 7:140095734-140095756 TAGATGCATGTCACCACACCTGG - Intronic
1036931922 8:12964713-12964735 TATAAGCATGCCACCACACCAGG + Intronic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1039252196 8:35679107-35679129 TACAGGTATGTCACCACACCAGG - Intronic
1039920077 8:41887389-41887411 TACAGGCATGCCACCACACCTGG + Intronic
1041670278 8:60484841-60484863 TACAGGCATGCCACTACACCTGG - Intergenic
1041699587 8:60773548-60773570 TGCAAGCCTGTGACTTCATCTGG + Intronic
1042395267 8:68284976-68284998 TACAAGCATGTGCCACCACGCGG - Intergenic
1046179036 8:110618560-110618582 TACAAGCATGCCACTACACCTGG + Intergenic
1046249532 8:111611898-111611920 TGCAAGGCTGTGGCTACACCGGG + Intergenic
1049151717 8:141039249-141039271 TCCAAGAATGTGACTCCTCCAGG + Intergenic
1049931220 9:458668-458690 TACAGGCACGCCACTACACCCGG - Intronic
1052905314 9:33828527-33828549 TACAGGCATGTGCCACCACCGGG + Intronic
1055573198 9:77637711-77637733 TACAGGCATGCTACCACACCCGG - Intronic
1055813794 9:80181739-80181761 TACAACCAAGTGACCCCACCTGG + Intergenic
1056531930 9:87496054-87496076 TACAGGCATGTGACTATGCCCGG - Intergenic
1057731250 9:97610716-97610738 TTCTAACATGTGACTATACCCGG + Intronic
1058230610 9:102419766-102419788 TATAAGCTTGTGACTAAATCTGG - Intergenic
1059835311 9:118145565-118145587 TACCAGCATGTGACTAGTCCAGG - Intergenic
1060048940 9:120363053-120363075 TACAGGCATGCCACTATACCTGG + Intergenic
1060274235 9:122170153-122170175 TACAGGCATGCCACCACACCCGG - Intronic
1061123663 9:128659925-128659947 TAGATGCATGCCACTACACCTGG - Intergenic
1061979160 9:134090230-134090252 TACAAGGTTGTGCATACACCAGG + Intergenic
1185994089 X:4924982-4925004 TAGGCGCATGTCACTACACCTGG - Intergenic
1186240587 X:7561210-7561232 TACAGGCATGCAACCACACCAGG + Intergenic
1187008342 X:15253765-15253787 TACAAGAATGTGTCTGCACTTGG - Intronic
1190772112 X:53523895-53523917 TACAGGCTTGTTACCACACCTGG - Intergenic
1194579631 X:95655922-95655944 TACAATCATGAGACTACAGAAGG - Intergenic
1200410264 Y:2853971-2853993 TACAGGCATGTGCCACCACCCGG + Intronic
1201912236 Y:19144559-19144581 TACAGGCATGTCACTACACCTGG - Intergenic