ID: 952422295

View in Genome Browser
Species Human (GRCh38)
Location 3:33143201-33143223
Sequence GGAGAAAGGAGACTAAAATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952422295_952422305 7 Left 952422295 3:33143201-33143223 CCAGATTTTAGTCTCCTTTCTCC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 952422305 3:33143231-33143253 GGAAAGATGGTGGAAGACATAGG 0: 1
1: 0
2: 4
3: 44
4: 444
952422295_952422299 -6 Left 952422295 3:33143201-33143223 CCAGATTTTAGTCTCCTTTCTCC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 952422299 3:33143218-33143240 TTCTCCCCATCCGGGAAAGATGG 0: 1
1: 0
2: 0
3: 10
4: 135
952422295_952422300 -3 Left 952422295 3:33143201-33143223 CCAGATTTTAGTCTCCTTTCTCC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 952422300 3:33143221-33143243 TCCCCATCCGGGAAAGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952422295 Original CRISPR GGAGAAAGGAGACTAAAATC TGG (reversed) Exonic
901136431 1:6999875-6999897 GGAAAAAGCAGACTGAAATCAGG - Intronic
903629228 1:24754186-24754208 TGAGAAAGGAGCCTAGAATGGGG + Intronic
904358227 1:29955193-29955215 GGAGAAAGGTGTTTAAAATTGGG + Intergenic
905382562 1:37573487-37573509 GGAGAAAGAAGACTGAAGGCTGG - Intronic
905510003 1:38511594-38511616 GGATGAAGGAGACAAAAATGTGG - Intergenic
905802422 1:40853621-40853643 GGAGAAGGGTGACTAAATCCTGG + Intergenic
906022738 1:42644993-42645015 GGAGATAGTTTACTAAAATCTGG - Intronic
906638198 1:47424502-47424524 GGAGAAAGGAGATTAGAAAGAGG - Intergenic
906713264 1:47948464-47948486 GGAGACAGGAGACAAAAGACAGG + Intronic
907082660 1:51638448-51638470 ATAGAAAGGAGACTACATTCTGG + Intronic
909935393 1:81545089-81545111 GGAGAAAGGAGAGAAAAAGAAGG + Intronic
912210871 1:107555651-107555673 GGATAGAAGATACTAAAATCTGG + Intergenic
912429842 1:109623347-109623369 GGAGAAAGGGGGCTAGAATTTGG - Intronic
913280048 1:117177122-117177144 GGAAAAAGAAGATTAAAAGCGGG + Intronic
913482468 1:119301911-119301933 GGAAAAAGGTGACAAAAATGAGG + Intergenic
915312307 1:155010823-155010845 GGAGAAAGGAGACAGAAGTAAGG + Intronic
916636955 1:166681886-166681908 GGAGAATAGTGACTGAAATCTGG + Intergenic
917233041 1:172858306-172858328 GGGGAAAGGAGACTAAAATGAGG - Intergenic
918022372 1:180707641-180707663 AGAAAAAGAAAACTAAAATCAGG - Intronic
918414436 1:184291952-184291974 GGAGAAAAGAGACTAAAAACAGG - Intergenic
918450649 1:184654449-184654471 GGAGAAAAAAGACTAAAGTGAGG + Intergenic
918846567 1:189622476-189622498 GGAGAGAGGAGACAAAAAAGCGG + Intergenic
919484246 1:198127558-198127580 GGAGAAAGAAGCCTAGGATCTGG - Intergenic
920615485 1:207488295-207488317 GGAGAAAGCAGTTTAAACTCAGG - Intronic
920952012 1:210581337-210581359 TGAGAAAGAACACTAAAATGTGG + Intronic
920998002 1:211013595-211013617 GGAGTCAGGAGACTAGAGTCCGG + Intronic
921028339 1:211311657-211311679 TGAGAAAGGAGACAAAAATATGG - Intronic
921466110 1:215490328-215490350 GAAGAAAGGAGGATAAAAACTGG + Intergenic
922293221 1:224226293-224226315 GGCCAAAGGAGAGTCAAATCTGG + Intergenic
923873939 1:238027394-238027416 GTAGAAAGGAGAATACATTCTGG + Intergenic
924014181 1:239701902-239701924 GGAGAAAAGAGGTTGAAATCTGG - Intronic
924151618 1:241135600-241135622 GGAGAAAGGATACTAAACTCTGG + Intronic
924829987 1:247583363-247583385 AGATAAATGAGACAAAAATCTGG + Intergenic
1062878160 10:958402-958424 GAAGAAAGGAGAAGAACATCAGG - Intergenic
1063419650 10:5901504-5901526 GGTCAAAAGAGAATAAAATCAGG - Intronic
1063702850 10:8402284-8402306 GAAAAAAGGAGAAAAAAATCAGG + Intergenic
1065343417 10:24725765-24725787 TGATAAAGGAGAGTAAAATGTGG + Intergenic
1065492996 10:26301562-26301584 AGAGAAAGGAAAAAAAAATCTGG - Exonic
1066366446 10:34781440-34781462 TGTGAAAGGAGGCTGAAATCTGG - Intronic
1069324508 10:67216443-67216465 GGAGGAAGGAGAAAAAAATAAGG + Intronic
1070222231 10:74459756-74459778 GGAGAAAAAAGAAAAAAATCAGG + Intronic
1070346665 10:75549783-75549805 GGAGAAAGGAGATTGAAAAGTGG - Intronic
1071663811 10:87533503-87533525 GGAGACAGTAAAATAAAATCTGG - Intronic
1075244912 10:120812349-120812371 GGTCAAACGAGGCTAAAATCAGG + Intergenic
1076160893 10:128243374-128243396 GAAGAAGGGAGACCAAAAGCAGG + Intergenic
1076667493 10:132101556-132101578 GGAAAAGGGAAAATAAAATCTGG - Intergenic
1077345372 11:2046564-2046586 GGGGAATGGAGAATAAATTCTGG - Intergenic
1077763042 11:5124344-5124366 AGAAAAAGGACACTAAAATAAGG + Intergenic
1077898171 11:6469533-6469555 TGAGAAAGGAGAGTAAAGTCTGG - Intronic
1077973000 11:7215555-7215577 GGATGCAGGAGACAAAAATCTGG - Intergenic
1078350788 11:10591475-10591497 GGAGGAAGGAAAGTAAAATGGGG + Intronic
1078368866 11:10728771-10728793 GGAGAAAAGAGACAAAAGTATGG - Intergenic
1079375723 11:19890057-19890079 CGAGAAAGGAAACTAACATACGG + Intronic
1080055839 11:27905535-27905557 GGAGAAATGAGACTGAAAACTGG - Intergenic
1080477667 11:32610335-32610357 GGAGAGTTGAGACAAAAATCAGG - Intronic
1080908348 11:36569487-36569509 GGAGAAAGCAGGCTAAAATATGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081400036 11:42632677-42632699 GGAGAAGTGAGACTCAAATAGGG - Intergenic
1084271010 11:68029214-68029236 AGAGACAGGAGACGAAACTCAGG - Exonic
1084391400 11:68879609-68879631 TGTGAAAGGAAAATAAAATCTGG - Intergenic
1090366584 11:126211674-126211696 GGAGAAGGGCGACTACAATGAGG + Exonic
1090463619 11:126913141-126913163 GGAGAAAGGACACTGAAAGATGG - Intronic
1090715038 11:129423001-129423023 AGATAAAAGAGAATAAAATCTGG - Intronic
1091693637 12:2613340-2613362 GCAGAACGGAGACTGGAATCCGG + Intronic
1091847232 12:3666760-3666782 GGACAAAGGAGAGAAAAAGCAGG - Intronic
1092023535 12:5222311-5222333 GCAGAAAGGACACTAAAGCCAGG - Intergenic
1094233136 12:28131402-28131424 GAAGAGAGGAGTCTAAAACCTGG + Intergenic
1096993132 12:55821183-55821205 GCAGAAAAGAGCCTAAAATTGGG + Exonic
1097608044 12:61780143-61780165 GCAGGAAGCAGATTAAAATCAGG + Intronic
1098301279 12:69056445-69056467 GGAGAATGGAGACCAGACTCTGG + Intergenic
1098389691 12:69956514-69956536 GGAAAGGAGAGACTAAAATCAGG - Intronic
1099286102 12:80715991-80716013 GGAGAAAGGAGACTCACCCCTGG + Intergenic
1099883937 12:88503698-88503720 GGAGAAAGGAGAGTAAGATGTGG - Intronic
1100935691 12:99662591-99662613 GAACAAAGGACATTAAAATCTGG - Intronic
1101048788 12:100838952-100838974 ACAGAAGGGAGACTAAAAGCAGG + Intronic
1102607748 12:114082145-114082167 GGAGATAGGATAATAAAAGCAGG - Intergenic
1102741541 12:115211703-115211725 AGAGAGAGGAGACTAAGGTCTGG - Intergenic
1103497313 12:121373103-121373125 TGAGAAAGAAAAATAAAATCTGG + Intronic
1103543530 12:121683179-121683201 GGAAAAAGGAGACAAAAAAAGGG - Intergenic
1103794511 12:123494118-123494140 GGAGAGAGGAGTATAAGATCAGG - Intronic
1105522224 13:21141081-21141103 GGAGAAATGAAATTGAAATCAGG - Intronic
1106160172 13:27194443-27194465 GGAGAAAGGAGCCTGAATCCAGG - Intergenic
1106293404 13:28387678-28387700 GAAAAAAGGAGCCTAAAATGGGG - Intronic
1108778142 13:53792530-53792552 GAAGTAAGGAGACTTAAATGGGG + Intergenic
1108841307 13:54619679-54619701 GAAGAAAGGAGATTAAAAAAAGG - Intergenic
1109646914 13:65271215-65271237 GAAGAAAGGTGCCTGAAATCAGG + Intergenic
1110018298 13:70436901-70436923 GCAGAAAGGAGAATAAACGCAGG + Intergenic
1110518629 13:76446661-76446683 GGAGACAGGAGATGAAAATTAGG - Intergenic
1111140152 13:84106602-84106624 GGAGTAAGGAGAGGAAAATAAGG + Intergenic
1111299431 13:86328101-86328123 TGAGAAAGAAAACTGAAATCAGG + Intergenic
1111921077 13:94411766-94411788 GGAGAGAAGAGACAAAAATAAGG - Intergenic
1112854795 13:103754696-103754718 GCAGAAAAGACACTTAAATCTGG - Intergenic
1113150158 13:107254355-107254377 TGAGAAATGAGACTTAAATTTGG + Intronic
1113699754 13:112375756-112375778 GGGGAAAGGAGGCTGAAACCTGG + Intergenic
1113892973 13:113746115-113746137 TGTGAAAGGAAAATAAAATCTGG + Intergenic
1114826843 14:26090917-26090939 GGAGAAAGGTGAAGAAAAACTGG + Intergenic
1116267018 14:42705374-42705396 AGGGAAAGGAAACTAAAATTTGG + Intergenic
1116580313 14:46632643-46632665 TGAGAAAGGAGAATAAAATTAGG + Intergenic
1117078401 14:52127078-52127100 GTAGAGAGGTGAATAAAATCTGG + Intergenic
1119885763 14:78140100-78140122 GGAGAAAAGAGACTAGAATGGGG + Intergenic
1120088454 14:80303330-80303352 GGAGAAAGGAGAGTTAACTAGGG - Intronic
1120536643 14:85704531-85704553 GGAAAAAGAAGACAAAAATTTGG + Intergenic
1122833520 14:104417958-104417980 GGGGAAAGCAGACTAAAATTAGG + Intergenic
1124352292 15:28965415-28965437 TGAAAAAGGAGAATAAAATTGGG - Intronic
1124795644 15:32775519-32775541 GAAGGAAGAAGACAAAAATCAGG + Intronic
1124838211 15:33216065-33216087 GGAGGAAGGAGAGTGAGATCAGG - Intergenic
1125179324 15:36863785-36863807 GGAGAAAGGAGAAAACAATCAGG - Intergenic
1125764445 15:42123811-42123833 GGAGAGAGGAGATTAAGAGCAGG + Intergenic
1125867954 15:43071682-43071704 GCAGAAACATGACTAAAATCTGG + Intronic
1127155229 15:56117249-56117271 GGAGAAAGGAGATTTAAACTGGG + Intronic
1127631998 15:60836285-60836307 GGAGAGAGGAGACAAAAAAAAGG + Intronic
1127897157 15:63311422-63311444 GGAAAAATGAAACAAAAATCTGG + Intergenic
1128899454 15:71407236-71407258 GGAGAAAGCAGACCTAAAACCGG - Intronic
1131245469 15:90788099-90788121 GGAAAAAAGAGATTAAAATGGGG + Intronic
1131597128 15:93809402-93809424 GTAGAATGGAGAATATAATCAGG - Intergenic
1132847666 16:2007913-2007935 GGAAAAAGGAGACTAGAGTGAGG + Intronic
1134885420 16:17786646-17786668 AGATATTGGAGACTAAAATCAGG - Intergenic
1135892694 16:26371699-26371721 GGAGGAAGGAGACAAAAGACAGG + Intergenic
1136394530 16:29985931-29985953 GGAGAAAGAAGACAAGAATGAGG - Intronic
1140420609 16:74815975-74815997 GGAGAAATGATGCTACAATCTGG + Intergenic
1141373039 16:83504948-83504970 AGAGAAAGGAGATTTAAAGCAGG - Intronic
1144278498 17:13700145-13700167 TGAAAAAGGAGAAGAAAATCAGG - Intergenic
1144501663 17:15792988-15793010 GGAAAACGTAGACTCAAATCAGG - Intergenic
1146679238 17:34795141-34795163 GGAAGAAGGGGAATAAAATCTGG + Intergenic
1147915884 17:43885572-43885594 GGAGAAGGGAGACACAAATATGG - Intronic
1148858254 17:50590863-50590885 GGAGAGAGGAGACTAAAGAGGGG - Intronic
1150558695 17:66276470-66276492 GGAAAAAGGAGGCTACAGTCAGG + Intergenic
1151053316 17:71004169-71004191 AGAGAGGGGAGACTAAAACCTGG + Intergenic
1151766706 17:76136784-76136806 AGAGAGAGGAGACCAAAATGAGG - Exonic
1153196599 18:2605016-2605038 GGAGAAAGGAGATTTAAAGATGG + Intronic
1155248845 18:23936826-23936848 GGAGAAAGGAGACTAGAGAGAGG + Intronic
1157053272 18:44195695-44195717 GGAAAAAGGAAACTGTAATCTGG - Intergenic
1157838776 18:50934679-50934701 GCAGAAATGAGCCTAAAAGCAGG + Intronic
1159607773 18:70493540-70493562 GAAGAAAGCAGACTAATAACTGG - Intergenic
1162859940 19:13499034-13499056 GGAGAAAGAAGACCAAAGTTTGG + Intronic
1163685107 19:18708190-18708212 GGAGAGAGGAGACCCAGATCTGG + Intronic
1165393345 19:35550657-35550679 GGAGAAAGGAGACTCAGTGCTGG + Intronic
1165867375 19:38946989-38947011 TGAAAGAGGTGACTAAAATCAGG + Intronic
1166763330 19:45238194-45238216 GGAGAGATGGGACCAAAATCAGG + Intronic
926109547 2:10173313-10173335 GGAGAAAGGGGACTAAGGACAGG - Intronic
928022685 2:27716205-27716227 GGAGGTAGGAGACTAAAGGCGGG - Intergenic
930329861 2:49968705-49968727 GGAGAAAGGAGAGTTTAATGTGG - Intronic
931227367 2:60343024-60343046 GGAAAAAGAAGAATAAAAGCTGG + Intergenic
931573157 2:63691135-63691157 GGATAATAGAGACTAAAAGCTGG - Intronic
932882692 2:75518569-75518591 GGAGAAAGGTCAGGAAAATCAGG - Intronic
933313954 2:80693616-80693638 GGAGGAAGGAGACAACAGTCAGG + Intergenic
934316006 2:91920947-91920969 GGATAAATGAAACTAAAAGCTGG + Intergenic
935891156 2:107679969-107679991 AAAGAAAGGAGAATTAAATCAGG - Intergenic
936348118 2:111690681-111690703 GGAGAACTGAGACTTGAATCTGG - Intergenic
937009341 2:118548155-118548177 AGAGAAAGGAAACTCAAATGGGG + Intergenic
937814199 2:126233116-126233138 GAAGAAAGGAGATTCAAATTTGG - Intergenic
938275389 2:130016054-130016076 CAAGAAAGGAGAGTATAATCAGG - Intergenic
938693013 2:133809566-133809588 GCAAGAAGGAAACTAAAATCAGG + Intergenic
939530772 2:143358252-143358274 GCAGAAAGGAGGTTACAATCTGG + Intronic
939978382 2:148747729-148747751 GAAGAAAGAAGACAATAATCAGG - Intronic
941018346 2:160382241-160382263 TTAGAAAGGAGTCTGAAATCTGG + Intronic
941407723 2:165111944-165111966 GGAGGAAGAAGAGTAGAATCTGG + Intronic
941463828 2:165801857-165801879 GGAGAAAGGAGAAGAGAGTCAGG + Intergenic
942413587 2:175736149-175736171 GGAGACAGGAAACTACAATGGGG - Intergenic
942651287 2:178171038-178171060 GGAAAAAGCAAACTAAAATTTGG - Intergenic
942846674 2:180434830-180434852 GGAGGGAGGAGACTAACATCTGG - Intergenic
943258989 2:185633189-185633211 GGAGAAAGGAGAATGAGTTCTGG - Intergenic
943491925 2:188564766-188564788 TGAGAGAGAAGACCAAAATCTGG + Intronic
945021128 2:205572761-205572783 GGAGAGACAAGACTACAATCAGG + Intronic
945542079 2:211100516-211100538 GGAGAAAGGTGACTGGAATAGGG - Intergenic
946788491 2:223273939-223273961 AGAGAAAGGACAGTTAAATCAGG + Intergenic
947405163 2:229768325-229768347 TGAGAATGGATTCTAAAATCTGG - Intronic
948146616 2:235712900-235712922 GGTGAAAGGAAAATAAAATAAGG - Intronic
1170145136 20:13165058-13165080 GAAGAAGAGAGACTTAAATCTGG - Exonic
1171225070 20:23435992-23436014 GCAGAAAGGAGACCAAAGGCTGG + Intergenic
1171802565 20:29638342-29638364 GGAGGAAGGACACTCAAGTCTGG - Intergenic
1172860474 20:38046185-38046207 AGGGAAAGGAGACTAAAAACAGG + Intronic
1172989773 20:39025977-39025999 GGAGAAGGTAGATTAAATTCAGG + Intronic
1178850689 21:36209752-36209774 GGGGAAAAGAGACAAAGATCTGG - Intronic
1179120928 21:38544968-38544990 GGAGAAAGAAGACCAAGAGCGGG - Intronic
1179198471 21:39189482-39189504 GGAAAAAAAAAACTAAAATCAGG + Intronic
1179247828 21:39648946-39648968 GGAGACAGGAGTCTAAGATCAGG - Intronic
1180104435 21:45608633-45608655 GGAGAATGGATACGCAAATCAGG - Intergenic
1182784799 22:32898415-32898437 GGAGAAAGGAGAGTGAACTCTGG - Intronic
1183613584 22:38927578-38927600 GCAGAACGGAGACTCAAAGCCGG + Intergenic
1185369384 22:50453982-50454004 GGAGAAAGGAGACTGCGATTGGG - Intronic
950671790 3:14531812-14531834 TGAGAAAGGAGACTTAGATGAGG - Intronic
951212402 3:19990100-19990122 GGAGAAAGGACATTAAATCCTGG + Intronic
951601765 3:24384489-24384511 GGTGAAAGGAGGATAAAATTTGG + Intronic
952107182 3:30084264-30084286 GTAGAAAAAAGTCTAAAATCTGG - Intergenic
952223629 3:31351129-31351151 GGAGAAAGGTACCTAAAATTTGG - Intergenic
952419924 3:33121708-33121730 GGAGGCATGAGGCTAAAATCAGG - Intronic
952422295 3:33143201-33143223 GGAGAAAGGAGACTAAAATCTGG - Exonic
953221430 3:40975259-40975281 GCAGAAAGGGGACTGAGATCAGG + Intergenic
953700681 3:45193323-45193345 GGAGAAAGTAGACTAGAAAGAGG - Intergenic
955167860 3:56532472-56532494 GGAAAAACGAGATTAGAATCTGG - Intergenic
955609673 3:60743811-60743833 GGAGAAAGGAGACTCAGCGCTGG + Intronic
956626185 3:71268971-71268993 GCAGAAGGAAGACAAAAATCTGG + Intronic
957794703 3:84988238-84988260 AGAAAAAGGATACTAAGATCTGG - Intronic
958482787 3:94665516-94665538 GGAAAATTGACACTAAAATCTGG - Intergenic
958978989 3:100698268-100698290 GGAGAAAGGACAATTATATCAGG + Intergenic
959045071 3:101464834-101464856 GCAGAAAGGAGACTAAAAAGGGG + Intronic
959625413 3:108444223-108444245 GAAGCAGGGAGACCAAAATCAGG + Intronic
960148506 3:114228575-114228597 GGAGAGAGGAGACAAATCTCAGG + Intergenic
960310926 3:116115510-116115532 GAAGAAAGGAGACTGAACACAGG - Intronic
960407246 3:117276942-117276964 GGAGATATGAGACTAAAAACAGG - Intergenic
963751627 3:149185694-149185716 GGAGAGACGAGAATAAAATGAGG - Intronic
964970589 3:162554575-162554597 TGAACAAGGTGACTAAAATCTGG - Intergenic
965129179 3:164672867-164672889 GGAGAAAGGAGACAAAAATAAGG - Intergenic
965869346 3:173247999-173248021 GGAGAAAGGAAAATAAAGACAGG + Intergenic
966572704 3:181464149-181464171 GGATAGAGGAGACTAGAATATGG - Intergenic
967018553 3:185502975-185502997 TGAGAAAGAAGACTGAAATCAGG + Intergenic
970030036 4:11663840-11663862 GGAGGAAGGTGACTAAATTAAGG - Intergenic
970665264 4:18329425-18329447 TGAGCAAGGAGACTAGAGTCAGG + Intergenic
971852487 4:32000878-32000900 GGATTAAGGAAACTATAATCTGG + Intergenic
972448919 4:39176574-39176596 AGAGAAAGGAGACCAAAAGTTGG - Intergenic
972699722 4:41482442-41482464 GGAGAAAGGAGAAGGAAATCAGG + Intronic
972840353 4:42923045-42923067 TGAGAAAGCAGACTAATGTCAGG - Intronic
974676608 4:65098135-65098157 GGAGAAAGGGGAGTATGATCTGG + Intergenic
975689277 4:76949130-76949152 TGAGAAGGGAGACTAAAGACAGG - Intergenic
975877896 4:78866444-78866466 GGAGAAATAGGACTCAAATCAGG - Intronic
975991195 4:80262013-80262035 GGAGAAAGAAGTCTAACCTCAGG + Intergenic
976782994 4:88782649-88782671 GTAGAAAAAAGACTAAAATATGG - Intronic
977261144 4:94798694-94798716 GCAGAAAGGAGAGTTTAATCAGG + Intronic
977376259 4:96208399-96208421 GGAAAAAGGAGACTAGAAATAGG - Intergenic
977395161 4:96462172-96462194 AGAGAAAGGTGAAGAAAATCAGG + Intergenic
978115491 4:105015651-105015673 GGAGAGAGGAGAGGAAAATGAGG - Intergenic
979982765 4:127276745-127276767 GGAGGAAGGAGAGTATAATGAGG - Intergenic
980908662 4:138974145-138974167 ACAGATAGGAGACTAAAACCTGG - Intergenic
981744889 4:148043146-148043168 TGAGAAAGGAGAAAAGAATCAGG + Intronic
982330409 4:154176171-154176193 GGAGGAAGCAGAATAAAATATGG - Intergenic
982529146 4:156516641-156516663 GAAGAAAGGGAACAAAAATCTGG - Intergenic
982985063 4:162196674-162196696 GGTGAAAGGAGAAAAAAATTAGG + Intergenic
984239717 4:177203954-177203976 GGATAAAGTGGAATAAAATCTGG - Intergenic
985163267 4:187065785-187065807 GGAGAAAGTAAAATTAAATCAGG + Intergenic
985179321 4:187239498-187239520 GGAGAAAGGAGACTGACAACAGG - Intergenic
987485741 5:18523327-18523349 GGAGAAACTAGACTATAATTGGG + Intergenic
988216626 5:28283214-28283236 TGAGAAATCAAACTAAAATCTGG + Intergenic
988465406 5:31486270-31486292 GGAGAAAGGGGTATAAAAACAGG + Intronic
989512376 5:42303307-42303329 TGAGAAAGGACACTCACATCAGG + Intergenic
989665717 5:43851631-43851653 AAAGAAAGGAGATTAAAATTAGG + Intergenic
989987204 5:50714769-50714791 GCAGGAGGGAGGCTAAAATCAGG - Intronic
990088684 5:52012725-52012747 GCAGAAAAGAGACCAAAATATGG + Intronic
991282296 5:64929085-64929107 GAAGAAAGGAGATAAAAATGTGG + Intronic
991642236 5:68766664-68766686 GGAGAAAAGAGGTTGAAATCCGG + Intergenic
991968704 5:72117617-72117639 GGAGAAAGGAGAGGAGAATGGGG - Intronic
993528477 5:88996192-88996214 GGAGAAAGGAGATGAACAGCTGG - Intergenic
993784218 5:92108766-92108788 GTAGAAAGATGATTAAAATCTGG + Intergenic
994057744 5:95437930-95437952 GGAGAAAGTAGAGTATTATCAGG - Intronic
996032230 5:118718414-118718436 AGATAAATGAGACAAAAATCTGG + Intergenic
996928304 5:128855545-128855567 GCAGAAAGAAGACAGAAATCAGG - Intronic
998254772 5:140576337-140576359 GGAGAAAGGCAACTTAAATATGG + Intronic
998904603 5:146891121-146891143 ATAGAAAGGAGACTCACATCTGG - Intronic
999632622 5:153586384-153586406 CGAGTAAGGAGACTAAAATGTGG + Intronic
1000310235 5:160036313-160036335 AGAGGAAAGAGACTAAACTCTGG - Intronic
1000759091 5:165199026-165199048 GGAGAAAGTAAACTGAAATTAGG - Intergenic
1002100360 5:176854651-176854673 GGAGGAGGGAAACTCAAATCTGG - Intronic
1002393872 5:178938424-178938446 GGAGAAAGGAGGTTAAAACGTGG - Intergenic
1002559762 5:180073095-180073117 GGAGACAGGAGACTCAACCCTGG - Intergenic
1003928024 6:10895613-10895635 GGAGAAAGGAGAACAAAAGGGGG + Intronic
1004785812 6:18966090-18966112 AGATAAAGGACACTAAAATGGGG + Intergenic
1004992986 6:21160148-21160170 GGAGATAGGTGACTTAAAGCGGG - Intronic
1006089800 6:31621410-31621432 GGAGAAAGGAGACGAGGAACAGG - Intronic
1006475483 6:34249899-34249921 GGAGAAAAGAAAGTAAAATCCGG - Intergenic
1007998610 6:46335239-46335261 GGAGAAAGGACATCAAATTCTGG + Intronic
1008151789 6:47961895-47961917 GAAGAAAGGAAACAATAATCTGG + Intronic
1008644208 6:53496555-53496577 GGAGAAAGAAGACCACTATCTGG + Intergenic
1009278612 6:61718620-61718642 GGAGAAAGGAGAGTGAGATCAGG + Intronic
1010964734 6:82191811-82191833 GAAGAAAGTAGACAAAAATGTGG - Exonic
1011309322 6:85964558-85964580 AAAAAAAGGAGACTAAAAACAGG - Intergenic
1013286947 6:108689908-108689930 GGGGAAAGGAGACTCAACTTGGG + Intergenic
1013316913 6:108951954-108951976 GTAGAAAGGACACTAGAGTCTGG + Intronic
1016053222 6:139551806-139551828 GGAGAAAGGAGGGTAATAGCTGG + Intergenic
1016871098 6:148817482-148817504 GGAGACATGAGATTGAAATCAGG + Intronic
1017542735 6:155419496-155419518 GGAGAAAGGAAGCTAAAGTGTGG - Intronic
1018374266 6:163195921-163195943 GGAGAATGGAGGCGAGAATCAGG - Intronic
1019211158 6:170406232-170406254 TGAGAAAGGAGAAGAAAAGCTGG + Exonic
1019793110 7:3030200-3030222 GGAGAAAGGGGATTAATATGGGG - Intronic
1020205686 7:6113494-6113516 GGGGAAAGGAGAGCAAAATTAGG - Intronic
1020604942 7:10325421-10325443 GGAGAGGAGAGACTAGAATCAGG + Intergenic
1021417725 7:20407567-20407589 GGAAAAAGGAAACAAAACTCTGG - Intronic
1021646257 7:22792640-22792662 GGAGAAAGGAGAATAAAAAGAGG - Intergenic
1021779931 7:24094062-24094084 GGAGAAAGGAGAGAAGAATCAGG - Intergenic
1022367406 7:29737054-29737076 GGAAAAGGGAGACAAAGATCAGG + Intergenic
1022412524 7:30150024-30150046 GTAGAACTGAGACTTAAATCCGG - Intronic
1023239628 7:38129765-38129787 TGAGAAAGGAGAGTAAAAAAAGG + Intergenic
1024046730 7:45590285-45590307 GGAGAAAGGAAGCTAACATGTGG + Intronic
1025076742 7:55950474-55950496 GAAGAAAGGAGATAAAAATACGG + Intergenic
1027644673 7:80782160-80782182 GAAGAAAGGAGATAAAAATTGGG - Intronic
1028122099 7:87067704-87067726 GAAGAAAGGAGAATAATATTGGG + Intergenic
1028637070 7:93001126-93001148 GGAGAAAGGAGACTTCAAGAAGG - Intergenic
1028653963 7:93181273-93181295 GGAGAAAGGAAATTAAAGGCAGG + Intergenic
1029184448 7:98728657-98728679 GGAGGAAGGAAACAAGAATCTGG - Intergenic
1030068073 7:105675826-105675848 GCAGGAAGGAGACAAAAATATGG + Intronic
1031009473 7:116510690-116510712 CGAGAATGGAGACTAAAGGCAGG - Intergenic
1031814709 7:126419333-126419355 GGAGACAGGATAATCAAATCTGG - Intergenic
1031977769 7:128104603-128104625 GGAACAAGGAGACTAAGCTCCGG - Intergenic
1032138596 7:129306003-129306025 AGAGAAAGGATCCTAAAAGCAGG - Intronic
1032303596 7:130712275-130712297 GGAGGGAGGAGACTGAGATCTGG + Intergenic
1032910762 7:136426910-136426932 AGAGTAAGGAGACGAATATCAGG + Intergenic
1034151990 7:148924270-148924292 GGAGAAAAGAGACTAAACAGAGG - Intergenic
1034536432 7:151728567-151728589 GGAGAAAGGAGATTCAAAAGGGG - Intronic
1034609764 7:152355672-152355694 GGAGGATGAAGACTAAAAGCTGG + Intronic
1035790404 8:2298741-2298763 GGAGGACGGAGACCAAAATGGGG - Intergenic
1035802401 8:2422964-2422986 GGAGGACGGAGACCAAAATGGGG + Intergenic
1035928108 8:3751260-3751282 GGAGAGAGGAGTCAAAAATTTGG - Intronic
1036461189 8:8954297-8954319 AGAGAAAGGAGAGTGAAATTTGG - Intergenic
1036497954 8:9286604-9286626 GAAGATAGGAGACAAATATCAGG - Intergenic
1036498892 8:9295477-9295499 GGAGCAAGGAGAGTTAAATCAGG - Intergenic
1037215034 8:16439256-16439278 GGAGAAAGGAGATAAAACTGAGG + Intronic
1037646612 8:20798187-20798209 AGAGAAAGGAGAGGAAAAGCCGG - Intergenic
1038065634 8:23961011-23961033 GGAAAAAGGAAACAAAATTCTGG + Intergenic
1038541456 8:28393564-28393586 GGAGGAAGGAGACACAGATCTGG - Intronic
1038670801 8:29581293-29581315 GGAGAGAGGAGATTACAAGCCGG - Intergenic
1040557271 8:48491814-48491836 GGAGAGAGGGAAATAAAATCTGG - Intergenic
1041249790 8:55922928-55922950 AGAGAAAGGAGACCAATATAGGG + Intronic
1041952273 8:63516939-63516961 GGAGAGAGGAGACAAGAAACAGG + Intergenic
1042418433 8:68555544-68555566 GGAGATAGAAGACTGAAATTAGG - Intronic
1042963317 8:74325389-74325411 GGAGGAAGGAGAGTAAATTATGG + Intronic
1043380687 8:79698799-79698821 GGACAAATGAGTCTAAAAACTGG + Intergenic
1043595688 8:81882092-81882114 GGAGCAAGCAGAAAAAAATCTGG + Intergenic
1045256248 8:100525421-100525443 TGAGAAAGTAGACTAGAAGCTGG - Intronic
1046798170 8:118395006-118395028 GGAAAACGGAGACTTAAAGCAGG - Intronic
1047611001 8:126520862-126520884 GGAGAAAGGATACTGGAATGAGG - Intergenic
1048024700 8:130575401-130575423 GGAAAAAGGAGACAAATTTCTGG - Intergenic
1048093854 8:131269456-131269478 GGAGAAAGGAGAGTAGATCCTGG + Intergenic
1050231889 9:3535064-3535086 GGAGAGAGGAGAGTAAAGTCAGG + Intergenic
1050428813 9:5540426-5540448 AGAGAAATGAAACAAAAATCTGG + Intronic
1050474291 9:6023689-6023711 GCATAAAGGATATTAAAATCAGG + Intergenic
1052989590 9:34511363-34511385 GGAGAAATGCAACTCAAATCTGG + Intronic
1054877480 9:70112017-70112039 GGTGGAAGGAGAATGAAATCAGG - Intronic
1054999711 9:71435294-71435316 GGAGAAATGAAACTAGAATTTGG - Intronic
1055256190 9:74374013-74374035 GCAGAGTAGAGACTAAAATCTGG - Intergenic
1055671500 9:78611339-78611361 GGAGAAAGGAGATGAAGATGTGG - Intergenic
1056817910 9:89815105-89815127 GGAGAAAGGAGACTTTAATGGGG + Intergenic
1057215588 9:93226671-93226693 GGAAAAGGCAGACTAATATCTGG - Intronic
1058972048 9:110092833-110092855 TGAGAAAGTAGAATAAAAGCCGG - Intronic
1059529229 9:115020395-115020417 GTGGAAAGGAGACTAAAGACTGG - Intronic
1186043074 X:5503051-5503073 GAAGAAAGGATACTACAAGCTGG - Intergenic
1186981459 X:14961668-14961690 GGAGAAAACAGACTGTAATCAGG - Intergenic
1186994218 X:15102430-15102452 GTAGAAAGGAAACTAAAGTGTGG - Intergenic
1187111001 X:16300286-16300308 GGAGAAGGGAGAGGAAAAACGGG - Intergenic
1188578741 X:31684757-31684779 GGAGAAGGAAAACTAGAATCTGG + Intronic
1188992226 X:36835815-36835837 GGAGAAAGGAATCTGAAGTCTGG - Intergenic
1189128859 X:38477881-38477903 GGAGAAAGCAGAGAAAAGTCTGG - Intronic
1189449337 X:41113022-41113044 TGAGAAAGGACACTAAAATAAGG - Intronic
1189511304 X:41664600-41664622 GGGCAAAGGAGTCTAAAAGCTGG + Intronic
1190200304 X:48355418-48355440 GGAGAAATCAGACGAAAACCAGG + Intronic
1190525267 X:51323229-51323251 GGAGGATGAAGACTAATATCTGG + Intergenic
1190887955 X:54545774-54545796 GAATAAAGGAGACTAGAATTAGG - Intronic
1191853016 X:65599951-65599973 GGAGAAAAGATACTGACATCAGG + Intronic
1192615563 X:72617988-72618010 AGGGAAAGGAGACTAAATTGGGG - Intronic
1193501623 X:82282883-82282905 GGAGAAAGGAACATAAAAACAGG - Intergenic
1194509122 X:94770500-94770522 GGAGAAAGAATACTAATATCAGG - Intergenic
1194536543 X:95111400-95111422 GAAGAAAGGAGAATAAAATGGGG - Intergenic
1195530432 X:105948356-105948378 AGAGAAAGGACTCTAATATCAGG + Intronic
1197296685 X:124727769-124727791 GAAGAAAGGAAACTAAAATGAGG + Intronic
1200171013 X:154074791-154074813 GTAGAAAGGTGAATAATATCAGG + Intronic
1200176924 X:154123426-154123448 GGAGAGGGGAGGCTACAATCAGG + Intergenic
1201544090 Y:15141561-15141583 GAAGAAAGGATACTAGAAGCAGG + Intergenic
1201687510 Y:16723095-16723117 GGAGAAAGGAGTATAAATTTGGG + Intergenic