ID: 952422415

View in Genome Browser
Species Human (GRCh38)
Location 3:33144078-33144100
Sequence CCTGTTAGGAAGCTACTGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952422406_952422415 26 Left 952422406 3:33144029-33144051 CCATATTGTGAAAAACTTTAGTG 0: 1
1: 0
2: 1
3: 20
4: 238
Right 952422415 3:33144078-33144100 CCTGTTAGGAAGCTACTGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952422415 Original CRISPR CCTGTTAGGAAGCTACTGCA AGG Exonic
901701274 1:11045848-11045870 CTCCTTAGGAAGCTGCTGCAAGG - Intronic
901954794 1:12776348-12776370 CATGCTAGGAAGGTACTGCAGGG + Intronic
904751345 1:32742695-32742717 ACTGTTAAGAAGCTAAGGCAGGG - Intronic
906209654 1:44005466-44005488 CCTGTTAGGTAGCTTGTGTAGGG - Intronic
907080020 1:51613178-51613200 GCTGTTAAGAAGCTAATGGAGGG + Intronic
907866956 1:58407730-58407752 TCTGATAGGAAGATATTGCAGGG - Intronic
908511267 1:64851680-64851702 CCCGCTATGGAGCTACTGCAAGG + Intronic
911941644 1:104055046-104055068 ACTGTGAGGAAGCTGCTCCAGGG + Intergenic
912756026 1:112325464-112325486 CCTTTTGGGAAGAGACTGCAGGG + Intergenic
920292959 1:204936782-204936804 CATGATAGGAAGCGGCTGCAGGG - Intronic
924535335 1:244930976-244930998 ACTTTTAGGAAGCTACTGTGTGG + Intergenic
1063487364 10:6432552-6432574 CCAATTAGAAAGCCACTGCACGG + Intronic
1070335446 10:75450844-75450866 CCTGTTCGGCAGCCACAGCAGGG - Intronic
1070916927 10:80161008-80161030 CCTGTCGGGAGGCTGCTGCAGGG - Intronic
1072704912 10:97674201-97674223 CATGGGAGGAAGCAACTGCAAGG - Exonic
1073727465 10:106249986-106250008 TCTGCTAGGGAGCTACTGAATGG + Intergenic
1074211654 10:111340871-111340893 CCTGTTAGTAAGTTACTGCTAGG + Intergenic
1078413712 11:11148392-11148414 CCTGTTTGGCAGCTGCTGCGGGG - Intergenic
1078666514 11:13330233-13330255 CCTGTTGCCAAGCTACTGCAAGG - Intronic
1080061156 11:27958412-27958434 CCTGTGAGGTAGTTAATGCAGGG + Intergenic
1081723089 11:45304336-45304358 CCTGTGAGGAAGCTGCACCAGGG + Intergenic
1083346197 11:61994475-61994497 GCTATTACGATGCTACTGCATGG + Intergenic
1088943280 11:114482603-114482625 CCTGTTTGAAAGCAGCTGCAAGG + Intergenic
1089568172 11:119383559-119383581 GCTTTTATGAAGCTACTGGAAGG + Intergenic
1089665140 11:120013548-120013570 CCGGGCAGGAAGCTCCTGCAGGG - Intergenic
1097144965 12:56933800-56933822 TCTGATTGGAAGCCACTGCATGG - Intronic
1102408339 12:112693973-112693995 CCAGTTAGAAAGCCATTGCAAGG - Intronic
1102757006 12:115349677-115349699 CCTGTGAGGAAGAAAATGCAGGG - Intergenic
1103221861 12:119252917-119252939 GATGTTAGGAAGCTCCTGCAAGG - Intergenic
1103739493 12:123081699-123081721 CCTCTCAGGAGGCTCCTGCAGGG - Intronic
1106244977 13:27941330-27941352 CCTCACAGGAAGATACTGCATGG + Intergenic
1107120255 13:36788421-36788443 ACTGTTAGGAAGCTGGTGGAAGG - Intergenic
1110949769 13:81471199-81471221 CAAGTTAAGAAGCTTCTGCATGG + Intergenic
1112616855 13:101015233-101015255 CCAGTTAGTAAGCCATTGCAGGG + Intergenic
1113449779 13:110399763-110399785 CCTGCCAGGAAGATCCTGCAGGG - Intronic
1114888658 14:26887919-26887941 CCTGTGAGGATGGCACTGCATGG + Intergenic
1116659746 14:47694102-47694124 CTTGTTAGGAAGGTAAAGCATGG - Intergenic
1117990768 14:61431052-61431074 CCTATGAGGAAGCTACTGATTGG - Intronic
1121825439 14:97006712-97006734 CCTGGTAGGAAGGTGCTCCAGGG + Intergenic
1125242574 15:37592873-37592895 ACTGATAACAAGCTACTGCAGGG - Intergenic
1127378894 15:58411130-58411152 CCTGTGAGGAAGCTACTTACAGG - Intronic
1128939061 15:71772091-71772113 ACTGTGAAGAAGCTACTGAAGGG - Intronic
1131605352 15:93897850-93897872 CCTGTTAGGAAGCAAGTTCTGGG + Intergenic
1132551909 16:557053-557075 CCTGTTAGGAGGCGCCTGAATGG - Intergenic
1133800462 16:9080991-9081013 CCAGTTAGGAGGCTAAGGCAGGG + Intergenic
1133855306 16:9544097-9544119 CGTGTTAGGCATCTACTGCAGGG - Intergenic
1134907333 16:17991492-17991514 CCAGTTAGCAGGGTACTGCAGGG + Intergenic
1138420498 16:56896040-56896062 CCTGTTAGGAACCGGGTGCATGG - Intronic
1140081594 16:71753306-71753328 TATGTTAGGAAGCCATTGCAGGG - Intronic
1143887745 17:10077771-10077793 TTTTTCAGGAAGCTACTGCAGGG + Intronic
1147646376 17:42036756-42036778 CCTGTCAGCAAGCGACAGCAAGG + Intronic
1147758536 17:42783257-42783279 CCCTTTAGGAGGCTGCTGCAGGG - Intronic
1155355448 18:24948385-24948407 CCTGTTAGGAAGCTATTAAAAGG - Intergenic
1155963996 18:32019125-32019147 CCTCTTAGGAAATTGCTGCAGGG + Intronic
1158173481 18:54626367-54626389 CCTTTTCCCAAGCTACTGCATGG - Intergenic
1159608774 18:70503220-70503242 CCTCTTAGGAAGTTAATGAAGGG - Intergenic
1160657330 19:280286-280308 CCTGATAGGAACATCCTGCAAGG + Intergenic
1160944551 19:1635313-1635335 CTTGGAAGGAAGCTGCTGCAGGG - Intronic
1161828804 19:6588122-6588144 CTTGTTAGGAAGGAACTGAACGG + Intronic
1162799650 19:13103496-13103518 CCTGTTGGGCATCTACTGGAAGG - Intergenic
925683350 2:6446266-6446288 ACTATTAGGAATCTAGTGCATGG + Intergenic
927422821 2:22950829-22950851 GAGGTCAGGAAGCTACTGCAAGG - Intergenic
927459023 2:23281671-23281693 ATTGTTAGGAAGCTATTGTAGGG + Intergenic
928235190 2:29533202-29533224 CTTGTTGGGAAGCTTCAGCATGG + Intronic
930755435 2:54967955-54967977 CCTGTTAGGAACCGACCGCAGGG - Intronic
933548482 2:83743708-83743730 CTGGTTAGGCAGCAACTGCAGGG - Intergenic
934955627 2:98615613-98615635 CCAGTTAGAAGGCTACTGCAAGG - Intronic
935171571 2:100614532-100614554 CCTGCTAAGAATCTATTGCAAGG - Intergenic
935707120 2:105866696-105866718 CCTGTTAGGAATGGGCTGCACGG - Intronic
935853297 2:107246642-107246664 CCTGTTTGGCAGCTACTTCATGG + Intergenic
939118633 2:138089610-138089632 CCAGTTTGTAAGCGACTGCAGGG + Intergenic
943254119 2:185571175-185571197 CCTGTTAGGTAGCTAGTGGGAGG - Intergenic
944616880 2:201469832-201469854 CTCATTAGGAAGGTACTGCAAGG - Intronic
948899609 2:240949719-240949741 CCTTCTAGGAAGCTACTGGTGGG - Intronic
1171451154 20:25237090-25237112 CCTGTGTGGAGTCTACTGCAGGG + Intergenic
1171869152 20:30512269-30512291 GCTGTTAGGAAGTTACCACAAGG - Intergenic
1172078104 20:32315096-32315118 CATGACAGGAAGCCACTGCAGGG - Intronic
1172169074 20:32917978-32918000 GATGCTTGGAAGCTACTGCAGGG + Intronic
1173464088 20:43267645-43267667 CCTGTGAGGCAGCTCCTGGAAGG - Intergenic
1174641414 20:52047733-52047755 CCTGTCTGGAAGCTAAAGCAGGG - Intergenic
1174897469 20:54466171-54466193 CCAGTTAGGAAGCTACTGAGGGG - Intergenic
1178998628 21:37431634-37431656 CTTGGTGGGAAGCTACTGCAAGG - Intronic
1183779309 22:39988655-39988677 CCAGTTAGGAGGCTCTTGCAAGG + Intergenic
952422415 3:33144078-33144100 CCTGTTAGGAAGCTACTGCAAGG + Exonic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954694102 3:52411087-52411109 CGGGTTAGGAAGCCACTGCCTGG + Exonic
955543520 3:60002937-60002959 CCTTTCAAGAAGCTACTTCATGG + Intronic
956068577 3:65422993-65423015 CCTGTTGCGAGGCCACTGCAAGG + Intronic
956294141 3:67693790-67693812 CCTGTTAGGATGTCAGTGCAGGG - Intergenic
958441508 3:94161742-94161764 CTTGTTTGGGAGCAACTGCAAGG - Intergenic
962527508 3:136250007-136250029 CCAGATAGTAAGCTAGTGCATGG + Intergenic
964753492 3:160074114-160074136 TCAGTTAGGAAGCCACTGCCTGG + Intergenic
965891418 3:173519213-173519235 CCAGTCAGAAAGCTGCTGCAGGG + Intronic
966639080 3:182169084-182169106 TCTGTAAGGAATCAACTGCAGGG - Intergenic
968205520 3:196796129-196796151 CTTGTTAGGAACCGGCTGCACGG - Intronic
970232866 4:13928666-13928688 CCACTTACGAAGCTTCTGCAAGG - Intergenic
971197215 4:24480990-24481012 CCTGTTAGGAATCTACCATAGGG - Intergenic
974625956 4:64429301-64429323 CCTGTTAGAAGTCTACTGCAGGG + Intergenic
982964022 4:161879309-161879331 CCAGGTAGGAAGCTATTACAGGG - Intronic
984246362 4:177279296-177279318 CATGTTAGGAAGTGACTGGAAGG - Intergenic
984623105 4:181975644-181975666 CTGGTTAGGCAGCTACTGCAGGG + Intergenic
984663898 4:182405035-182405057 CCAGGTAAGAAGCTAGTGCAAGG - Intronic
984980365 4:185274381-185274403 CCTTTCTGGAAACTACTGCATGG + Intronic
989064407 5:37445004-37445026 CCTGTTAGGAACCAGGTGCACGG - Intronic
990361482 5:55025329-55025351 ACTGTTAGGTAGCTACTGTTAGG - Intronic
990573736 5:57104944-57104966 CCTGTCAGCATTCTACTGCAAGG - Intergenic
991569175 5:68036376-68036398 CCTCTTAGGAAGCTGCTGTGAGG + Intergenic
994913447 5:105943374-105943396 CATGTTTGGACGCTGCTGCAGGG - Intergenic
1002433182 5:179216013-179216035 CCTCTCAAGAAGCTACTGAAAGG + Intronic
1004915385 6:20327427-20327449 CAAGTTAGGAAGCTAATACATGG - Intergenic
1007056665 6:38892625-38892647 TTGGTTAGGAAGTTACTGCATGG - Intronic
1007849911 6:44793049-44793071 TCTTTTAGGAAGATACTGTAGGG + Intergenic
1009627480 6:66154371-66154393 CATGTTAGAAAGCCTCTGCAAGG + Intergenic
1015266064 6:131293568-131293590 CCTGCGTGGATGCTACTGCATGG + Intergenic
1018314363 6:162542304-162542326 CCTGTGAGGTAACTACTGTATGG + Intronic
1019292818 7:258592-258614 CCTGTTAGGAACCTTGTACAGGG + Intronic
1023302594 7:38789680-38789702 CCAGTTAGGAGGCTGCTGCAGGG + Intronic
1028994914 7:97089752-97089774 CCAGGTAGAAAGCAACTGCAGGG - Intergenic
1033046433 7:137966726-137966748 CTTGTCAGTAAGCCACTGCAGGG - Intronic
1037617086 8:20529239-20529261 CCAGGGAGGAAGCTACTTCAGGG + Intergenic
1039155163 8:34547082-34547104 TCTGTTACAAAGCTACTTCAAGG - Intergenic
1039302355 8:36223049-36223071 CCTATAAGGAAGCCAGTGCAAGG - Intergenic
1041430951 8:57780155-57780177 CCTGTTAGGAATCTGTTCCAAGG - Intergenic
1044561117 8:93613205-93613227 CTTGTTAGGAGGCCATTGCATGG - Intergenic
1045989175 8:108285772-108285794 CCAGCTAGGAAACTCCTGCAAGG + Intronic
1046338233 8:112818781-112818803 GTTGTCTGGAAGCTACTGCAGGG - Intronic
1046697498 8:117358319-117358341 CTTATCAGGAAGCTGCTGCAAGG - Intergenic
1055101103 9:72466611-72466633 TCTTTTAGGAAGCTCCTGCCTGG + Intergenic
1055542009 9:77319449-77319471 GCTTATAGGAAGCTACTGAATGG + Intronic
1056277060 9:85003740-85003762 CCTGTTAGGAGGCTACTGTGAGG + Intronic
1056474363 9:86939170-86939192 ACAGTTCAGAAGCTACTGCAGGG - Intergenic
1186465309 X:9780169-9780191 GCTGATAGGAAGCTCCTTCATGG - Intronic
1186909055 X:14142129-14142151 CTATTTAGGAAGCCACTGCAGGG - Intergenic
1189084297 X:38004170-38004192 CAAGTTAAGAAGCTCCTGCATGG - Intronic
1190381850 X:49846873-49846895 CCTGTTAGGGAGATGGTGCAGGG + Intergenic
1200963468 Y:9015696-9015718 CCTGGGAGAGAGCTACTGCACGG + Intergenic