ID: 952423242

View in Genome Browser
Species Human (GRCh38)
Location 3:33149571-33149593
Sequence CAGCAGGATTTTAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952423242_952423249 14 Left 952423242 3:33149571-33149593 CCAACTTCCCTAAAATCCTGCTG 0: 1
1: 0
2: 0
3: 22
4: 208
Right 952423249 3:33149608-33149630 ACTGAGAGTTAGGTTTAGAAAGG 0: 1
1: 0
2: 1
3: 20
4: 229
952423242_952423248 4 Left 952423242 3:33149571-33149593 CCAACTTCCCTAAAATCCTGCTG 0: 1
1: 0
2: 0
3: 22
4: 208
Right 952423248 3:33149598-33149620 AGGTAACATAACTGAGAGTTAGG 0: 1
1: 0
2: 1
3: 15
4: 212
952423242_952423250 15 Left 952423242 3:33149571-33149593 CCAACTTCCCTAAAATCCTGCTG 0: 1
1: 0
2: 0
3: 22
4: 208
Right 952423250 3:33149609-33149631 CTGAGAGTTAGGTTTAGAAAGGG 0: 1
1: 0
2: 2
3: 18
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952423242 Original CRISPR CAGCAGGATTTTAGGGAAGT TGG (reversed) Intergenic
902579703 1:17400708-17400730 CAGCAGGTGTTTAGAGAATTGGG - Intronic
903294050 1:22332473-22332495 CAGTAGGCTTTGAGGAAAGTAGG - Intergenic
904013642 1:27404566-27404588 CATCAAGATTTTAGGGAAGGGGG - Exonic
907964100 1:59312562-59312584 AAGCAGGGTTTTATGGAAGATGG + Intronic
908175134 1:61547753-61547775 ATGCAGGTTTTCAGGGAAGTGGG + Intergenic
913994682 1:143642659-143642681 CAGCAGGATTTCTGGTAGGTTGG - Intergenic
915890208 1:159766272-159766294 CAGCAGGACCTTAAGGAAGTGGG + Intergenic
916550532 1:165845606-165845628 CAGCAGTATTTTGGGGAAGGGGG + Intronic
918158342 1:181872648-181872670 ATGCAGGTTGTTAGGGAAGTGGG - Intergenic
920314186 1:205065939-205065961 CAGCTGGGTTTTAAGGGAGTTGG - Intronic
923874673 1:238034643-238034665 AAGCAGGTTATCAGGGAAGTGGG - Intergenic
924861665 1:247930428-247930450 CAGAAGGATTTGAGTGTAGTGGG + Intergenic
1063349782 10:5343476-5343498 GAGAAGGATTTTAGGGGGGTTGG + Intergenic
1067424158 10:46190281-46190303 CATCAGGATTTTTGGGGAGAAGG - Intergenic
1070860565 10:79655529-79655551 CATCAGGATTTTTGGGGAGAAGG - Intergenic
1070876701 10:79820020-79820042 CATCAGGATTTTTGGGGAGAAGG + Intergenic
1071816484 10:89237514-89237536 CACCAGGATTTAAGGCAAGAAGG + Intronic
1072968357 10:99994479-99994501 CAGCAGCAGTTTTGAGAAGTTGG - Intronic
1073860116 10:107728945-107728967 AAGCAGTATTTTGGGGAACTAGG + Intergenic
1074557405 10:114504376-114504398 TAGCAGGATGTTGGGGGAGTGGG - Intronic
1078358401 11:10649629-10649651 CAGCAGGAATTCAGGGGAGCCGG - Intronic
1078881152 11:15450262-15450284 CAGGAGAATCTCAGGGAAGTGGG - Intergenic
1079985204 11:27192712-27192734 CAGCAGGATTTGAAGAAAGTTGG + Intergenic
1080149651 11:29036022-29036044 CAGCAGGATTTAAAGGAGGAAGG + Intergenic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1081301490 11:41457853-41457875 CATGATGATTTTAGAGAAGTAGG - Intronic
1082722719 11:56698094-56698116 CATAAGAATTTCAGGGAAGTAGG + Intergenic
1082832937 11:57632928-57632950 CAGCAGCATTTGAGAGAAGCAGG + Intergenic
1082903887 11:58285329-58285351 CTGCAGGTTGTCAGGGAAGTGGG - Intergenic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1088231773 11:107680290-107680312 CAGCAAGATTGTTGGGAAATTGG + Intergenic
1089327715 11:117668804-117668826 CATCAGAGTTTTAGGCAAGTTGG - Intronic
1089639849 11:119840471-119840493 CAGTAGGATTTGGGGGAATTTGG + Intergenic
1089954248 11:122555821-122555843 ATGCAGGTTGTTAGGGAAGTTGG + Intergenic
1090936920 11:131351408-131351430 CAGCAGGTGTTTGAGGAAGTCGG - Intergenic
1091723100 12:2827421-2827443 CAACAGGAGTCTAGGGAAATGGG - Intronic
1091778917 12:3201701-3201723 CTGCAGCATTTTATGGGAGTGGG + Intronic
1096212671 12:49778436-49778458 CTGAGGGATTTTAGGGAAGAAGG - Intergenic
1096940444 12:55338691-55338713 CACCAGGATTTAAGGCAAGAAGG - Intergenic
1099134618 12:78880386-78880408 AAGAAAGATGTTAGGGAAGTGGG - Intronic
1100350262 12:93774451-93774473 CAGCAGCATTTGGGGAAAGTGGG - Intronic
1102183022 12:110926834-110926856 CAGCAGAATTTAAGATAAGTTGG + Intergenic
1105632165 13:22180829-22180851 CAGCAGGATTTTACAGAAATTGG - Intergenic
1105835543 13:24208004-24208026 TAGGAGTAATTTAGGGAAGTTGG + Intronic
1106691756 13:32124932-32124954 CAGCCCTAATTTAGGGAAGTTGG + Intronic
1108317401 13:49250176-49250198 CAGCAGAATTATGGGCAAGTTGG - Intronic
1110868775 13:80425674-80425696 CAACAGTCTTTTAGGGACGTAGG + Intergenic
1111426195 13:88086521-88086543 GAGCAGGATTTGAAGGAAGGAGG + Intergenic
1111528384 13:89503899-89503921 CAGGAGAATTTTAGGGATGTAGG - Intergenic
1112430068 13:99343255-99343277 CAGCAGCAGTTTATGCAAGTGGG + Intronic
1113601761 13:111574381-111574403 CAGCAGCATTTTCGGGCAGTGGG - Intergenic
1114337375 14:21705065-21705087 AAGAAAAATTTTAGGGAAGTAGG - Intergenic
1114689433 14:24566524-24566546 CAGCATGGTTGTAGGGAAGTGGG - Intergenic
1115507325 14:34104871-34104893 GTGCAGTATTTTAGGGCAGTAGG - Intronic
1119281988 14:73417117-73417139 CAGCAGGATGATGGGGAAGCTGG - Intronic
1120215460 14:81677233-81677255 CAGAAGGATTTTAGGAAATAAGG - Intergenic
1121485868 14:94313888-94313910 CAGCAGGATTGTGGTGAAGATGG + Intronic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1123928111 15:25138824-25138846 CAGCAGCATATTAGGGGCGTGGG + Intergenic
1124336951 15:28864673-28864695 CAGAAAGATTTTATGCAAGTGGG - Intergenic
1128563219 15:68682182-68682204 CTGCAGGATTTTTTGGCAGTTGG - Intronic
1130701648 15:86189355-86189377 CAGCAGGCTTTTAGATATGTAGG - Intronic
1134237874 16:12481899-12481921 AAGGTGGATTTCAGGGAAGTGGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134672186 16:16064119-16064141 CATCAGGATTTTTAGGGAGTGGG + Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135418069 16:22284201-22284223 GGGCAGTATTTTGGGGAAGTGGG + Exonic
1139307755 16:66002101-66002123 CAGCATGATTTTAGGGTTCTGGG - Intergenic
1141623559 16:85249702-85249724 CAGCAGGACATTTGGGAAGGGGG + Intergenic
1149443694 17:56697392-56697414 CAGCAGTATATTAGTCAAGTTGG + Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1153465797 18:5386795-5386817 CAGCAGAATGTTTGGGAATTTGG - Intergenic
1153885861 18:9465242-9465264 CAGCTGTCTTTTAGGGTAGTTGG - Intergenic
1158331532 18:56368124-56368146 CTGCAGGTTGTCAGGGAAGTAGG + Intergenic
1159291783 18:66432710-66432732 CAGCAGCATTTTGCTGAAGTTGG - Intergenic
1159594291 18:70367921-70367943 CAGAACAATTTGAGGGAAGTGGG - Intergenic
1166143043 19:40815649-40815671 CAGCAGGATGTTAGGGTATTAGG + Intronic
1166184514 19:41131182-41131204 CAGCAGGATGTTAGGGTATTAGG - Intergenic
1166259188 19:41626223-41626245 GAGCAGGATCTGAGGGCAGTGGG - Intronic
1166281510 19:41797345-41797367 GAGCAGGATCTGAGGGCAGTGGG + Intronic
925006082 2:444175-444197 CAACGGGACTTCAGGGAAGTGGG - Intergenic
925034033 2:672500-672522 CAGCAGCATTTTAGAGAACGTGG - Intronic
926209006 2:10854996-10855018 CAGGTGGATTCTAGGGAAGGAGG + Intergenic
927589059 2:24336996-24337018 CTGCAGGGTTTAATGGAAGTAGG - Intronic
929950236 2:46404456-46404478 AAGCAGGTTTTCTGGGAAGTCGG + Intergenic
931773060 2:65516154-65516176 AAGCAGGATTTTAAGCAAGGAGG - Intergenic
931951160 2:67363679-67363701 CAACAGGATTTTTTGGAAGGTGG + Intergenic
933366049 2:81355490-81355512 CAGCAGGATTTTAGCCAACAGGG - Intergenic
937723064 2:125126306-125126328 ATGCAGGTTGTTAGGGAAGTGGG + Intergenic
938238812 2:129727272-129727294 AAACAGTATTTTAGGGAAGATGG - Intergenic
938689066 2:133770058-133770080 CAGAAGGTTCTTAGGGAACTGGG + Intergenic
938705174 2:133917522-133917544 CACCATTATTTGAGGGAAGTGGG + Intergenic
939693162 2:145291212-145291234 CAGCTGGATTTTCTGGAAGACGG - Intergenic
940998125 2:160172304-160172326 CACCAGGATTTTTGAGAAGTTGG + Intronic
941945310 2:171089979-171090001 CAGCAGGATTTTGGGGAGGGTGG - Intronic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
943621164 2:190149975-190149997 CTGCAGGTTGTCAGGGAAGTGGG + Intronic
943737810 2:191376493-191376515 TATCACTATTTTAGGGAAGTTGG - Intronic
943988690 2:194657726-194657748 CAGCAAGATTTTGTGGAAATTGG - Intergenic
944528895 2:200648846-200648868 ATGCAGGTTGTTAGGGAAGTAGG + Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945491884 2:210465905-210465927 CACCAGGATTTAAGGCAAGAAGG + Intronic
945647888 2:212523294-212523316 CAGCAGGAATTTAGAAAACTGGG - Intronic
945911773 2:215658057-215658079 CATCAGGGTCTTAGGGAATTTGG + Intergenic
945932954 2:215873888-215873910 CAACAGAATTTCAGGGAGGTGGG + Intergenic
947454818 2:230244493-230244515 CTGCAGGTTCTTAGGGGAGTGGG + Intronic
947721794 2:232374192-232374214 GGGCAGGATTTATGGGAAGTAGG + Intergenic
1169336216 20:4759580-4759602 CTGCAGGTTGTCAGGGAAGTGGG + Intergenic
1170602605 20:17852633-17852655 CACCAGGATTTAAGGCAAGAAGG - Intergenic
1171304383 20:24092617-24092639 CAGTAGGATGTTAGGAAACTTGG - Intergenic
1175909929 20:62400306-62400328 CAGCAGGCTCTGAGGGCAGTGGG + Intronic
1177140874 21:17356586-17356608 CATCAGGTTTTTAGGGGAATCGG - Intergenic
1178779272 21:35585545-35585567 TAGCAGGTTTTTAAGGAAATTGG + Intronic
1179084218 21:38203239-38203261 ACGCAGGTTTTTAGGAAAGTGGG + Intronic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183470628 22:38004238-38004260 CATCAGGATCTCAGGGAGGTGGG - Intronic
1183623151 22:38986533-38986555 CACCAGGAGTTAAGGGAAGGTGG - Intronic
949138284 3:599325-599347 GAGAAGGAGTTTTGGGAAGTAGG + Intergenic
949664608 3:6322756-6322778 CAGAAATATGTTAGGGAAGTAGG - Intergenic
949820224 3:8108157-8108179 CACGAGGATCATAGGGAAGTAGG + Intergenic
950211187 3:11124761-11124783 CAGGAGGAATTTCGGGAAGGAGG - Intergenic
950606088 3:14082013-14082035 CATCAGGTTTTTAGGGGACTGGG - Intronic
951036705 3:17940270-17940292 GATTAGGATTTTAGGGAAGAGGG + Intronic
952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG + Intergenic
952423242 3:33149571-33149593 CAGCAGGATTTTAGGGAAGTTGG - Intergenic
953353126 3:42230750-42230772 CAGCAGGATGATAGGCAAGGTGG - Intergenic
953690046 3:45110323-45110345 CAGCAAGAGTTTCAGGAAGTGGG - Intronic
954084818 3:48235929-48235951 CAGCAGCATTTTGCTGAAGTGGG - Intergenic
954692843 3:52404920-52404942 CAGCAGGAGCTTAGGGAGGCAGG - Intronic
956146972 3:66200027-66200049 CAGCAAAAGTTTAGGCAAGTTGG - Intronic
957604560 3:82380529-82380551 CAGAAGTATTTTGGAGAAGTTGG + Intergenic
958984921 3:100769170-100769192 CAACAGGATTTTAGGGCAAATGG + Intronic
962702637 3:138014251-138014273 GAGAAGGATTTTAGGGAAGCTGG + Intronic
963852600 3:150223400-150223422 CAGCATGTTTTCAGGCAAGTGGG - Intergenic
964331537 3:155608532-155608554 GAGCTGGTTTCTAGGGAAGTGGG - Intronic
964917498 3:161854579-161854601 ATGCAGGTTGTTAGGGAAGTGGG + Intergenic
966122396 3:176536965-176536987 ATGCAGGTTTTCAGGGAAGTTGG - Intergenic
970321467 4:14879627-14879649 AAGCAGGATCTTAGGGAAGATGG - Intergenic
970998005 4:22290198-22290220 CAGCAGGGTTTTCTAGAAGTAGG + Intergenic
971301652 4:25446908-25446930 CTCCAAGATTTCAGGGAAGTGGG + Intergenic
972314290 4:37911475-37911497 ATGCAGGATTTTAGGGAAAGAGG + Intronic
973257000 4:48123770-48123792 AAGCAGGCTTTTAGGGAAATGGG - Intronic
975591034 4:76000048-76000070 CTGCAGGATTTTAAGCAAGGTGG + Intergenic
975845468 4:78520324-78520346 CAGCAGAATTTAGGGGAAATGGG - Intronic
976080004 4:81345463-81345485 CAGGAGCATGATAGGGAAGTGGG - Intergenic
976858480 4:89632319-89632341 AAGCAGAATTTTGGGGAATTGGG - Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
980269330 4:130563786-130563808 CAGCAGGATTCCAAGGAAATGGG - Intergenic
980482536 4:133405486-133405508 CACCAGGATTTAAGGCAAGGAGG - Intergenic
980490951 4:133527837-133527859 TTGCAGTATTTTAGGGAATTTGG + Intergenic
981563515 4:146073497-146073519 CAGCAGGATGGTATGGATGTAGG - Intergenic
983749140 4:171242657-171242679 CATCAGGAATTTAGGGCAGGAGG + Intergenic
983921703 4:173352734-173352756 CAGCAGGTTTTTAAGGAATGTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
988029955 5:25751611-25751633 GGGGAGGATATTAGGGAAGTAGG - Intergenic
988072030 5:26303812-26303834 CAGCATGATTTTATGGAAGATGG - Intergenic
988163462 5:27551690-27551712 CAGCAGGATGGTAGGGTCGTTGG + Intergenic
989049015 5:37300403-37300425 CAGGAGGTTTGTAGGGAAGGTGG - Intronic
990151505 5:52823100-52823122 CAGAAGGATGTCAGGAAAGTCGG - Intronic
990359483 5:55004000-55004022 TAGCATGATGTTAGGGAAGAAGG - Intronic
992250111 5:74867630-74867652 GAGCAGGAATTTTGGGTAGTTGG + Intergenic
992575159 5:78100359-78100381 CAGGAGGATTTAAGGGGAGGTGG + Intronic
994568390 5:101483021-101483043 ATGCAGGTTTTCAGGGAAGTGGG + Intergenic
994875290 5:105413881-105413903 ATGCAGGTTTTCAGGGAAGTAGG - Intergenic
994987206 5:106951823-106951845 CAGTTGGAGTTTAGGGAAGAAGG - Intergenic
995327881 5:110912190-110912212 CATCAGGATTTAAGGCAAGATGG - Intergenic
995359290 5:111276344-111276366 CTGCAAGATTTTGGGGGAGTAGG - Intronic
995852399 5:116559800-116559822 CAACAGGATTTGAGGCCAGTTGG - Intronic
996124162 5:119706197-119706219 CAACAGACTTTCAGGGAAGTGGG + Intergenic
996796302 5:127352247-127352269 CAGCAGAAATGTAAGGAAGTGGG - Intronic
997610223 5:135210551-135210573 CAGCAGGGTTTTATGGAGTTTGG + Intronic
999822477 5:155241626-155241648 GAGCAAGATCTTAGGGTAGTAGG + Intergenic
1000435274 5:161200251-161200273 AAGCATGATTTGAGGGAAGAAGG - Intergenic
1000894368 5:166837539-166837561 GAGCAGGATTTTAGAGGAGGAGG + Intergenic
1001158437 5:169293360-169293382 CAGCATGATTTAGGGGAAGGTGG - Intronic
1001261944 5:170237642-170237664 CACCAGGATCTTCTGGAAGTAGG + Intronic
1001506650 5:172284609-172284631 CCCCATGATTTTAGGGAAGACGG - Intergenic
1002931102 6:1635722-1635744 CAGTATCATTTTAGGCAAGTTGG - Intronic
1003488405 6:6599607-6599629 CACCAGGCTTGTAGGGAAATAGG - Intronic
1006031138 6:31177471-31177493 CATCAGGATCTCAGTGAAGTGGG + Intronic
1006863891 6:37192848-37192870 CAGCAGGTTTCTCGGGAAGCGGG + Intergenic
1009414494 6:63400346-63400368 CTTCAGGATTCTAGGAAAGTGGG + Intergenic
1009887859 6:69645587-69645609 AAGCAGGATATCAGGGAAGATGG - Intergenic
1010859875 6:80897652-80897674 CAGCATGATTTTACGGTAATGGG + Intergenic
1015079595 6:129207764-129207786 CAGGGGTATTTTTGGGAAGTTGG - Intronic
1015984771 6:138873947-138873969 CAGCAGGATGATAGGTAGGTAGG - Intronic
1019076461 6:169392438-169392460 CAGCAGGATTATATGGTTGTAGG + Intergenic
1020354040 7:7257540-7257562 CAGCAGGAATTTTGGGAGGAGGG - Intergenic
1022816177 7:33916627-33916649 CAGCAGGCTCTTAGAGGAGTTGG - Intronic
1024135073 7:46398536-46398558 CAGCAGGAATATGGGGAAGTGGG - Intergenic
1024520047 7:50297577-50297599 CTGCAGCATTTTAGGAAAGAGGG + Intergenic
1027162810 7:75814720-75814742 CACCAAGATTCTAGGGAAGTGGG + Intronic
1028693290 7:93678826-93678848 CAACAGGATTTGTGGGATGTAGG + Intronic
1028947359 7:96595582-96595604 CAACAGCATTATAGGAAAGTTGG + Intronic
1031891392 7:127297205-127297227 CTGCAGGATTTGGGGGCAGTGGG + Intergenic
1033365502 7:140670430-140670452 CAGGAGGAAGTTAGGGAAGGGGG + Intronic
1033564106 7:142562031-142562053 CAGCTGGGCTTTAGAGAAGTAGG - Intergenic
1039165517 8:34675307-34675329 CAGCAGGAGGCTAGGGAAGGAGG - Intergenic
1040387474 8:46923271-46923293 TAACAGGAATTTAGAGAAGTGGG + Intergenic
1041614851 8:59894457-59894479 CAGCAGGATTTAAGGAAGGAAGG + Intergenic
1042368059 8:67959234-67959256 TGGCAGGACTTGAGGGAAGTGGG + Intronic
1044279243 8:90337300-90337322 GAGCAGAATTTTAAGGGAGTAGG - Intergenic
1045680057 8:104649364-104649386 CAGAAGCATTTAAGGCAAGTTGG - Intronic
1046558358 8:115805748-115805770 CAGCAATATTTCAGGGAAGGTGG - Intronic
1047205417 8:122799256-122799278 CTGCAAGGTTTGAGGGAAGTGGG + Intronic
1048425486 8:134319444-134319466 AATCAGGAATTTAGGGAAATGGG - Intergenic
1048523191 8:135176520-135176542 CTTCAGGATTTTGGAGAAGTTGG - Intergenic
1048937509 8:139369113-139369135 CTGTAGCATTTCAGGGAAGTTGG - Intergenic
1051910182 9:22145631-22145653 CAGCAGGAAATTTGGGAAGGTGG - Intergenic
1052411844 9:28131334-28131356 CAGTAGGATTTTAAGGAAGAAGG - Intronic
1052861320 9:33439628-33439650 CAGCAGGATTTGAGAGAAATGGG + Intergenic
1056058789 9:82860741-82860763 CATGAGGATTCTAGGGAAGTGGG + Intergenic
1056305895 9:85289962-85289984 CAGCAGGATGTGGGGGATGTGGG + Intergenic
1058085053 9:100739827-100739849 ATGCAGGTTGTTAGGGAAGTAGG + Intergenic
1061030723 9:128080743-128080765 CAACAGGGTTTTGGGCAAGTGGG - Intronic
1187238880 X:17494646-17494668 GAGCAGGATCTTATGGAAGAGGG - Intronic
1187531379 X:20099985-20100007 CCCCAGGATCTGAGGGAAGTAGG - Intronic
1191045330 X:56129903-56129925 ATGCAGGTTGTTAGGGAAGTAGG - Intergenic
1191080346 X:56504216-56504238 ATGCAGGTTTTCAGGGAAGTGGG - Intergenic
1191825106 X:65356070-65356092 CACTAGGATTTTTGGGAATTAGG - Intergenic
1192881127 X:75285057-75285079 CTGCAGGTTGTCAGGGAAGTGGG + Intronic
1192903551 X:75524852-75524874 GAGCAGGATTTAAGGGAGGAGGG + Intergenic
1195146756 X:102026262-102026284 CAGCAGGGCTTCAGGGATGTGGG - Intergenic
1196603166 X:117624753-117624775 TAGCAAGATTTTAGGGATGCAGG + Intergenic
1197136103 X:123061291-123061313 CAGCAAGAGTTCAGGGAATTAGG - Intergenic
1197762448 X:130037467-130037489 CAGCAGGATGTTCAGGATGTCGG - Exonic
1198744672 X:139877558-139877580 CAGAAGCAATTTAGGGAAGGGGG + Intronic
1199575504 X:149310203-149310225 CAGAAGGATCTCAGGGAGGTAGG + Intergenic
1199688865 X:150290949-150290971 CAGCCAGATGTTAGGGGAGTGGG - Intergenic
1200511617 Y:4085864-4085886 ATGCAGGTTTTCAGGGAAGTTGG - Intergenic