ID: 952441879

View in Genome Browser
Species Human (GRCh38)
Location 3:33338862-33338884
Sequence TTCGTCATGAAGCATTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 10, 3: 89, 4: 477}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952441879_952441883 21 Left 952441879 3:33338862-33338884 CCTGGCAAATGCTTCATGACGAA 0: 1
1: 0
2: 10
3: 89
4: 477
Right 952441883 3:33338906-33338928 AAAACCAAAAATTGACCAGTGGG 0: 4
1: 63
2: 708
3: 2936
4: 16254
952441879_952441882 20 Left 952441879 3:33338862-33338884 CCTGGCAAATGCTTCATGACGAA 0: 1
1: 0
2: 10
3: 89
4: 477
Right 952441882 3:33338905-33338927 CAAAACCAAAAATTGACCAGTGG 0: 5
1: 68
2: 704
3: 2919
4: 16159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952441879 Original CRISPR TTCGTCATGAAGCATTTGCC AGG (reversed) Intronic
901297604 1:8172535-8172557 GTCTTCATCCAGCATTTGCCTGG - Intergenic
901873970 1:12155485-12155507 TGTTTCATGAAGGATTTGCCAGG - Intergenic
903094678 1:20959473-20959495 TTACTCATGAATTATTTGCCTGG - Intronic
903974258 1:27138819-27138841 TTCATCAGGAAGCATTTGAAAGG + Intronic
904546896 1:31282021-31282043 TTCCTCATTAAGGGTTTGCCGGG - Intronic
904986583 1:34555069-34555091 TTCTTCATGAAATCTTTGCCAGG - Intergenic
905197690 1:36293397-36293419 TTCTTCTGGAAGAATTTGCCTGG + Intronic
905954471 1:41980902-41980924 TTCCTCATGGAGTATTTGCTTGG - Intronic
906360646 1:45154975-45154997 TTGGTCATGAAATCTTTGCCTGG - Intronic
906585383 1:46971989-46972011 TTCATCATAAATTATTTGCCAGG + Intergenic
906997467 1:50812140-50812162 TTTGTCATGAAATCTTTGCCAGG - Intronic
907638831 1:56164787-56164809 TTTGTCATGAAATCTTTGCCAGG + Intergenic
908105737 1:60839923-60839945 TTCATCATGAAGTCTTTGCCAGG - Intergenic
908819905 1:68075087-68075109 TTCATCATGAAATCTTTGCCAGG + Intergenic
909442706 1:75715732-75715754 TTTGTCATGAAATCTTTGCCAGG - Intergenic
909490640 1:76222336-76222358 TTCATCATGAAATCTTTGCCAGG - Intronic
909577697 1:77193776-77193798 TGCGTCATGAAATCTTTGCCAGG - Intronic
909685878 1:78348146-78348168 TTCTTCATTAAGCATTTCACCGG + Intronic
910082462 1:83357265-83357287 TTCATCATGAAGTCTTTGCCAGG + Intergenic
910159701 1:84259849-84259871 AGGGCCATGAAGCATTTGCCAGG - Intergenic
910313363 1:85854018-85854040 TTTGTCATGAAGTCTTTGCAAGG + Intronic
911374794 1:97038992-97039014 TTCATCATGAAGTCTCTGCCAGG + Intergenic
912589751 1:110804938-110804960 TTCATCATGAAGTCCTTGCCTGG + Intergenic
912957077 1:114162433-114162455 TTTGTCATGAAGTGTTTGCCAGG - Intergenic
913041426 1:115028755-115028777 TTCGTCATGAAATCTCTGCCCGG - Intergenic
916032711 1:160892297-160892319 TTCATCATGAAATCTTTGCCAGG - Intergenic
916940578 1:169672727-169672749 CTTGTCATGAAGTCTTTGCCAGG - Intronic
916998076 1:170323239-170323261 TTTGTCATGAAGCCTTTGCCAGG + Intergenic
917003617 1:170387726-170387748 TTTGTCATGAAATCTTTGCCAGG + Intergenic
917248098 1:173026439-173026461 TTCCTCAGGAAGTCTTTGCCAGG + Intergenic
917832589 1:178908958-178908980 TTCATCATGAAGTCTTTGCCAGG + Intronic
918736806 1:188074450-188074472 TTCGTCATGAAGTCTTTGCCTGG + Intergenic
918867725 1:189925005-189925027 TTCATCATGAAATCTTTGCCAGG - Intergenic
918930284 1:190846633-190846655 TTCCTCATGAAGTCTTTGCCTGG - Intergenic
918948692 1:191106409-191106431 TTCATCATGAAATCTTTGCCAGG + Intergenic
919617403 1:199824719-199824741 TTTGTCATGAAATCTTTGCCAGG - Intergenic
921095214 1:211880969-211880991 TTCATCATGAAATCTTTGCCAGG + Intergenic
921236712 1:213139396-213139418 TTTGTCATGAAGTCTTTGCCTGG + Intronic
921675059 1:217967927-217967949 TTCATCATGAAATCTTTGCCAGG + Intergenic
923198943 1:231693635-231693657 ATCCTCAGGAAGTATTTGCCTGG - Intronic
923248567 1:232158034-232158056 TTTGTCATGAAATATTTGCCAGG - Intergenic
923260580 1:232264240-232264262 TTCTTCATCCAGCATTTGCCAGG - Intergenic
923645548 1:235816814-235816836 TTCGTCATGAAACCTTTGCCAGG - Intronic
924179507 1:241426030-241426052 TTAGTCATGAAGTCTTTGCCAGG + Intergenic
924782561 1:247165498-247165520 TTCATCATGAAATACTTGCCAGG - Intronic
924819564 1:247475683-247475705 TTTGTCATGAAATTTTTGCCAGG - Intergenic
924886552 1:248224196-248224218 TTCCTCAGGAAATATTTGCCAGG + Intergenic
1063322550 10:5064468-5064490 TTCATCATGAAATCTTTGCCAGG - Intronic
1064313344 10:14231984-14232006 TTTGTCATGAAATCTTTGCCAGG + Intronic
1064525632 10:16253689-16253711 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1064912890 10:20422492-20422514 TTCATCATGAAATCTTTGCCAGG + Intergenic
1066529548 10:36321502-36321524 TTTGTCATGAAATATTTGCCAGG - Intergenic
1067005586 10:42657976-42657998 TTTGTCATGAATTCTTTGCCAGG - Intergenic
1067929760 10:50548646-50548668 TTCGTCATGAAATCTTTGCCTGG - Intronic
1068088624 10:52405575-52405597 TTCATCATGAAATCTTTGCCAGG + Intergenic
1068384713 10:56310654-56310676 TTCATCATGAAATTTTTGCCAGG - Intergenic
1068412171 10:56670275-56670297 TTCTTCATGAAGCATTACACTGG - Intergenic
1068640525 10:59400177-59400199 TTTGTGATGAAGTATTTGCTAGG + Intergenic
1068925814 10:62536575-62536597 TTTGTCATGAAATTTTTGCCAGG - Intronic
1069167258 10:65177414-65177436 TTCATCATGAAATCTTTGCCAGG + Intergenic
1069388386 10:67905799-67905821 TATGTCATGAACCATTTTCCAGG + Intronic
1071811721 10:89189346-89189368 TTATTCATTAAGCATTTTCCTGG - Intergenic
1072839725 10:98758274-98758296 TTCATCATGAAATCTTTGCCAGG - Intronic
1073669456 10:105571214-105571236 TTTGTCATGAAACCTTTGCCTGG - Intergenic
1073678666 10:105678463-105678485 TTCTTCATGAAATCTTTGCCAGG + Intergenic
1073992184 10:109274657-109274679 TTCATCACGAAGTCTTTGCCAGG + Intergenic
1074643919 10:115422128-115422150 TTCGTCATGAAATCTTTGCCAGG - Intronic
1075156762 10:119984061-119984083 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1077841287 11:5977766-5977788 TTCATCATAAAATATTTGCCAGG + Intergenic
1078694347 11:13615368-13615390 TTCATCATGAAATCTTTGCCAGG + Intergenic
1078946697 11:16076197-16076219 TTCGTCATTAAATCTTTGCCAGG - Intronic
1079302776 11:19294132-19294154 TTTGTCATGAAGTCTTTGCCTGG + Intergenic
1079560848 11:21817477-21817499 TTTGTCATGAAGCCTTTGCCTGG + Intergenic
1080152412 11:29068720-29068742 TTCCTCATGATGTCTTTGCCTGG - Intergenic
1080256953 11:30300999-30301021 TTCATCATGAAATCTTTGCCAGG - Intergenic
1082981386 11:59126341-59126363 TTTGTCATGAAATCTTTGCCAGG - Exonic
1085813209 11:79705379-79705401 TTCATCATGAAACGTTTGCCAGG - Intergenic
1085901622 11:80706945-80706967 TTCATCATGAAGCCTTTGCCAGG - Intergenic
1086611839 11:88766641-88766663 TTGGTCATGAAATCTTTGCCTGG - Intronic
1087440296 11:98175319-98175341 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1087466796 11:98518033-98518055 TTTGTCATGAAACATTTGCCAGG + Intergenic
1087918460 11:103837383-103837405 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1090096707 11:123749279-123749301 TTCATCATGAAATCTTTGCCAGG + Intergenic
1090574028 11:128080937-128080959 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1090742604 11:129678991-129679013 TTCGTCATGAAATCTTTGCTAGG - Intergenic
1091276384 11:134355225-134355247 TTCTTCATATATCATTTGCCTGG + Intronic
1092334150 12:7614015-7614037 TTTGTCATGAAGTCTTTGCCAGG - Intergenic
1092680807 12:10978511-10978533 TTTGTCATGAACTCTTTGCCAGG - Intronic
1093476750 12:19564357-19564379 TTCATCATGAAATCTTTGCCAGG + Intronic
1093491131 12:19705851-19705873 TTCATCATGAAATCTTTGCCAGG - Intronic
1093655803 12:21693103-21693125 TTCATCATGAAATCTTTGCCAGG - Intronic
1094407395 12:30131828-30131850 TTCATCATGAAGTCTTTGCCAGG - Intergenic
1095298273 12:40551994-40552016 TTTGTCATGAAATCTTTGCCAGG + Intronic
1095519473 12:43045419-43045441 CTCATCATGAAGTCTTTGCCAGG - Intergenic
1096894325 12:54805366-54805388 TACGTCATGAAATCTTTGCCAGG + Intergenic
1097389085 12:58987090-58987112 TCCATCATGAAATATTTGCCAGG - Intergenic
1097776343 12:63651338-63651360 TTCATCATGAAATTTTTGCCAGG - Intronic
1098563333 12:71902664-71902686 TTCTTCATGAAGTCTTTGCCTGG - Intronic
1098641556 12:72844420-72844442 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1099323331 12:81179230-81179252 TTCATCATGAAATCTTTGCCAGG - Intronic
1099634709 12:85199167-85199189 TTTATCATGAAGTCTTTGCCAGG + Intronic
1099696750 12:86032819-86032841 TTTGTCATGAAATCTTTGCCAGG + Intronic
1099825651 12:87774108-87774130 TTCATCATGAAATCTTTGCCAGG + Intergenic
1100710826 12:97254756-97254778 ATATTCAGGAAGCATTTGCCTGG - Intergenic
1103179387 12:118896066-118896088 TTCGTCTTGAAATCTTTGCCAGG - Intergenic
1104698021 12:130879453-130879475 TTGCTCATGAAGCCTTCGCCTGG + Intergenic
1105343308 13:19548797-19548819 TTTGTCATGAAGTCCTTGCCTGG - Intergenic
1105537002 13:21275299-21275321 TTTGTCATGAAGTCCTTGCCTGG + Intergenic
1106742137 13:32655880-32655902 TTCATCATGAAATCTTTGCCAGG + Intronic
1107082871 13:36393753-36393775 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1107176086 13:37400101-37400123 TTCCTCATGAAATCTTTGCCAGG - Intergenic
1107232645 13:38129189-38129211 TTTGTCATGAAATTTTTGCCAGG + Intergenic
1108130494 13:47294422-47294444 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1108162667 13:47658249-47658271 TTTGACATGAAGCAGGTGCCAGG - Intergenic
1108426272 13:50304895-50304917 TTCGTCATGAAATGTTTGCCAGG + Intronic
1108525369 13:51281344-51281366 TTCTTCATGATCCATTTCCCAGG + Exonic
1108917341 13:55631180-55631202 TTCATCATGAAATCTTTGCCAGG + Intergenic
1108992432 13:56677474-56677496 TTCCTTATTAAGCATTTCCCTGG + Intergenic
1109880256 13:68463998-68464020 TTAGTCATGAATTATTCGCCTGG - Intergenic
1110463575 13:75775394-75775416 TTCGTCATAAATTCTTTGCCTGG - Intronic
1110992006 13:82053671-82053693 TTCATCATGAAATCTTTGCCAGG - Intergenic
1111288784 13:86132727-86132749 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1111370056 13:87305786-87305808 TTCATCATGAAATCTTTGCCAGG + Intergenic
1112084049 13:96009278-96009300 TTCGTCATGAAATCTTTGCCAGG - Intronic
1112672012 13:101651725-101651747 TTCATCATGAAATTTTTGCCCGG + Intronic
1113202342 13:107880329-107880351 TTTATCATGAAACCTTTGCCAGG - Intergenic
1113390202 13:109888879-109888901 TTTGTCATGAAATATTTGCCTGG - Intergenic
1114345294 14:21788353-21788375 TTTGTGATGAAATATTTGCCAGG - Intergenic
1115021444 14:28685417-28685439 TTCATCATGAAATCTTTGCCAGG + Intergenic
1115148517 14:30255620-30255642 TTTGTCATGAAATATTTGCCAGG + Intergenic
1115449188 14:33526767-33526789 TTCATCCTGAACAATTTGCCTGG - Intronic
1115915346 14:38306237-38306259 TTCGTCATGAAATCTTAGCCAGG - Intergenic
1116648519 14:47560761-47560783 TTCATCATGAAATCTTTGCCAGG + Intronic
1116670908 14:47842196-47842218 TTCATCATGATGTCTTTGCCTGG + Intergenic
1118081269 14:62363740-62363762 TTTGTTATGAAATATTTGCCAGG + Intergenic
1118115002 14:62765457-62765479 TTCATCATGAAATCTTTGCCAGG - Intronic
1118352986 14:64987259-64987281 TTCGTCGTGGAGCGTTTGCGCGG + Intronic
1120064376 14:80023105-80023127 TTCATTATGAAGTTTTTGCCAGG + Intergenic
1120131549 14:80813268-80813290 TTTGTCATGAAGTCTTTGCCAGG + Intronic
1120184468 14:81379931-81379953 TTTGTCATGAAGTTTTTGCTAGG - Intronic
1120812819 14:88821888-88821910 TTGGTCAACAAGTATTTGCCCGG - Intergenic
1123018840 14:105388175-105388197 TTCATCCAGAGGCATTTGCCAGG + Intronic
1124830015 15:33139251-33139273 TTCCTCAATAAGCAATTGCCTGG - Intronic
1125217331 15:37290157-37290179 TTCATTATCAAGCATTTGCTTGG + Intergenic
1125408622 15:39381341-39381363 TTTGTCATGAAGTCTTCGCCTGG - Intergenic
1126046437 15:44645554-44645576 TTTGTCATGAAATCTTTGCCAGG - Intronic
1127022069 15:54759429-54759451 TTCATCATGAAATCTTTGCCAGG - Intergenic
1127058454 15:55156615-55156637 TTCATCATGAAATCTTTGCCAGG - Intergenic
1127182807 15:56441495-56441517 TTCATCATGAAATCTTTGCCAGG - Intronic
1127320718 15:57842801-57842823 TTTGTCATGAAATTTTTGCCAGG + Intergenic
1128822336 15:70670210-70670232 TTCTTCAGGGAGCATTTGACTGG + Intronic
1129534731 15:76303402-76303424 TTCGTCATGAAATCTTTGCCAGG - Intronic
1129569048 15:76659006-76659028 TTCATCATGAAATATTTACCAGG - Intronic
1130038307 15:80381360-80381382 TTCATCCTGAACCATTTGCTGGG - Intronic
1130189329 15:81717394-81717416 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1130439396 15:83936600-83936622 TTTGTCATGAAATCTTTGCCAGG - Intronic
1130782401 15:87055977-87055999 TTTGTCATGAAGTCTTTGCTGGG - Intergenic
1131704966 15:94983635-94983657 TTTGTCATAAAACCTTTGCCTGG - Intergenic
1133640752 16:7714984-7715006 TTCTGCATGAAGCATATGCATGG - Intergenic
1134612723 16:15622943-15622965 TCCTGCAGGAAGCATTTGCCAGG - Exonic
1138690340 16:58761837-58761859 TTCGTCATGAAATCTTTGCCAGG + Intergenic
1138891344 16:61147958-61147980 TTCCTCATGAAATCTTTGCCAGG + Intergenic
1138998715 16:62482415-62482437 TTCATCATGAAGACTTTGCCAGG + Intergenic
1139305043 16:65978083-65978105 TTCCTTATGAAGAATTTGCAAGG - Intergenic
1139958184 16:70703276-70703298 TTCGTCATGAGACAATGGCCTGG + Intronic
1140973829 16:80040367-80040389 TTTGTGATGAAACATTTGCCAGG + Intergenic
1142616838 17:1141487-1141509 TACCTCATGAAGCTTTTGCGAGG + Intronic
1143257438 17:5572185-5572207 TTCCTCATGAAATTTTTGCCAGG - Intronic
1144533245 17:16061059-16061081 TTTCTCAGGAAGCATTTGCTAGG - Intronic
1149131153 17:53303795-53303817 TTCCTCATAAAATATTTGCCAGG - Intergenic
1149176705 17:53880598-53880620 TTCGTCATGAAATCTTTGGCAGG - Intergenic
1149362184 17:55907263-55907285 TTCTTCATGAAACCTTTGGCAGG + Intergenic
1150894102 17:69189576-69189598 TTCATCATGAAGTCTTTGCCAGG + Intronic
1153418657 18:4879538-4879560 CTAGTTATGAAGCATTTCCCTGG + Intergenic
1153447020 18:5185281-5185303 TTCTTCATGAAATCTTTGCCAGG - Intronic
1153543529 18:6182594-6182616 TTCATCATGAAATCTTTGCCAGG + Intronic
1154155845 18:11943627-11943649 TCCCTCATGCAGCACTTGCCAGG - Intergenic
1154371862 18:13770821-13770843 TTCATCATGAAATCTTTGCCAGG - Intergenic
1155100144 18:22603024-22603046 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1155105857 18:22665359-22665381 TTCGTCATGAAATCTTTGCCAGG + Intergenic
1155709021 18:28852616-28852638 TTCATCATGAAATATTTGCCAGG - Intergenic
1156182054 18:34616297-34616319 TTCATCATAAAATATTTGCCGGG - Intronic
1156790309 18:40964384-40964406 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1156968055 18:43119970-43119992 TTAGTCATCTAGCATATGCCAGG - Intergenic
1157054599 18:44211712-44211734 TTTGTCATGAAGTCGTTGCCTGG - Intergenic
1159485180 18:69046648-69046670 TTTGTCATGAAATATTTGTCAGG + Intronic
1159493707 18:69172693-69172715 TTCGTCATAAACTCTTTGCCAGG - Intergenic
1159751867 18:72312779-72312801 TTCGTCATGAAATCTTTGCCAGG + Intergenic
1160280833 18:77488891-77488913 TTTGTCATAAAGTCTTTGCCAGG - Intergenic
1166176047 19:41070983-41071005 TTCATCATGAAATCTTTGCCAGG + Intergenic
1168497260 19:56864177-56864199 TTCGACAAGAAGCAGTTGCTGGG - Intergenic
925296884 2:2783253-2783275 TTCCTCAGGAAGCACTTCCCTGG - Intergenic
925477837 2:4238463-4238485 TTCATCATGAAATCTTTGCCAGG - Intergenic
925810990 2:7700543-7700565 TTTGTCATGAAATCTTTGCCAGG + Intergenic
926836138 2:17023274-17023296 TTCATCATGAAACCTTTGCCAGG + Intergenic
927127980 2:20030673-20030695 TTCCTCATGAAATCTTTGCCAGG - Intergenic
927234998 2:20864832-20864854 TTTATCATGAAGTATTTGCCAGG - Intergenic
928774771 2:34747476-34747498 TTCATCATGAAATGTTTGCCAGG - Intergenic
928871612 2:35987566-35987588 CTCGTCATGATGCTTTAGCCTGG + Intergenic
928955532 2:36863232-36863254 TTCATCATGAAATCTTTGCCAGG + Intronic
929382776 2:41371958-41371980 TTTGTCATGAAATCTTTGCCTGG - Intergenic
929450790 2:42035701-42035723 TGCCTCATGAAGCATTTGCCAGG - Intergenic
930677104 2:54214295-54214317 TTTGTCATGAAATCTTTGCCAGG + Intronic
930836244 2:55796418-55796440 TTTGTCATGAAATCTTTGCCAGG - Intergenic
930839623 2:55831141-55831163 TTCATCATGAAATCTTTGCCAGG - Intergenic
930943514 2:57042455-57042477 TTAGTCATGAAATCTTTGCCAGG - Intergenic
931546518 2:63394007-63394029 TTTGTCATGAAATCTTTGCCAGG - Intronic
931576815 2:63726096-63726118 TTCATCATGAAATATTTGCCAGG + Intronic
931779919 2:65570317-65570339 TTCATAATGAAGTCTTTGCCTGG + Intergenic
932374755 2:71226386-71226408 TTCTTCATGCCTCATTTGCCTGG - Intronic
932827039 2:74950808-74950830 TTCGTCATGAAATCTTTACCTGG - Intergenic
933080832 2:77983118-77983140 TTTGTCATGAAATTTTTGCCAGG - Intergenic
933101511 2:78264739-78264761 TTTGTCATGAAATCTTTGCCAGG - Intergenic
933363128 2:81313707-81313729 TTCATTATGAAATATTTGCCAGG - Intergenic
933447589 2:82402065-82402087 TTTGTCATGAAGTGTTTGCCAGG + Intergenic
933593141 2:84255412-84255434 ATCGTCATGAAGTCTTTGCCAGG + Intergenic
935653261 2:105399502-105399524 TTCGTAAAGAAGCATCTGCAGGG - Intronic
935839590 2:107094731-107094753 TTTGTAGAGAAGCATTTGCCTGG - Intergenic
936554651 2:113484521-113484543 ATCCTCATGAAGCATTTGATGGG - Intronic
937561225 2:123226459-123226481 TTTGTCATGAAATCTTTGCCAGG + Intergenic
937723405 2:125129926-125129948 TTTGTCATGAAATATTTTCCTGG - Intergenic
937753026 2:125500778-125500800 TTTGTCATGAAGTCTTTTCCAGG + Intergenic
938168679 2:129056098-129056120 TTCCTCAAGAAACATCTGCCTGG - Intergenic
938229019 2:129641782-129641804 TTCCTCATGAAGACTATGCCTGG + Intergenic
939089489 2:137762259-137762281 TTTGTCATGAAATCTTTGCCAGG - Intergenic
939650709 2:144758795-144758817 TTCATCATGAAATCTTTGCCAGG + Intergenic
939946017 2:148411900-148411922 TTCATCATGAAATATTTCCCAGG + Intronic
940539050 2:154987236-154987258 TTTGTCATGAAATCTTTGCCAGG - Intergenic
940547463 2:155106650-155106672 TTTGTCATGAAATCTTTGCCAGG - Intergenic
941680918 2:168398199-168398221 TTCATCATGAAATCTTTGCCAGG + Intergenic
941692946 2:168520484-168520506 TTAGTCATAAATTATTTGCCTGG + Intronic
941891512 2:170586714-170586736 GTGGTCCTGAAGCCTTTGCCAGG + Intronic
942760638 2:179393309-179393331 TTTGTCATGAAATCTTTGCCAGG - Intergenic
942900481 2:181110941-181110963 TTCAAAATGATGCATTTGCCAGG - Intergenic
943016306 2:182514754-182514776 TTCCTCATGAAATCTTTGCCAGG - Intronic
943073349 2:183167666-183167688 TTCGTCATGAAATCTTTGCCAGG + Intergenic
943312073 2:186338355-186338377 TTCATCATGAAATCTTTGCCAGG + Intergenic
944471739 2:200060732-200060754 TTCATCATGAAATGTTTGCCAGG - Intergenic
944788677 2:203101111-203101133 TTCATCATGAAATCTTTGCCAGG + Intronic
945342789 2:208677284-208677306 TTCATCATGAAATCTTTGCCAGG + Intronic
945541971 2:211099175-211099197 TTTGTCATGAAATCTTTGCCAGG + Intergenic
948485799 2:238279986-238280008 TTCCTCACGAAGCATCTTCCTGG - Intronic
1170378263 20:15726984-15727006 TTTGTCATGAAACCTTTGTCAGG + Intronic
1170987395 20:21271179-21271201 TTCATCAGGAAACTTTTGCCGGG + Intergenic
1172232876 20:33348743-33348765 TTGGTCATGCAGCATGTGCCAGG - Intergenic
1173700244 20:45063647-45063669 TTCGTCATGAAATCTTTGCCAGG + Intronic
1173772311 20:45671829-45671851 TTTATCATGAAGTCTTTGCCTGG - Intergenic
1174795958 20:53522745-53522767 TTCCTCATGTGGCATTTTCCTGG + Intergenic
1175962530 20:62644330-62644352 TCCCTCATGAAGAATTTTCCAGG - Intronic
1177097000 21:16848722-16848744 GTAGTCATGAAGCATTTTCAAGG - Intergenic
1177136267 21:17308218-17308240 TTTGTCATGAGGTTTTTGCCAGG - Intergenic
1177475920 21:21622530-21622552 TTCTTGATTAAGCATTTGCTTGG + Intergenic
1184822678 22:46921945-46921967 TTGGTCATGAAATCTTTGCCAGG + Intronic
949229887 3:1738271-1738293 TTTGTCATGAAACCTTTGCCAGG + Intergenic
949869809 3:8578903-8578925 TGTGTCATGAAACCTTTGCCTGG - Intergenic
950822421 3:15775373-15775395 TTCCTCATAAAGCAATTCCCCGG + Intronic
951167883 3:19504275-19504297 TTTGTCATGAAATCTTTGCCAGG - Intronic
951435955 3:22664989-22665011 TTCTACATGAAGCATTTTCTTGG - Intergenic
951559569 3:23952314-23952336 TTATTCATGAAGCCTATGCCTGG - Intronic
952441879 3:33338862-33338884 TTCGTCATGAAGCATTTGCCAGG - Intronic
952572174 3:34731211-34731233 TTTGTCATGAAATCTTTGCCAGG - Intergenic
952863706 3:37836641-37836663 TTTATCACGAAGCATTTGCTGGG + Intergenic
953249237 3:41228779-41228801 TTCGTCATGAAATCTTTGCCAGG + Intronic
953333786 3:42076685-42076707 TTTGTCATGAAATCTTTGCCAGG + Intronic
954722138 3:52573762-52573784 TTCTTAATTAAGCATTTGCTTGG - Intronic
954844597 3:53544565-53544587 TGAGTCATCAATCATTTGCCTGG + Intronic
957532236 3:81455111-81455133 TTTGTCATAAAGTCTTTGCCTGG - Intergenic
957595128 3:82253842-82253864 TTCTCCATTAACCATTTGCCTGG - Intergenic
957662730 3:83182635-83182657 CTTGTCATGAAGCCTTTGCCTGG - Intergenic
957879325 3:86189690-86189712 TTCATTATGAAGTCTTTGCCTGG - Intergenic
958594624 3:96205597-96205619 TTCATCATGGAGTCTTTGCCAGG - Intergenic
958626915 3:96638045-96638067 TTTGTCATGAAATCTTTGCCAGG - Intergenic
959128335 3:102318848-102318870 TGCATCATGAAGTCTTTGCCAGG + Intronic
959188257 3:103075023-103075045 TTTGTCATGAAATCTTTGCCAGG - Intergenic
959262578 3:104100517-104100539 TTTGTCATAAAATATTTGCCAGG + Intergenic
959825190 3:110785949-110785971 TTTATCATAAAGCCTTTGCCAGG + Intergenic
959870310 3:111319390-111319412 TTTGTCATGAAATTTTTGCCAGG - Intronic
959881863 3:111452761-111452783 TTCATCATGAAATCTTTGCCAGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960400142 3:117187111-117187133 TTCGTCATGAAATCTTTGCCAGG - Intergenic
960560540 3:119078652-119078674 TTCATCATGAAATCTTTGCCAGG - Intronic
960762240 3:121085271-121085293 TTTGTCATGAAATCTTTGCCTGG + Intronic
960858792 3:122130239-122130261 TTCATCATGAAGTCTTTGCCAGG - Intergenic
961850532 3:129812759-129812781 TTTGTTATGAAGTCTTTGCCAGG - Intronic
962472693 3:135726760-135726782 TTCATCATGAAATCTTTGCCAGG + Intergenic
962655228 3:137537175-137537197 TTCATCATGAAATCTTTGCCAGG + Intergenic
963925854 3:150950248-150950270 TTTGTCATGAAATCTTTGCCAGG - Intronic
964054411 3:152435094-152435116 TTTGTCATGAAATCTTTGCCAGG + Intronic
964177523 3:153842351-153842373 TTTGTCATGAAATCTTTGCCAGG + Intergenic
964244797 3:154638951-154638973 TTTGTCATGAAATCTTTGCCAGG - Intergenic
964672189 3:159238804-159238826 TTTGTTATGAATCATTTGACTGG + Intronic
964676441 3:159287123-159287145 TTTGTCATGAAATTTTTGCCAGG + Intronic
964868355 3:161286628-161286650 TTCATCATGAAATCTTTGCCAGG - Intergenic
965087798 3:164121846-164121868 TTCATCATGAAATCTTTGCCAGG - Intergenic
965230527 3:166045935-166045957 TTCATCATGAAATCTTTGCCAGG + Intergenic
966042090 3:175503984-175504006 TTCGTCACGAAATTTTTGCCAGG + Intronic
966076963 3:175948074-175948096 TTCATCATGAATTCTTTGCCAGG - Intergenic
966362093 3:179140950-179140972 TTTGTCATGAAATCTTTGCCTGG - Intergenic
966654558 3:182340693-182340715 TTTGTCATGAAATCTTTGCCAGG - Intergenic
967605452 3:191440007-191440029 TTTGTCATGACGTCTTTGCCGGG - Intergenic
967622079 3:191645680-191645702 TTCATCATGAAATCTTTGCCAGG - Intergenic
968019309 3:195370296-195370318 TTTGTCATGAAATCTTTGCCAGG + Intronic
970379895 4:15496286-15496308 TTCATAATGAAGTCTTTGCCAGG + Intronic
971141114 4:23926003-23926025 TTAGTCGTGATGCATTTTCCTGG + Intergenic
971305662 4:25478734-25478756 TTCATCATGAAACCTTTGCCAGG - Intergenic
971602707 4:28615674-28615696 TTTGTCATGGAGTCTTTGCCAGG + Intergenic
971729388 4:30357869-30357891 TTTGTCATGAAATATTTGCTGGG + Intergenic
972126023 4:35766691-35766713 TTCATCATGAGGTCTTTGCCAGG + Intergenic
972214941 4:36886682-36886704 TTCATCATGAAATCTTTGCCAGG + Intergenic
972419621 4:38874720-38874742 TTTGTCATGAAATCTTTGCCAGG + Intronic
973072790 4:45885984-45886006 TTCATCATGAAATCTTTGCCAGG + Intergenic
973289010 4:48451458-48451480 TTTGTCATGAAATCTTTGCCAGG - Intergenic
973617904 4:52697805-52697827 TTCATCATGAAATCTTTGCCAGG - Intergenic
974270038 4:59638707-59638729 TTCATCATGAAATCTTTGCCAGG - Intergenic
974411593 4:61548335-61548357 TTCATCATGAAATCTTTGCCAGG + Intronic
974742083 4:66020621-66020643 TTTGTTATGAAGTCTTTGCCAGG - Intergenic
974914549 4:68163276-68163298 TTTGTCATGAAATATTTGCCAGG - Intergenic
975909564 4:79250567-79250589 TTCATCATGAAATCTTTGCCGGG - Intronic
976076971 4:81310328-81310350 TTCATCATGAAGTCTTTGCCAGG - Intergenic
976514083 4:85944622-85944644 TTAGTCATGAAGTCTTTGTCTGG + Intronic
977482720 4:97598858-97598880 TTTGTCATGAAATCTTTGCCAGG - Intronic
977484343 4:97623200-97623222 TTCATCATGAAATCTTTGCCAGG - Intronic
977625440 4:99185060-99185082 TTTGTCATGAAGTCTTTGCCAGG + Intergenic
977812893 4:101378826-101378848 TTTGTCATGAAATCTTTGCCAGG + Intergenic
977891272 4:102314294-102314316 TTGGTCAGGAAGCGATTGCCAGG - Intronic
977956574 4:103034389-103034411 TTCATCTTGAAGTCTTTGCCTGG - Intronic
978460718 4:108949050-108949072 TTCCTGAAGAAGCATTTTCCTGG + Intronic
978607872 4:110502332-110502354 TTTGTCATGAAATCTTTGCCAGG + Intronic
978656584 4:111072740-111072762 TTCATCATGAAATCTTTGCCAGG - Intergenic
978823955 4:112998424-112998446 TCCATCATAATGCATTTGCCAGG + Intronic
978942457 4:114453092-114453114 TTTGTCATGAAATCTTTGCCAGG - Intergenic
979300760 4:119084339-119084361 TTAGTCATGAATTATTTACCTGG - Intergenic
979819918 4:125158386-125158408 TTTGGCATGATGCATTTGACTGG + Intergenic
980089662 4:128429471-128429493 TTTGTCATGAAATTTTTGCCAGG + Intergenic
980095535 4:128486397-128486419 TTTGTCATGAAATCTTTGCCAGG - Intergenic
980258480 4:130414860-130414882 TTAGTCATAAATTATTTGCCAGG - Intergenic
980456523 4:133050995-133051017 TTCATCATGAAATCTTTGCCAGG - Intergenic
980539299 4:134172597-134172619 TTCATCATGAAATCTTTGCCAGG - Intergenic
981878382 4:149577285-149577307 TTAGTCATGAAATCTTTGCCAGG + Intergenic
982050267 4:151494226-151494248 TTTGTCATGAAATCTTTGCCAGG + Intronic
983252161 4:165357661-165357683 TAAGTCATGAAGCATTTTCTTGG + Intergenic
984736740 4:183115894-183115916 TTTGTCATGAAATCTTTGCCAGG + Intronic
984877559 4:184383119-184383141 CTCCTCATGAAACATTTACCTGG + Intergenic
985839144 5:2292607-2292629 TCCGTCATGAAGTCTTTGCCAGG - Intergenic
986018387 5:3778366-3778388 TTCGCAATAAAGCATTTGCCGGG + Intergenic
986620830 5:9672227-9672249 TTCATCATGAAACCTTTGTCAGG - Intronic
986979645 5:13432434-13432456 TTTGTCATGAAATCTTTGCCAGG - Intergenic
986989950 5:13540294-13540316 TTCATCAAGAACCATATGCCAGG + Intergenic
987159581 5:15127624-15127646 TTCATCATGAAATCTTTGCCAGG + Intergenic
987866907 5:23553702-23553724 TTTGTCATGAAATCTTTGCCAGG + Intergenic
987908899 5:24115933-24115955 TTCGTCATGAAATCTTTGACAGG + Intronic
988979820 5:36555964-36555986 TTCATCATGAAATCTTTGCCAGG + Intergenic
989013577 5:36902313-36902335 TTCATCATGAAATCTTTGCCAGG + Intronic
989244595 5:39240259-39240281 TTTGTCATGAAATCTTTGCCAGG - Intronic
989330570 5:40253259-40253281 TTCGTCATGAAATCTTTGCCAGG + Intergenic
989360032 5:40591310-40591332 TTTGTCATGAAGTCTTTGCCTGG + Intergenic
989734071 5:44681649-44681671 TTCATCATGAAATCTTTGCCAGG - Intergenic
989824920 5:45841639-45841661 GTCATCATGAAGTCTTTGCCAGG + Intergenic
990089663 5:52026352-52026374 TTTGTCATGAAATCTTTGCCAGG - Intronic
990091611 5:52058105-52058127 TTTGTCATGAAGTCTTTGCTGGG + Intronic
990747318 5:58972485-58972507 TTCAGCATGAGTCATTTGCCTGG + Exonic
990885121 5:60582696-60582718 TTCATCATAAAACCTTTGCCAGG + Intergenic
990898144 5:60721638-60721660 TTTGTCATGAAATCTTTGCCAGG - Intergenic
991351552 5:65724398-65724420 TTCGTTTTGAAGCATGTGTCGGG + Intronic
993281178 5:85926538-85926560 TTTGTCATGAAATCTTTGCCTGG - Intergenic
993350734 5:86847220-86847242 TTCGTCATGAAATATTTGCCAGG + Intergenic
993633933 5:90321235-90321257 TTAATCATGAAATATTTGCCAGG + Intergenic
993794847 5:92254166-92254188 TTTGTCATGAAATCTTTGCCAGG - Intergenic
994263502 5:97687067-97687089 TTTGTCATGAAATCTTTGCCAGG - Intergenic
994381919 5:99081213-99081235 TTTGTCATGAAATCTTTGCCAGG + Intergenic
994558396 5:101333737-101333759 TTCATGATGAAATATTTGCCAGG - Intergenic
994663438 5:102680466-102680488 TTCGTCTTAAAGCATTTCTCTGG + Intergenic
994765025 5:103904464-103904486 TTCATCATGAAATGTTTGCCAGG - Intergenic
994848080 5:105016226-105016248 TTCATCATGAAATCTTTGCCAGG - Intergenic
995099885 5:108287208-108287230 TTTGTCATGAAATCTTTGCCAGG - Intronic
995602000 5:113807527-113807549 TTGTTCATGAAGGATTTCCCCGG + Intergenic
995718051 5:115100065-115100087 TTTGTCATGAATTCTTTGCCAGG + Intergenic
996092065 5:119361198-119361220 TTTCTCAGGAAGCATTTGCGGGG + Intronic
996835855 5:127791537-127791559 TTCCTCATCAAGCATTTCTCTGG - Intergenic
997019722 5:129985076-129985098 TTCATCATGAAGTCTTTGCCAGG + Intronic
997183568 5:131858519-131858541 TTCCTCATGAAATCTTTGCCAGG - Intronic
998291357 5:140917460-140917482 TTTGTCATGAAATCTTTGCCAGG + Intronic
999567323 5:152878941-152878963 TTCATCATGAAATCTTTGCCAGG - Intergenic
999853373 5:155566852-155566874 TTCGTCATGAACTCTTTGCCAGG - Intergenic
1000642482 5:163718913-163718935 TTCGTCATTAAATCTTTGCCAGG - Intergenic
1000698250 5:164416488-164416510 GTCGTCATGAAATCTTTGCCAGG + Intergenic
1001166368 5:169372642-169372664 TTCATCATGAAATCTTTGCCTGG + Intergenic
1001767723 5:174265744-174265766 TTCATCATGAAATCTTTGCCAGG - Intergenic
1001851021 5:174965499-174965521 TTCGTCATAAAATCTTTGCCAGG + Intergenic
1003992987 6:11505958-11505980 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1004092863 6:12522896-12522918 TTCATCATGAAATCTTTGCCAGG + Intergenic
1005471876 6:26169217-26169239 TTAGTCATGAAGGATTTGTAAGG + Intronic
1005909795 6:30298676-30298698 TTCATCATGAAGTCTTTGCCAGG + Intergenic
1007438591 6:41837539-41837561 TTCGTCGTGAAATCTTTGCCAGG - Intronic
1007549982 6:42721874-42721896 TTCTTCATGAAACACCTGCCAGG + Exonic
1008236091 6:49052763-49052785 TTCTTCATGAAGTCTTTGCCAGG - Intergenic
1009468733 6:64005523-64005545 TTTGTCATGAAATCTTTGCCAGG + Intronic
1009599277 6:65777125-65777147 TTCGACATGAAGTCTTTGCCAGG - Intergenic
1009915617 6:69991955-69991977 TTCATCATGAAATCTTTGCCAGG + Intronic
1009997380 6:70911213-70911235 TTCATCATGAAATCTTTGCCAGG + Intronic
1010299670 6:74245013-74245035 TTTGTCATGAAATTTTTGCCAGG + Intergenic
1010377297 6:75186053-75186075 TTTGTCATGAAATCTTTGCCAGG - Intronic
1010415965 6:75612092-75612114 TTCTTCATGTAGCATCTGCAGGG + Intronic
1011140985 6:84156309-84156331 TTGGTCATAAATCCTTTGCCTGG - Intronic
1011190803 6:84726223-84726245 TTTGTCATGAAGCAGTTGCCTGG + Intronic
1011595824 6:89014949-89014971 TTCATCATGAAATCTTTGCCAGG + Intergenic
1011896722 6:92236898-92236920 TTCATCATGAAATCTTTGCCTGG + Intergenic
1011978171 6:93334335-93334357 TTCATCATGAAATCTTTGCCAGG - Intronic
1012560825 6:100579397-100579419 TTTTTCATGAAATATTTGCCAGG + Intronic
1012830431 6:104197841-104197863 TTCATCATGAAGTATTCGTCAGG - Intergenic
1012834489 6:104247936-104247958 TTCATCATGAAATCTTTGCCAGG - Intergenic
1014841146 6:126221865-126221887 TTCTTCATGAAATCTTTGCCAGG + Intergenic
1015045491 6:128770673-128770695 TTTGTCATGAAATATTTGCCAGG - Intergenic
1015470960 6:133605822-133605844 TTCGTCATGAAATATTTGCCAGG + Intergenic
1016577047 6:145581550-145581572 TTTGTCATGAAGTCTTTGACAGG + Intronic
1016997769 6:149972443-149972465 TTCTTCATGAAATCTTTGCCAGG - Exonic
1017000496 6:149993758-149993780 TTCTTCATGAAATCTTTGCCAGG + Intergenic
1017010732 6:150062279-150062301 TTCTTCATGAAATCTTTGCCAGG + Intergenic
1017754673 6:157519309-157519331 TTTGCTATGAAGCAGTTGCCAGG + Intronic
1019052706 6:169195583-169195605 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1020706561 7:11551279-11551301 TTCGTCATGAAATCTTTGCTGGG - Intronic
1020747817 7:12100003-12100025 TTCATCATGAAGTCTTTGCCTGG + Intergenic
1021259366 7:18434340-18434362 TCTGTCATGAAGTCTTTGCCAGG - Intronic
1022935253 7:35168933-35168955 TTCGTCATGAAATTTTTGCCAGG - Intergenic
1023075429 7:36477394-36477416 TTTGTCATGAAATTTTTGCCAGG + Intergenic
1023505383 7:40894403-40894425 TTCATCATGAAATGTTTGCCAGG - Intergenic
1024262651 7:47583436-47583458 GTGCTCATGAAGCCTTTGCCTGG - Intergenic
1027299299 7:76813478-76813500 TTCATCATGAAGTCTTTGTCAGG + Intergenic
1027506680 7:79024419-79024441 TTTGTCTTGAAGCCTTTGCTGGG - Intronic
1028761445 7:94501499-94501521 TTAGTCATAAATTATTTGCCTGG - Intergenic
1028886167 7:95936311-95936333 TTAGTAATGAACCATTTCCCTGG + Intronic
1029831207 7:103261709-103261731 TTCGTCATGAAATTTTTGCCAGG - Intergenic
1030012170 7:105180822-105180844 TTCATCATGAAATCTTTGCCAGG - Intronic
1031248294 7:119346687-119346709 TTCATCATGAAATTTTTGCCAGG + Intergenic
1031268686 7:119616469-119616491 TTTGTCATAAAGCCTTTGTCAGG + Intergenic
1031429345 7:121647658-121647680 TTCATCATGAAATCTTTGCCAGG + Intergenic
1033819037 7:145111166-145111188 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1033829094 7:145230881-145230903 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1034591671 7:152145513-152145535 TTCTTCAAGGAGCATTTGGCAGG - Intronic
1035148741 7:156848166-156848188 TTTGTCATGAAGTCTTTGTCAGG - Intronic
1035453472 7:158994218-158994240 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1038173281 8:25158448-25158470 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1038859465 8:31371218-31371240 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1039138474 8:34355595-34355617 TTTGTCATGAAGTCTTTGCCAGG + Intergenic
1039168861 8:34717917-34717939 TTCATCATGAAGTCTTTGCCAGG + Intergenic
1039309450 8:36299833-36299855 TGTGTCATGAAGTCTTTGCCAGG - Intergenic
1039311086 8:36318706-36318728 TTCTTCAGGAAGCATTTATCAGG - Intergenic
1041507922 8:58622023-58622045 TTCGTCATGAAATCTTTGCTGGG + Intronic
1041665063 8:60435758-60435780 TTCATCATGAAATGTTTGCCAGG - Intergenic
1042035494 8:64529011-64529033 TTGGTCATAAATTATTTGCCTGG + Intergenic
1043240399 8:77926288-77926310 TTTGTCATGAAATTTTTGCCTGG - Intergenic
1043336703 8:79185079-79185101 TTTATCATGAAATATTTGCCAGG + Intergenic
1043550493 8:81366593-81366615 TTCGTCATGAAATCTTTGCCAGG + Intergenic
1043676131 8:82956540-82956562 TTCTTCATGAAATCTTTGCCAGG - Intergenic
1043695910 8:83217066-83217088 TTCGTCATGAAATCTTTGCCAGG + Intergenic
1044193596 8:89348692-89348714 TTTGTCATGAAGTCTTTGCCAGG + Intergenic
1044769243 8:95612247-95612269 TTCATCATGAAATCTTTGCCAGG + Intergenic
1044802694 8:95973493-95973515 TTCATCATGAAATATTTGCCAGG - Intergenic
1044914023 8:97092758-97092780 TTCATCATGAAGTCTTTGCCAGG - Intronic
1045813778 8:106255765-106255787 TTAGTCATGAAGTCTTTGCCTGG + Intergenic
1046279503 8:112007204-112007226 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1046323167 8:112604721-112604743 TTCATTATGAAACCTTTGCCAGG - Intronic
1046736345 8:117780232-117780254 TTCGTCATGAAGTCTTTTCAGGG - Intergenic
1047278276 8:123422698-123422720 TTCATCATGAAATCTTTGCCAGG + Intronic
1049028301 8:140012894-140012916 TTCCTTAGGAAGCATTTTCCAGG - Intronic
1049704315 8:144033464-144033486 TTCCTCATTAAGCATTCCCCTGG + Intronic
1049898361 9:132664-132686 ATCCTCATGAAGCATTTGATGGG + Intronic
1050238456 9:3608690-3608712 TTCATCATGAAATATTTTCCAGG + Intergenic
1050878305 9:10669018-10669040 TTCATCATGAAATTTTTGCCAGG + Intergenic
1050928135 9:11291774-11291796 TTCATCATGAAATCTTTGCCAGG + Intergenic
1051192445 9:14529295-14529317 TAAGTCAGGAAGCAATTGCCTGG + Intergenic
1051457974 9:17282640-17282662 TTTGTCATGAAATCTTTGCCCGG + Intronic
1051976698 9:22958798-22958820 TTCATCATGAAGTCTTTGCCAGG + Intergenic
1052402507 9:28018294-28018316 TTCATCATGAAATCTTTGCCAGG - Intronic
1052501274 9:29293535-29293557 TTCATTATGAAGTCTTTGCCAGG + Intergenic
1052793143 9:32896535-32896557 TTCATCATGAAATTTTTGCCAGG + Intergenic
1053598398 9:39586231-39586253 TTGGGCATGAAGCATTTGTCTGG - Intergenic
1053741424 9:41142965-41142987 ATCCTCATGAAGCATTTGATGGG + Intronic
1053856431 9:42343240-42343262 TTAGGCATGGAGCATTTGTCTGG - Intergenic
1054346637 9:63972452-63972474 ATCCTCATGAAGCATTTGATGGG + Intergenic
1054444414 9:65299112-65299134 ATCCTCATGAAGCATTTGATGGG + Intergenic
1054485858 9:65722389-65722411 ATCCTCATGAAGCATTTGATGGG - Intronic
1054686924 9:68288336-68288358 ATCCTCATGAAGCATTTGATGGG - Intronic
1055131812 9:72784004-72784026 TTCTTAATGAAGGATTTGCCAGG - Intronic
1055337259 9:75245589-75245611 TTCATCATGAAATCTTTGCCAGG + Intergenic
1056054950 9:82811888-82811910 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1056669240 9:88610213-88610235 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1056877846 9:90352309-90352331 TTCATCATGAAATCTTTGCCAGG - Intergenic
1057326918 9:94074172-94074194 TTCTTCTTGAAGCATTAGCCAGG + Intronic
1058078706 9:100677803-100677825 TTCGTCATAAAATCTTTGCCAGG + Intergenic
1058198970 9:102014546-102014568 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1058238413 9:102523422-102523444 TTTGTCATGAAATTTTTGCCAGG + Intergenic
1058831290 9:108819321-108819343 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1058916645 9:109573254-109573276 TCCGTCATGAAATCTTTGCCAGG - Intergenic
1059622656 9:116024929-116024951 TTTGTCATGAAGTCTTTGCCAGG + Intergenic
1060340638 9:122773100-122773122 TTCATCATGAAATCTTTGCCAGG - Intergenic
1185760001 X:2683437-2683459 TTCGTCCAGCTGCATTTGCCAGG - Intergenic
1186018320 X:5225046-5225068 TTCGTCATGAATTCTTTGCTAGG - Intergenic
1187107416 X:16258447-16258469 TTCATCATGAAATCTTTGCCCGG + Intergenic
1187405615 X:19001087-19001109 TTCATAATGAAAGATTTGCCAGG - Intronic
1187615233 X:20986548-20986570 TTCATCATGAAATCTTTGCCGGG - Intergenic
1187801936 X:23073516-23073538 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1187945323 X:24420993-24421015 TTTGTCATGAAACTTTTGCCAGG + Intergenic
1188111808 X:26202917-26202939 TTCATCATGAAATGTTTGCCGGG - Intergenic
1188758449 X:33994837-33994859 TTTCTCATGAAGCCTTTGCCAGG + Intergenic
1188798126 X:34491695-34491717 TTTGCCATGAAGTATTTGCCAGG + Intergenic
1188835758 X:34952355-34952377 TTCCTCATGAAATCTTTGCCAGG - Intergenic
1188838072 X:34983182-34983204 TTTGTCATGAAGTCTTTGCCAGG - Intergenic
1188921395 X:35982514-35982536 TTCATCATGAAATCTTTGCCAGG + Intronic
1188959665 X:36475305-36475327 TTCATCATGAAATCTTTGCCAGG - Intergenic
1189154444 X:38742678-38742700 TTGGTCATGAAATCTTTGCCAGG + Intergenic
1189210978 X:39281928-39281950 TTCATCATGAAATCTTTGCCAGG - Intergenic
1190810234 X:53876133-53876155 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1190993411 X:55578071-55578093 TTCATCATGAAATCTTTGCCGGG - Intergenic
1191001804 X:55667791-55667813 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1191018623 X:55837140-55837162 TTCATCATGAAATCTTTGCCAGG + Intergenic
1191095369 X:56668072-56668094 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1191651774 X:63546409-63546431 TTTGTCATGAAGGCTTTGCTAGG - Intergenic
1191685887 X:63890252-63890274 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1191927776 X:66333036-66333058 TTTGTCATTAAGGCTTTGCCAGG + Intergenic
1191961654 X:66709677-66709699 TTCATAATGAAATATTTGCCAGG - Intergenic
1192075847 X:67995597-67995619 TTCGTCATGAACTCTTTGCCAGG + Intergenic
1192828488 X:74725125-74725147 TTCGTCATGAAATTTTTACCAGG + Intergenic
1192837617 X:74818546-74818568 TTCATCATGAAATCTTTGCCAGG - Intronic
1192866353 X:75136969-75136991 TTCCTCCTGAAGTCTTTGCCAGG - Intronic
1192877289 X:75244861-75244883 TTCATCATGAAATATTTGCCAGG - Intergenic
1192886728 X:75343129-75343151 TTCATCATGAAATCTTTGCCTGG + Intergenic
1193090421 X:77488112-77488134 TTCTTCATGAAATTTTTGCCAGG - Intergenic
1193171099 X:78336817-78336839 TTCATCATGAAATTTTTGCCAGG + Intergenic
1193218457 X:78893877-78893899 TTCATCATGAAACATTTGTTAGG + Intergenic
1193275713 X:79585216-79585238 TTTGTCATGAAATATTTGCCTGG + Intergenic
1193308922 X:79982034-79982056 TTCATCATGAAATCTTTGCCAGG + Intergenic
1193425113 X:81332795-81332817 ATCTTCATGAAATATTTGCCAGG + Intergenic
1193428825 X:81374839-81374861 TTCATCATGAAATCTTTGCCAGG + Intergenic
1193440078 X:81529819-81529841 TTTGTCATGAGGTCTTTGCCAGG + Intergenic
1193512851 X:82427119-82427141 TTCATCATGAAGTCTTTGTCAGG + Intergenic
1193585983 X:83321802-83321824 TTCGTCATGAAATCTTTGCCAGG - Intergenic
1193611264 X:83634178-83634200 TTCATCATGAAATCTTTGCCAGG + Intergenic
1193619192 X:83729979-83730001 TTCAACATGAAATATTTGCCAGG + Intergenic
1193748878 X:85318425-85318447 TTTGTCATGAAGTCTTTGTCAGG + Intronic
1193854781 X:86586468-86586490 TTCATCATGAAACCTTTGCCAGG + Intronic
1193878460 X:86893649-86893671 TTAGTCATGAAATCTTTGCCAGG + Intergenic
1193913220 X:87330586-87330608 TTCATTATGAGGCCTTTGCCAGG - Intergenic
1193973405 X:88086542-88086564 TTTGTCATGAAATATTTGCCAGG + Intergenic
1193976254 X:88122866-88122888 TTTGTCATGAAATATTTGCCAGG - Intergenic
1193981127 X:88183009-88183031 TTTGTCATGATATATTTGCCAGG + Intergenic
1194126603 X:90025846-90025868 TTCATCATGAAGACTTTGCTAGG - Intergenic
1194129881 X:90068567-90068589 TTTGTCATGAAGTCTTTGCTGGG + Intergenic
1194134034 X:90116614-90116636 TCCATCATGAAGTATTTGGCTGG + Intergenic
1194245740 X:91509755-91509777 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1194251465 X:91580631-91580653 TTTGTCATAAAGTCTTTGCCAGG + Intergenic
1194581958 X:95684265-95684287 TTTGTCATGAAGTCTTTGCCAGG - Intergenic
1194797734 X:98233622-98233644 TTCATCATGAAGTCTTTGCCAGG - Intergenic
1195024063 X:100857971-100857993 TTCATCATGAAATCTTTGCCAGG + Intronic
1195124806 X:101797372-101797394 TTCATCATGAAATATTTTCCAGG - Intergenic
1195238093 X:102921988-102922010 TTCATCATGAAGTCTTTGCCAGG + Intergenic
1195241137 X:102953482-102953504 TTCATCATAAAATATTTGCCAGG + Intergenic
1195353569 X:104016985-104017007 TTAGTCATGAAATCTTTGCCTGG + Intergenic
1195576273 X:106454812-106454834 CTTGTCATGAAGACTTTGCCAGG - Intergenic
1196040547 X:111198380-111198402 TTCATCATGAAATCTTTGCCAGG + Intronic
1196587076 X:117442599-117442621 TCTGTCATGAAGTCTTTGCCAGG - Intergenic
1196926351 X:120637179-120637201 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1197089279 X:122517674-122517696 CTCGTCATGAAATATTGGCCAGG - Intergenic
1198280876 X:135141153-135141175 TTCATCATGAAATCTTTGCCAGG + Intergenic
1198290082 X:135231361-135231383 TTCATCATGAAATCTTTGCCAGG - Intergenic
1199182021 X:144868917-144868939 TTTGTCATGAAATCTTTGCCAGG + Intergenic
1199354473 X:146845456-146845478 TTCATCATGAAGTCTTTACCTGG - Intergenic
1199786140 X:151106985-151107007 TTCGTCATGAAATCTTTGCTGGG + Intergenic
1199913381 X:152312571-152312593 TTTGTCATGAAATATTTGCCAGG - Intronic
1199917308 X:152357676-152357698 TTCATCATGAAATCTTTGCCAGG + Intronic
1200361175 X:155608493-155608515 TTTGTCATGAAATATTTGACAGG - Intronic
1200479813 Y:3686729-3686751 TCCATCATGAAGTATTTGGCTGG + Intergenic
1200564710 Y:4751005-4751027 TTTGTCATGAAATCTTTGCCAGG - Intergenic
1200570403 Y:4821862-4821884 TTTGTCATAAAGTCTTTGCCAGG + Intergenic
1201367378 Y:13222623-13222645 TTAGTCATACATCATTTGCCTGG - Intergenic
1201967872 Y:19758005-19758027 TTTGTCATAAAGTATTTTCCAGG + Intergenic
1202588860 Y:26461034-26461056 TTTGTCATGAAGTCGTTGCCTGG + Intergenic