ID: 952442790

View in Genome Browser
Species Human (GRCh38)
Location 3:33349909-33349931
Sequence GGGTCTGGTGCTTTCTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 728
Summary {0: 5, 1: 27, 2: 110, 3: 140, 4: 446}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952442790_952442795 -5 Left 952442790 3:33349909-33349931 CCAAAACAGAAAGCACCAGACCC 0: 5
1: 27
2: 110
3: 140
4: 446
Right 952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952442790 Original CRISPR GGGTCTGGTGCTTTCTGTTT TGG (reversed) Intronic
900118638 1:1039323-1039345 GGCTCTGGCGCTGTCTGTCTGGG - Intronic
901373030 1:8817113-8817135 GGGTCGTGTGCTTTCTTTTTTGG - Intronic
901523193 1:9801422-9801444 GGGTCTGGTACTTTTCGTTTTGG - Intronic
902205819 1:14867373-14867395 TGGTCTTGGGCTTTCTATTTTGG - Intronic
903644232 1:24883394-24883416 CTGCCTGGTGCCTTCTGTTTTGG + Intergenic
904309271 1:29616758-29616780 GGGCCTGGCGTTTTCTTTTTTGG + Intergenic
904728811 1:32572277-32572299 GGGTCTGGAGTTTTCTTTGTGGG + Intronic
905717253 1:40162129-40162151 GCGTCTAGAGCTTTCTGATTAGG + Intronic
905832694 1:41085615-41085637 GTGTCTAGTGCTTACTTTTTTGG - Intronic
905963942 1:42073181-42073203 GGGCCTGGTGTTTTCTGTTTTGG + Intergenic
906016417 1:42585014-42585036 GGGCCTAGTGCTTTATTTTTTGG + Intronic
906347406 1:45026840-45026862 GAGCCTGGCGCTTTCTGTTTTGG + Intronic
906701506 1:47861632-47861654 GGGCCTGGTGCTTTTTGTTTTGG - Intronic
907169789 1:52451949-52451971 AGGCCTAGTGCTTTCTTTTTTGG - Intronic
907325495 1:53635960-53635982 GGGTCTGGAGTTTTCTTTATGGG - Intronic
907881926 1:58557637-58557659 GGGTCTGGGGTTTTCTGTTATGG - Intergenic
908047755 1:60189907-60189929 GGGCCTGGTGCTTTCTGTTTTGG - Intergenic
908199464 1:61779551-61779573 GGCTGTGGTGCTGACTGTTTTGG - Intronic
908469542 1:64430325-64430347 GGGCCTGGTGCTTTTTAGTTAGG - Intergenic
908574816 1:65448644-65448666 AGGCCTTGTGCTTTCTGTTTTGG + Intronic
909944001 1:81642552-81642574 GAGCCTGGTGCTTTCAGTTTTGG - Intronic
909981080 1:82102014-82102036 TGGTCTGTTGTTTTCTTTTTTGG + Intergenic
910204882 1:84740087-84740109 GGGTCTGGTGGTTTTAGTTCTGG - Intergenic
910919767 1:92330993-92331015 GGGTGTGGTGGTTTGGGTTTGGG + Intronic
911081010 1:93930911-93930933 TGGTCTGTAGCTTTCTTTTTTGG - Intergenic
911373451 1:97023057-97023079 GGGCCTAGTACTTCCTGTTTTGG - Intergenic
911934804 1:103956122-103956144 GAGTCTAGTATTTTCTGTTTTGG + Intergenic
912065723 1:105739355-105739377 GGGCCTAGTGCTTTCTTGTTTGG + Intergenic
912367981 1:109150478-109150500 GGGTCTGGTGCTTGCTCTGGGGG + Intronic
913028226 1:114868674-114868696 AGGCCTGGTGCTTTCTGTTCTGG + Intronic
913065536 1:115250071-115250093 GGGCATGGTGTTTTCTCTTTAGG - Intergenic
913204746 1:116527795-116527817 GAACCTGGTGCTTTCTGTTTTGG + Intronic
914238111 1:145830940-145830962 AGGTCTGGTGTTTTTTTTTTTGG - Intronic
915569508 1:156736714-156736736 GGGTCAGGCTCTTTCTGTTCTGG + Exonic
917157235 1:172016720-172016742 GGGCCTGGTGCCTTCTTTTTTGG + Intronic
918351938 1:183665507-183665529 GTGCCTGGTGCTATATGTTTTGG + Intronic
918610847 1:186489311-186489333 CGCAGTGGTGCTTTCTGTTTGGG - Intergenic
919143635 1:193605681-193605703 GGTTCTGGGGCTTCCTGTTTGGG - Intergenic
921242375 1:213198706-213198728 GGTCCTGGTGCTTTCTATTTTGG - Intronic
921674164 1:217959723-217959745 GGGCCTGGTGCTTTCTGTTTTGG - Intergenic
922115091 1:222605655-222605677 GGGTCTGGAGTTTTCTTTGTTGG + Intergenic
922521866 1:226260201-226260223 GGGCCTGGTGCTATCTGTTTTGG - Intronic
922868523 1:228881417-228881439 GAGACTGGTGCTTTCCATTTGGG - Intergenic
922982656 1:229840903-229840925 GGGTGTGGTGGTTTATGCTTTGG + Intergenic
923023170 1:230181863-230181885 AGGCCAGGTGCTTTCTGTTTGGG + Intronic
923342611 1:233020700-233020722 GAATCTGCTGCTTTCTGTGTGGG - Intronic
923709261 1:236372681-236372703 GGGCCTGGTGCTTTCTGTTTTGG + Intronic
923967203 1:239155289-239155311 GGCTCTGGTGTTTTTTGGTTTGG + Intergenic
1063056913 10:2515138-2515160 GGGCCTGGTGTTTTCTTTTTTGG - Intergenic
1063263664 10:4420677-4420699 ATGGCTGGTACTTTCTGTTTTGG - Intergenic
1064704185 10:18054425-18054447 GGGCCCAGTACTTTCTGTTTTGG - Intergenic
1065227846 10:23563670-23563692 GGGCCTGGAGATTTCTTTTTTGG + Intergenic
1065619285 10:27563369-27563391 GGGTCTGGTGCTTCCTGTTTTGG + Intergenic
1065766041 10:29030409-29030431 GTGTCTGTTTCTTTATGTTTAGG - Intergenic
1065904641 10:30239320-30239342 TGTTCTGGTGCTTTTTGTTGTGG + Intergenic
1066043089 10:31571137-31571159 GGGCCTGGTGCTTTCTGTTTTGG - Intergenic
1066496389 10:35946456-35946478 GGCACTGGTCCTTTCTGTCTGGG + Intergenic
1067254473 10:44622920-44622942 GGGCCTGGTGCTTTCTGTTGCGG - Intergenic
1067265614 10:44741247-44741269 GTGTCTTGTGCTTTCCTTTTTGG - Intergenic
1067280414 10:44866995-44867017 GGGCCTGGAGGTTTCTGTGTGGG - Intergenic
1067664435 10:48263663-48263685 GGGCCTGGTGCTTTATGTTTTGG - Intronic
1067739141 10:48881586-48881608 CTGCCTGGTGCTTTCAGTTTAGG - Intronic
1068071524 10:52202478-52202500 TGGCCTGGTGATTTCTTTTTTGG + Intronic
1068441831 10:57065726-57065748 GGGCCTGGTGATTTTGGTTTCGG + Intergenic
1069022953 10:63509531-63509553 GGACCTGGTACTTTCTGTTTGGG + Intergenic
1069253455 10:66301191-66301213 GGTCCTGGTTCTTTCTGTTTTGG - Intronic
1071047161 10:81394679-81394701 AGGCCTCGTGCTTTCTGTTTTGG + Intergenic
1071199089 10:83196805-83196827 GGGCCTGGTGATTTCTTTTTTGG + Intergenic
1071323939 10:84493085-84493107 GGGCCTGGAGATTTCTTTTTTGG + Intronic
1071584666 10:86808033-86808055 GGGCCTGTTGTTTTCTGTTTTGG + Intronic
1071606046 10:86990822-86990844 GGGCCAAGTGCTTTCTGTTTTGG - Intergenic
1071947387 10:90661047-90661069 GGGTTTGGTTCTTGCTGTCTTGG - Intergenic
1071992770 10:91116072-91116094 GGGTCTGTCTCTTTCTGTCTTGG - Intergenic
1072123302 10:92423014-92423036 GGGCTTGATGCTTTCTTTTTTGG - Intergenic
1072386307 10:94932760-94932782 GGGTCTGGTGTTTTCTCTTTTGG - Intergenic
1073296518 10:102442792-102442814 GGGCTTGTTTCTTTCTGTTTTGG + Intergenic
1073586347 10:104713880-104713902 AGGCCTGGTGATTTCTTTTTTGG + Intronic
1073856351 10:107679385-107679407 GGGCCTGGTGCTTTCTTTAATGG - Intergenic
1073929486 10:108557809-108557831 GGGACTGATGCTTTCTGTTTGGG - Intergenic
1075029904 10:119016010-119016032 GGGTCAGGTGCTTTCTTTATGGG + Intergenic
1076470698 10:130716225-130716247 GGACTTGGTGCTTTCTGTGTGGG + Intergenic
1076576068 10:131469069-131469091 GGCCCTGGGGCTTTCTGATTTGG + Intergenic
1076872281 10:133199960-133199982 GGGTCTGGGGCCACCTGTTTGGG - Intronic
1076991139 11:275624-275646 GGGTCTAATGCTTTTTGGTTTGG + Intergenic
1077380025 11:2228481-2228503 GGGCCTGGTAATTTCTTTTTAGG - Intergenic
1077427145 11:2486835-2486857 GGGCCTGGTGGGTGCTGTTTGGG - Intronic
1077484987 11:2834535-2834557 AGCTCTGGTGCTGTCTGTGTTGG - Intronic
1078293918 11:10045827-10045849 GGGCCTGGTGCTTTCTGTTTTGG - Intronic
1078408760 11:11094330-11094352 TGGTCTCTTGCTTTCTGTTTGGG + Intergenic
1078591613 11:12645793-12645815 GGGCCTGGTCCTTTCTGTTTTGG - Intergenic
1078983469 11:16565325-16565347 GGGCCTGGGGATTTCTTTTTGGG - Intronic
1079275718 11:19035354-19035376 GGGCCTGGGGCTTTATGTTTTGG - Intergenic
1080305839 11:30834561-30834583 AGGACTGGTGCTTTCTGTCTTGG - Intronic
1080327014 11:31087015-31087037 GGGTCTGGAGTTTTCTTTGTAGG + Intronic
1080591128 11:33723851-33723873 GTGTCTGGAGCTCTCTGTTCGGG - Intronic
1080844103 11:36011289-36011311 GTGTCTAATGCTTTCTTTTTGGG + Intronic
1081463004 11:43289102-43289124 GGCTCTGCTCCTATCTGTTTAGG - Intergenic
1082246779 11:49932485-49932507 TGACCTGGTGCTTTCTGCTTTGG - Intergenic
1083100178 11:60296102-60296124 AGGTCTGATGCTTTCTGTTTTGG + Intronic
1083592074 11:63901660-63901682 CTGTCTAGTGCTTTATGTTTGGG + Intronic
1083917201 11:65755640-65755662 AGGCCTGCAGCTTTCTGTTTTGG + Intergenic
1085753234 11:79180958-79180980 GGGCCTGGTACTTTATTTTTTGG - Intronic
1085890807 11:80576546-80576568 GGGCCTGGAGATTTCTTTTTGGG - Intergenic
1086031464 11:82362095-82362117 GGGCCTAGTGTTTTCTATTTTGG + Intergenic
1086031472 11:82362601-82362623 AGGGCTAGTGCTTTCTATTTTGG - Intergenic
1086199383 11:84183106-84183128 GGGCCTGGTTCTTTCTGTTTGGG - Intronic
1086389984 11:86353822-86353844 TGGCCTAATGCTTTCTGTTTGGG - Intergenic
1086503830 11:87480634-87480656 GTGTCTGCTGCCTTCTGTATTGG - Intergenic
1087417809 11:97880262-97880284 GGGTCAAGTGGTTTCTGTTTTGG + Intergenic
1088115455 11:106306870-106306892 GGGTCTGCTGCTTCCTCTCTGGG + Intergenic
1088336424 11:108709412-108709434 GGGCTTGGTGATTTCTGTTTTGG + Intronic
1088873694 11:113914872-113914894 GGGTCTGGAGCTTTCTTTGTGGG + Intronic
1089585157 11:119505888-119505910 GGGGCAGGTGCTTTCTGTCTTGG + Intergenic
1089683620 11:120133209-120133231 TGGTCTGGGGATTGCTGTTTGGG + Intronic
1090108655 11:123880264-123880286 GGGCCTTGTGCTTTCTATTTTGG - Intergenic
1090131614 11:124148139-124148161 AAGTCTGATGCTTTATGTTTTGG + Intergenic
1090410430 11:126504540-126504562 GGGTCTAGGGCTTTCTTTATGGG - Intronic
1090754289 11:129775207-129775229 TGGCCTGGTGCTTTTTGTTTTGG - Intergenic
1090842366 11:130502564-130502586 GGGCCTGGAGATTTCTCTTTTGG + Intergenic
1091307680 11:134548455-134548477 TGGGCTTGTGCTTTCTGTTTTGG - Intergenic
1091326688 11:134695562-134695584 GGGTCTGATGCTTTCTGTTTGGG - Intergenic
1091704430 12:2684135-2684157 GGGTCCAGTGCTTTCTGCTCGGG + Intronic
1091962351 12:4707853-4707875 GAGCCTTGTGCTTTCTATTTTGG - Intronic
1092567015 12:9676795-9676817 TGACATGGTGCTTTCTGTTTTGG + Intronic
1092728367 12:11506216-11506238 GGACCTGGTGCTTTCTTCTTGGG - Intergenic
1093109780 12:15136020-15136042 GGGCATGGAACTTTCTGTTTTGG + Intronic
1093153255 12:15648887-15648909 GGATCTGATGATTTTTGTTTAGG - Intronic
1093506805 12:19876379-19876401 AGGCCTGGTGCTTTCTGTTTTGG + Intergenic
1093610163 12:21146073-21146095 AGGCCTGTTTCTTTCTGTTTTGG + Intronic
1093857654 12:24125792-24125814 AGGTCTGGAGCTTTCTTTTGGGG + Intergenic
1095258607 12:40071629-40071651 GAACCTGGTGCTTTCAGTTTTGG + Intronic
1095634222 12:44413233-44413255 GGCCCTGGTACTTTCTGTTTTGG - Intergenic
1096129054 12:49142885-49142907 GGGCCTGGTGCTTTCTGTTTGGG + Intergenic
1096561627 12:52439687-52439709 GGGTCTGGTGGTTGCTGTGGAGG + Intergenic
1097455474 12:59793817-59793839 GGGCCTTATACTTTCTGTTTGGG + Intergenic
1097511218 12:60543753-60543775 TGGTCTGGTGCTTTAATTTTTGG - Intergenic
1097718212 12:62990384-62990406 GAGCCTAGTGCTTTTTGTTTTGG + Intergenic
1097932345 12:65202680-65202702 GGGCCTGGTGCTTTATATTTTGG + Intronic
1098777766 12:74643016-74643038 GAGCCTGGTGTTTTCTGTTTTGG + Intergenic
1098832871 12:75384519-75384541 GGGCCTGGTGCTTTCTGTTTTGG - Intronic
1099293416 12:80800612-80800634 GGGTCGGGTGCTTCCTGCTTTGG - Intronic
1099571912 12:84332580-84332602 GTGTCTGTTGCATTCTGTTTTGG - Intergenic
1100255469 12:92878941-92878963 GGGCTTGGAGCTTTCTTTTTGGG - Intronic
1101142101 12:101806793-101806815 GGGTCTGGGGCTTTCTATTTTGG - Intronic
1101649632 12:106664182-106664204 GAACCTGGTGCTTTCTGTTTTGG + Intronic
1103386137 12:120534252-120534274 GGGTCTCGTGGTTTGTTTTTTGG - Intronic
1104307576 12:127623363-127623385 GGGGCTTGTGGTTTCTGCTTTGG + Intergenic
1104810362 12:131616858-131616880 GGGCCTTGTGACTTCTGTTTGGG - Intergenic
1105035350 12:132916189-132916211 GGGCCTAGAGATTTCTGTTTGGG + Intronic
1105205912 13:18223821-18223843 GGGCCTGGTGCTTTCTTTTTCGG + Intergenic
1105292921 13:19064154-19064176 GGCTCTGGGGTTTTCTTTTTGGG - Intergenic
1106306077 13:28511101-28511123 GAGTCTGGTGCTTTCTGTTTCGG + Intergenic
1106637817 13:31548878-31548900 GGGTCTGATGTTTTCTGTTTTGG + Intergenic
1106702318 13:32243652-32243674 GTGTCTGATGCTTTCCTTTTAGG + Intronic
1107261059 13:38491917-38491939 GGGCCTGGTTCTTTCTTTTTTGG + Intergenic
1107682320 13:42864799-42864821 GGGTCTTGTGCTTTCGGTGGTGG + Intergenic
1108392648 13:49962254-49962276 GAGTCTGGTGATTTCTGTTTTGG - Intergenic
1108567280 13:51712993-51713015 GGGCCTGGAGCTTTCTTTGTGGG - Intronic
1109500601 13:63232118-63232140 GGTTCTGGTCCTTTCTGGTTAGG + Intergenic
1109898905 13:68736259-68736281 GGGTTTTGTGCTTTCTGCTTTGG + Intergenic
1110827071 13:79984252-79984274 GGGCCTGATGCTTTCTATTTAGG + Intergenic
1110945540 13:81410903-81410925 GGGGCTGGTGCTTTGTGTTTTGG + Intergenic
1111129071 13:83951116-83951138 GGGCATGGTGCTTTCTGTTTCGG - Intergenic
1111326121 13:86698122-86698144 GAGCCCGGTGCTTTCTGATTTGG - Intergenic
1111560085 13:89932972-89932994 TGGTCTGTAGTTTTCTGTTTGGG + Intergenic
1111689673 13:91547512-91547534 GGGCCTGGTGCTTTCTGTTTTGG - Intronic
1112025306 13:95406144-95406166 GGGTCTGTGGCTTTTTGTTAGGG - Intergenic
1112320367 13:98401487-98401509 TGGCCTGGTGCTAGCTGTTTGGG + Intronic
1112710776 13:102126181-102126203 GGGTGCGGTAGTTTCTGTTTGGG - Intronic
1113754427 13:112800512-112800534 GAGTCTTGTGCTTTCCGTTTTGG - Intronic
1114445732 14:22786510-22786532 CGGTCTGGAGTTTTCTGTGTGGG - Intronic
1114819548 14:26001464-26001486 GGAACTGGTGCTTTCTGTTTTGG - Intergenic
1115678371 14:35707721-35707743 GGGCCTGGTGCTTTCTAATTTGG + Intronic
1115719266 14:36142605-36142627 GGGCCTGGTGCTTTGTGTTTTGG + Intergenic
1115841606 14:37477341-37477363 GGGCCTGGTGCTTCCATTTTTGG + Intronic
1116092298 14:40325275-40325297 AGGCCTGATGCATTCTGTTTTGG - Intergenic
1116442652 14:44971183-44971205 GACTCTGGTGCTTTCTGTTTTGG + Intronic
1116665720 14:47772145-47772167 GGGCCTGATGCTATCTGTTGTGG - Intergenic
1117651527 14:57911903-57911925 GGGCCTAATGCTTTCTATTTTGG + Intronic
1118409630 14:65464946-65464968 GAGTGTGGTGCTTTCTGTTTTGG + Intronic
1118428815 14:65693815-65693837 GAGTGTGGTGCTTTCTCTTTTGG + Intronic
1118430468 14:65714355-65714377 TGGTTTTGTGCTTTCTGCTTAGG + Intronic
1118727814 14:68642228-68642250 GGGCCTGGTGCTTTCTATTTTGG + Intronic
1118841064 14:69512018-69512040 GGGCCTGGTGCTTTCTGTTTTGG + Intronic
1119131846 14:72179985-72180007 GGGTCAGGTGCTTTCTGTGTTGG + Intronic
1120057345 14:79939922-79939944 GGGTCTAGTGTTTTCTGTTTTGG + Intergenic
1120737738 14:88073210-88073232 GGGACTGGTGCTGTCTGTTTTGG - Intergenic
1120837166 14:89050815-89050837 GGGCCCAGTGCTTTCTGTTTTGG - Intergenic
1121040436 14:90741921-90741943 GGCTCTGGCGTTTTCTTTTTTGG - Intronic
1121480820 14:94271041-94271063 GGGCTAGATGCTTTCTGTTTTGG - Intronic
1121509516 14:94501814-94501836 GGGGCTGGTGTTGGCTGTTTGGG - Intronic
1122426496 14:101610638-101610660 GGGGCTGCTACTTTCTCTTTTGG - Intergenic
1124398339 15:29325616-29325638 GGGCCTGCTGCTTTCTTTTTTGG - Intronic
1124599563 15:31121686-31121708 AGGCCTGGTGCTTTCTGTAGGGG - Intronic
1124713825 15:32038888-32038910 GGGCCTGTTGCTTTCTGTTTTGG + Intronic
1125792391 15:42377792-42377814 GGTTCTGGTGCCTTCTTTTTTGG + Intronic
1126025240 15:44440012-44440034 GGGCCTGGAGTTTTCTGTGTTGG + Intronic
1126219308 15:46194114-46194136 TGGCCTGAAGCTTTCTGTTTTGG + Intergenic
1126658746 15:51010121-51010143 GGGCCTCGTGCTTTCTATTTTGG + Intergenic
1127176160 15:56360350-56360372 GGGACTGGTGATTTCTTTCTTGG + Intronic
1127200289 15:56639423-56639445 GAGTTTGGAGATTTCTGTTTGGG - Intronic
1127549067 15:60019033-60019055 GAGTCTGATTCTTTCTCTTTGGG + Intronic
1129576218 15:76748877-76748899 GGGTCTGGGGTTTTCTTTGTGGG - Intronic
1130164922 15:81445029-81445051 AGGCATGGTGCTTTCTGTTTTGG - Intergenic
1130193593 15:81759170-81759192 GGGTCTGGAGCCTCCTGTGTAGG + Intergenic
1130580184 15:85130250-85130272 GGGTCTGGTGGGATGTGTTTGGG - Intronic
1130807294 15:87338156-87338178 GGACCTGGTGATTTCTATTTTGG - Intergenic
1132022852 15:98378878-98378900 GGACCTGGTGCTTTCTATTTTGG - Intergenic
1132296891 15:100743832-100743854 GGGCCTGAGGCTTTTTGTTTCGG + Intergenic
1132487598 16:203242-203264 GGACCTGATGCTTTCTGTTTTGG - Intronic
1133163065 16:3925043-3925065 GGACCTGGCACTTTCTGTTTTGG - Intergenic
1133266552 16:4588068-4588090 GGGTCTGATGCTTCTAGTTTGGG - Intronic
1133404931 16:5515965-5515987 CGCTCTGGTGCTCTCTGATTTGG - Intergenic
1135814514 16:25619907-25619929 GAGTCTGCTGCTTGATGTTTGGG - Intergenic
1137311741 16:47268375-47268397 CGGTCTGGAGTTTTCTTTTTTGG - Intronic
1137313048 16:47285637-47285659 GTGTCTGCTGCTTTGTGTGTGGG + Intronic
1137373897 16:47934238-47934260 GGGCCTGGTGCTTTCAGAGTTGG + Intergenic
1137437561 16:48469336-48469358 GGGCCTGGTGTTTTCTGTTTTGG + Intergenic
1137775559 16:51051404-51051426 GGGTCTGCTACTTTCTATCTGGG + Intergenic
1137882509 16:52066071-52066093 AGGTCTGGTGCTATCTGTTTTGG + Intronic
1138138590 16:54546555-54546577 TGGTTTGGGGCTTTCTGTGTAGG + Intergenic
1138592219 16:58007337-58007359 GGGCCTGGTGCCTTCTGTTTTGG + Intronic
1138904805 16:61318361-61318383 GGGCCTGGCGATTTCTGTTTTGG - Intergenic
1139121867 16:64029211-64029233 GGGCCTGTTGCTTTCTGTTTTGG + Intergenic
1139281660 16:65775736-65775758 GGGACTGGTGCCTTCTCTTGGGG + Intergenic
1139550265 16:67668911-67668933 GGACCTGGTGCTGTGTGTTTAGG + Intergenic
1139930278 16:70520659-70520681 GTGTGTGGTGTTTTTTGTTTAGG - Intronic
1140617753 16:76687689-76687711 AGGCCTGGTGCTTTCTGTTTTGG - Intergenic
1141449546 16:84088807-84088829 GGGTGTGGTTTTTTCTGCTTGGG - Intronic
1141977948 16:87530227-87530249 GGGACTGGTGTTTTCTTTGTGGG - Intergenic
1142299755 16:89249626-89249648 CGGCCTCGTGCTTTCTTTTTGGG - Intergenic
1143227447 17:5318553-5318575 GGGCATAGTGCTTTCTTTTTTGG - Intronic
1143308285 17:5966478-5966500 GGGCCTGATGCTTTCTGTTTTGG + Intronic
1143459584 17:7093184-7093206 TGGGCTGGTGATTTCTGTTTTGG - Intergenic
1143962091 17:10729638-10729660 GGGACTTGGGCTTTCTGCTTGGG - Intronic
1144048527 17:11475909-11475931 GGGTCTGGTGACTTCAGTTCTGG + Intronic
1144236785 17:13269339-13269361 GGGTCTGGTTTTGTGTGTTTGGG - Intergenic
1144361297 17:14496780-14496802 GGGACTGGTGGCTTGTGTTTAGG + Intergenic
1144521211 17:15953386-15953408 GGGTCTCTTGCTTTCCCTTTTGG - Intronic
1145878902 17:28340004-28340026 GTGGCTGGTGGTTTCTGTGTTGG + Intronic
1146700253 17:34952032-34952054 GGTTGTGGTGGATTCTGTTTTGG - Exonic
1147354328 17:39881776-39881798 GGGCCTGATGCTTTCTGTCTTGG + Intergenic
1147450960 17:40503689-40503711 GGTCCTGGTGCTTTCTGTTTTGG + Intergenic
1148464244 17:47855547-47855569 GGGTCTGGTTCTCTCTGAATTGG - Intronic
1148691876 17:49533109-49533131 GGGGCTGGTGCCTTCTGTTCGGG + Intergenic
1149234556 17:54574676-54574698 AAATCTGATGCTTTCTGTTTCGG - Intergenic
1150178157 17:63084107-63084129 GGGCCTGGTGCTTTCTGTTTTGG + Intronic
1150511809 17:65760871-65760893 AGGCCTGGTGTATTCTGTTTTGG + Intronic
1150574200 17:66415712-66415734 GGGTCTGTTGGTTTCTGGGTAGG + Intronic
1150994548 17:70301228-70301250 GGGCCTAGAGCTTTCTGTGTGGG + Intergenic
1151069724 17:71195025-71195047 AGTTCTGGTGCTTCCTGTCTTGG + Intergenic
1152893135 17:82894076-82894098 GGGACTGTTTCTTTCTGTTTCGG + Intronic
1152940120 17:83165642-83165664 GGGCTTGGTGCTTTCTGTTTTGG + Intergenic
1153792390 18:8590892-8590914 AGGCCTGGTGCTTTCTGTTTTGG - Intergenic
1154088539 18:11333217-11333239 AGGCCTAGTGTTTTCTGTTTTGG + Intergenic
1154114977 18:11605987-11606009 GGGCTTGGAGCTTTCTGCTTTGG - Intergenic
1154232172 18:12566715-12566737 GGTCCTGGTGCTTTCTGTTTTGG - Intronic
1154282940 18:13023844-13023866 GGGCATGGTGCATTCTATTTTGG + Intronic
1154398006 18:14009743-14009765 GGGTGTGTGGCTTTTTGTTTGGG + Intergenic
1155178544 18:23323316-23323338 GGGTCTGGATATTTCTCTTTTGG - Intronic
1155184762 18:23377431-23377453 GGTTCTGGTGTTTTCTCTTTTGG + Intronic
1156092633 18:33489614-33489636 GGGTTGGGTGCTTTTTGTTGAGG - Intergenic
1157072915 18:44430731-44430753 GGGTCTGGTGATATCTGTTTTGG + Intergenic
1157756646 18:50223826-50223848 TGGTCTGGTACTTTTTGTTACGG - Intergenic
1158356042 18:56620339-56620361 TGGTCTGCAGCTTTCTTTTTTGG + Intronic
1159005935 18:63011570-63011592 GGGCTTGGTGCTTTTCGTTTTGG + Intergenic
1159016227 18:63103706-63103728 GTGTGTGGTGCTTTGTGATTTGG + Intergenic
1159078067 18:63703751-63703773 GGGTCTGGTTCTGTCCTTTTGGG - Intronic
1160260990 18:77294070-77294092 GGGTCTGGTGGGTGGTGTTTGGG + Intergenic
1160491453 18:79339994-79340016 GGGTGTGGTGCTTTGTGCCTGGG + Intronic
1160561397 18:79759445-79759467 GGGCTTGATGCTTTCTGCTTTGG + Intergenic
1160621122 18:80171333-80171355 GTGTCTCCTGCTTTCTGTTCCGG - Exonic
1160912479 19:1481359-1481381 GGCTCAGGTGGTTTCTGCTTGGG - Intergenic
1161450110 19:4340867-4340889 GGGTCTGGAGATTGCTTTTTTGG + Intronic
1162246277 19:9404292-9404314 GGACTTGGTGCTTTTTGTTTTGG - Intergenic
1164574060 19:29395294-29395316 GGCTCTGGGGATGTCTGTTTTGG - Intergenic
1165283981 19:34822934-34822956 GGGCCTAGTGCTTTCTGTTTTGG - Intergenic
1165294488 19:34915689-34915711 GGTTCTGCTGCTTTCTGTGAAGG - Intergenic
1165589806 19:36958387-36958409 GGGCCTGATGCTTTCTATTTTGG + Intronic
1166879564 19:45919536-45919558 GGGTCTGCTGCTTTCCCTTGGGG - Intergenic
925565286 2:5246757-5246779 GGGCCTCATGCTTCCTGTTTTGG - Intergenic
926145402 2:10394181-10394203 GGGTTTGGGGATTTGTGTTTTGG + Intronic
926262637 2:11280781-11280803 GGACCTCATGCTTTCTGTTTTGG - Intronic
926769467 2:16355828-16355850 GGTTCTGGTGTTTTCTTTGTGGG + Intergenic
927154631 2:20214386-20214408 GGGGCTGGTCCCTTCTGGTTTGG + Intronic
927902821 2:26833624-26833646 GGACCTGGTGTTTTCTTTTTTGG - Intergenic
927958986 2:27228421-27228443 GGATATGATGTTTTCTGTTTTGG - Intronic
928301146 2:30126156-30126178 GGGCCTGGAGATTTCTTTTTTGG - Intergenic
928892899 2:36225920-36225942 AGGTCTGGTTCTTTCTGTTTTGG - Intergenic
929066915 2:37986321-37986343 GGTCCTGATGCTTTCTGTTTTGG - Intronic
929072126 2:38042070-38042092 GAGTCTGTTGCTATCTGCTTTGG + Intronic
929900421 2:45996942-45996964 GGGCCTAGTGCTTTCTGTTTTGG + Intronic
929913154 2:46110314-46110336 GGGTCTTATACTTTCTTTTTTGG + Intronic
930854994 2:56005776-56005798 GGGGCTTGTGCTTTCTGTGTTGG + Intergenic
931210263 2:60187451-60187473 GGATCTAGTGCTTTCCTTTTTGG - Intergenic
932637176 2:73400389-73400411 TGGTCTGTTGTTTTCTTTTTTGG + Intronic
932975011 2:76589716-76589738 GGCTCTGGAGCTGTCTGTGTAGG - Intergenic
933137500 2:78756549-78756571 CGCTCTAGTCCTTTCTGTTTGGG - Intergenic
933512396 2:83257639-83257661 GCTTCTGATACTTTCTGTTTTGG - Intergenic
933853406 2:86390156-86390178 GGAGTTGGTGCTTTCTGTTTTGG + Intergenic
933946515 2:87290706-87290728 GGGTGTGGTGTTTTCTTTTTGGG + Intergenic
934855415 2:97726286-97726308 GGGGCTGTTGCTCTCTGGTTTGG + Intronic
935518974 2:104080047-104080069 GGACCTGGCGCTTTCAGTTTTGG + Intergenic
935633529 2:105232028-105232050 GGGTCTTGTGCTTTTTGTGGTGG - Intergenic
935793843 2:106620183-106620205 GGGCCTGATGCTTTCTGTTCTGG + Intergenic
935848421 2:107192004-107192026 GAGGCAGGTGCTTTCTCTTTTGG - Intergenic
936064389 2:109319585-109319607 GAGTGTGGGGCTTTCTGTTCTGG - Intronic
936287459 2:111191734-111191756 GAGTCTGGAGCTTTCTGCTTGGG + Intergenic
936333678 2:111570835-111570857 GGGTGTGGTGTTTTCTTTTTGGG - Intergenic
937542624 2:122977419-122977441 GAGCCTGGTGCTTTCTGTTTTGG - Intergenic
937899370 2:127005980-127006002 GGGCCTGGAGTTTTCTTTTTGGG - Intergenic
938718377 2:134042401-134042423 TGGTCTCATGCTTTCTGTATTGG - Intergenic
939236865 2:139505228-139505250 GGACCTGGTGCTTTCTGTTTTGG - Intergenic
939963909 2:148592151-148592173 TGGTCTGTTCCTTTCTGTCTTGG - Intergenic
940163768 2:150744225-150744247 GAGCCTGGTGCTTTGTGTTTTGG - Intergenic
940410212 2:153354022-153354044 GGGCCTGGTACTTTCTGTTTTGG + Intergenic
940472968 2:154122548-154122570 GGGCCTGGTGCTTTCTTTGTTGG + Intronic
940714105 2:157199134-157199156 GGGCCTGGTGTTTTCTGTTTTGG - Intergenic
941060405 2:160840905-160840927 TGGCCTGGTGCTTTCTGTTTTGG - Intergenic
941265973 2:163362999-163363021 GGGTCCAATGCTTACTGTTTTGG + Intergenic
941603790 2:167570287-167570309 GGGCCTGGTGCTTTCTGTTTTGG + Intergenic
941979332 2:171437545-171437567 GGGCTTGGCACTTTCTGTTTTGG + Intronic
942074792 2:172347591-172347613 GAGTCTGGAGCTTTCTTTGTGGG + Intergenic
942224331 2:173802212-173802234 GGGTCTGCTGCTTGGTGTGTGGG - Intergenic
942677418 2:178442601-178442623 TGGCCTGGTGCTTTCTGTACTGG + Intronic
943266105 2:185735100-185735122 GTGTCTAGTGGTTTCTCTTTGGG - Intergenic
943460126 2:188162752-188162774 GAGACTGGTGCTTTCCATTTTGG - Intergenic
944103266 2:196052338-196052360 GGGGCTAGTGCATACTGTTTTGG - Intronic
944330601 2:198461921-198461943 GGGTCTGGTTCTTGCTTTTAAGG + Intronic
944829506 2:203519017-203519039 GGGCCTTGTGCTTTCTATTTTGG - Intronic
945309264 2:208291596-208291618 GGGCCTGGTGCTTTCTGTTTTGG + Intronic
946799460 2:223396134-223396156 GGGTCTGGAGCTTTCTTTTTTGG + Intergenic
947030802 2:225791599-225791621 GGGCCTGGTTCTTTCTTTTTTGG + Intergenic
947168091 2:227282990-227283012 GGGTCTGGGCATTTCTTTTTGGG + Intronic
947279875 2:228438614-228438636 GGGTCTGGAGTATTCTATTTGGG + Intergenic
947693276 2:232160237-232160259 GGGTCTGGAGTTTTCTATGTGGG + Intronic
947715754 2:232338144-232338166 GGCCCTGGTCCTTCCTGTTTGGG - Intronic
948160073 2:235816072-235816094 GGCTGTGGTGTTTTGTGTTTTGG + Intronic
948267929 2:236650796-236650818 GGGTCTGGTACTTTCTTTTTTGG + Intergenic
948277348 2:236719286-236719308 GGGCTTGGTGCTTACTGTTCTGG + Intergenic
948527856 2:238583903-238583925 AAGTCTAGTGCTTTCTGTTTTGG + Intergenic
948730851 2:239962948-239962970 GGGTCTGGTGGGTGGTGTTTAGG - Intronic
948843213 2:240669565-240669587 GGGCTTGGTGGTTTCTGTTTGGG - Intergenic
948863132 2:240762590-240762612 GGGTCTGGACCTGTCTCTTTAGG - Intronic
949002595 2:241625027-241625049 GGGCTTGGTGCTTTCTGTTTTGG - Intronic
1168988603 20:2073669-2073691 GGGCCTGGTGCTTTTTGTTTTGG - Intergenic
1170127640 20:12983597-12983619 GGGGCTAGTGCTTTCTGTGTGGG + Intergenic
1170378799 20:15732917-15732939 GGACCTGGTGCTTTCTGTTTTGG + Intronic
1170636694 20:18111860-18111882 GGGTCTGGTGTTTTCGATTTTGG + Intergenic
1170909441 20:20550089-20550111 GGGTATAGTGCTTACTGCTTGGG - Intronic
1171081295 20:22187719-22187741 CGGTCTGTAGCTTTCTTTTTTGG + Intergenic
1171288936 20:23968943-23968965 GGGTTTGGGGCTCTCTGTTGTGG - Intergenic
1171467786 20:25343224-25343246 GGGCCCAGTGATTTCTGTTTTGG - Intronic
1174095386 20:48084959-48084981 GGGTCTGGTTCTTTGGTTTTGGG + Intergenic
1174651290 20:52128041-52128063 GTGTCTGTTCATTTCTGTTTAGG + Intronic
1175402843 20:58710497-58710519 GGGTCAGGGGCTTTTTTTTTTGG - Intronic
1175510766 20:59523998-59524020 CAGCCTGCTGCTTTCTGTTTTGG - Intergenic
1177000873 21:15611016-15611038 GGGTCTGGTGCTTTCTGTTTGGG - Intergenic
1177383691 21:20380334-20380356 GGACCTGATGCTGTCTGTTTTGG + Intergenic
1177468683 21:21525532-21525554 GGGCTTGGTGCTTTCTGTCTGGG - Intronic
1177767733 21:25477025-25477047 GGGTCTGGAGTTTTCTTTGTGGG - Intergenic
1178031558 21:28532912-28532934 GGGCCTGATGCTTTCTGTTTTGG + Intergenic
1178266721 21:31149584-31149606 GGGGCTGGTTCTTTGAGTTTGGG - Intronic
1179018059 21:37611360-37611382 GGGCCAAGTGCTTTCTGGTTGGG - Exonic
1179218458 21:39386551-39386573 GGGTCTGGAGCTTCCTGAGTTGG + Intronic
1180725083 22:17940964-17940986 GTGTCTGGTGCTTTCTTTAGTGG - Intronic
1180760050 22:18194895-18194917 GGGCCTGGTGCTTTCTTTTTCGG - Intergenic
1180770362 22:18379194-18379216 GGGCCTGGTGCTTTCTTTTTCGG - Intergenic
1180775618 22:18429805-18429827 GGGCCTGGTGCTTTCTTTTTCGG + Intergenic
1180808691 22:18740842-18740864 GGGCCTGGTGCTTTCTTTTTCGG + Intergenic
1180828303 22:18882147-18882169 GGGCCTGGTGCTTTCTTTTTCGG - Intergenic
1181042463 22:20198564-20198586 GGGTCTGGTGCACTCTGGTGGGG + Intergenic
1181071618 22:20345816-20345838 GGGCCTGGTGCTTTCTTTTTCGG + Intergenic
1181194688 22:21174758-21174780 GGGCCTGGTGCTTTCTTTTTCGG + Intergenic
1181214756 22:21318012-21318034 GGGCCTGGTGCTTTCTTTTTCGG - Intergenic
1181329569 22:22079512-22079534 CTGTCTGGTGCTCTCTGTTCAGG + Intergenic
1182004901 22:26951788-26951810 GTGTGTGATGCTTTCCGTTTTGG + Intergenic
1182020911 22:27080846-27080868 AGGCGTGGTGCTTTCTGTGTTGG + Intergenic
1182056732 22:27362662-27362684 GGGCCTAGTGCTTTCTGTTTTGG + Intergenic
1182599159 22:31446396-31446418 CAGTCTGGAGCTCTCTGTTTCGG + Intronic
1182716649 22:32361760-32361782 GGTTCTGGTGTTGTCTTTTTTGG - Intronic
1183153392 22:36055272-36055294 CTGTCTGGTCCTGTCTGTTTTGG + Intergenic
1184055570 22:42045725-42045747 GAGCCTGGTGCTTTATTTTTTGG - Intronic
1203232195 22_KI270731v1_random:120378-120400 GGGCCTGGTGCTTTCTTTTTCGG - Intergenic
1203278400 22_KI270734v1_random:108152-108174 GGGCCTGGTGCTTTCTTTTTCGG - Intergenic
949654031 3:6196014-6196036 ATGTCTGGTGCTTTTTGCTTTGG + Intergenic
949983394 3:9518532-9518554 GGGCCTGGTGCTTTCTCTTTTGG + Intronic
950164748 3:10786704-10786726 GGGTCTGGAGTTTTCTTTGTGGG - Intergenic
950245744 3:11416330-11416352 GGGCCTGGTGCTTTCTATTTGGG + Intronic
950812585 3:15663454-15663476 GGGTCTGGTGCTTTCTGTTTTGG + Intergenic
950958948 3:17084303-17084325 TGTGCTGGTGCTTTTTGTTTTGG - Intronic
950994183 3:17477474-17477496 GGGATTGGTGTTTTCTGTCTGGG + Intronic
951134451 3:19087801-19087823 GGATATGGTGCTGTCTGTTTTGG - Intergenic
951504578 3:23429156-23429178 GGGCCTGGTGCTTTCCGTTTTGG - Intronic
951974126 3:28484403-28484425 GGGCTTGCTGCTTTTTGTTTGGG + Intronic
952442790 3:33349909-33349931 GGGTCTGGTGCTTTCTGTTTTGG - Intronic
952735412 3:36686187-36686209 AGGCCTGGTTCTTTCTGTTTTGG - Intergenic
953580737 3:44153442-44153464 GGGCCTGGAGATTTCTTTTTTGG + Intergenic
953627768 3:44584992-44585014 GGGTCTGGCGCTTTCGGTGAGGG + Exonic
956261295 3:67344994-67345016 GGGTCTGGTCTTTTCTTTGTGGG - Intergenic
956339074 3:68200457-68200479 AAGCCTGGTGCTTTCTGTTAGGG + Intronic
956954574 3:74321907-74321929 GGACCTGGTGCTTTCTGTTTGGG - Intronic
957120793 3:76089201-76089223 GGGTCTGGTATTTTCTATTTTGG - Intronic
958162134 3:89831226-89831248 GGCTCTGATGGTTTTTGTTTTGG + Intergenic
958443787 3:94190123-94190145 GGGCCAGGTGCTATCTGTGTTGG + Intergenic
959245085 3:103856035-103856057 GGGTCTGGTGCATTCTGTTTCGG - Intergenic
960226587 3:115176586-115176608 GGGCCTGATACTTTCTGTTTTGG - Intergenic
960251264 3:115457142-115457164 GGGCCTAGTCCTTTCTGTTTAGG + Intergenic
960608815 3:119535812-119535834 GGATTTGGTGCTTTCTTTTAGGG - Intronic
960756233 3:121016802-121016824 GGGCCTGGTGCTTTCTGTTTTGG - Intronic
960893210 3:122473242-122473264 AGTCCTGGTGTTTTCTGTTTTGG - Intronic
961231203 3:125311957-125311979 GGGTCTGGTGCTTTCTGTTTTGG - Intronic
961853333 3:129843741-129843763 GGGTCTGGAGTTTTCTTTTTTGG - Intronic
962000763 3:131293720-131293742 GGGCCTGGTGCTTTCTGATGTGG + Intronic
962240575 3:133747741-133747763 TTGTCTGTTGCTCTCTGTTTAGG - Intronic
962670339 3:137699294-137699316 GGGTCTGGTGTTTTATTTGTGGG - Intergenic
963232272 3:142920207-142920229 AGGCCTGATGGTTTCTGTTTTGG + Intergenic
963823901 3:149930685-149930707 GGATATGGTGCCTGCTGTTTTGG + Intronic
963845682 3:150154582-150154604 GGACCTGTTTCTTTCTGTTTTGG - Intergenic
964264805 3:154882770-154882792 GGTCTTGGTGCTTTCTGTTTTGG - Intergenic
965446913 3:168784719-168784741 TGGCCTACTGCTTTCTGTTTTGG - Intergenic
966275219 3:178157188-178157210 GGGGCTGCTGCTTTCTGCCTGGG - Intergenic
966477261 3:180364230-180364252 GGGCCTGGTGCTTTCCGATTTGG + Intergenic
966545745 3:181145567-181145589 GGACCTGGTGCTTTCTGTTTTGG - Intergenic
966719745 3:183050260-183050282 TGGCCTTGTGCTTTCTGTTTTGG - Intronic
967019605 3:185511202-185511224 GGGCCACTTGCTTTCTGTTTTGG + Intronic
967816295 3:193801197-193801219 GGGTCTGAAGCTTTCTTTGTGGG + Intergenic
967872307 3:194241197-194241219 GGACTTGGTGCTTACTGTTTTGG - Intergenic
968346029 3:198009592-198009614 GGGCCTGGAGATTTCTCTTTTGG + Intronic
968354872 3:198098583-198098605 GGGACTGGTACTTTATATTTAGG - Intergenic
968535067 4:1120604-1120626 GGGCCTGGTGCTTTCTGCTTTGG - Intergenic
969337266 4:6519005-6519027 GGGCCTGGTACTTTCTGTTTGGG - Intronic
969482238 4:7452940-7452962 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482242 4:7452960-7452982 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482261 4:7453034-7453056 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482279 4:7453130-7453152 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482316 4:7453298-7453320 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482367 4:7453540-7453562 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482413 4:7453766-7453788 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482433 4:7453862-7453884 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482453 4:7453958-7453980 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482457 4:7453978-7454000 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482477 4:7454074-7454096 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482493 4:7454150-7454172 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482501 4:7454188-7454210 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482505 4:7454208-7454230 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482509 4:7454228-7454250 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482542 4:7454378-7454400 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482562 4:7454488-7454510 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482588 4:7454620-7454642 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482632 4:7454823-7454845 GGGTCTGGTGCTGTGTGTTGGGG + Intronic
969482640 4:7454861-7454883 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482652 4:7454917-7454939 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482673 4:7455029-7455051 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482697 4:7455161-7455183 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482722 4:7455273-7455295 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
969482789 4:7455588-7455610 GGGTCAGGTGCTGTGTGTTGGGG + Intronic
970305770 4:14730692-14730714 GACTTTGGTACTTTCTGTTTAGG - Intergenic
971684945 4:29752520-29752542 AGGCCTGGTGCTTTCTCTTTTGG - Intergenic
972103437 4:35450959-35450981 GGCCCTGGTACCTTCTGTTTTGG - Intergenic
972186652 4:36536426-36536448 GGGACTGGTGCTTTCTGTTTTGG + Intergenic
972203500 4:36744201-36744223 AGGTCTGATGCTTTCTGTTTTGG - Intergenic
972207318 4:36791258-36791280 GGGCCTAGTGTTTTCTTTTTGGG + Intergenic
972479698 4:39485744-39485766 GGGTATGGTGCTTCCAGTTTAGG - Intergenic
973273888 4:48288737-48288759 GGGTCTGGAGATTTCTTTTGGGG - Intergenic
973313723 4:48737493-48737515 GGACCTGGTGCTTTCTCTTTTGG - Intronic
974632287 4:64508898-64508920 GTGCCTTGTGCTTTCTATTTTGG - Intergenic
977308388 4:95354113-95354135 GAATCTGTTTCTTTCTGTTTCGG + Intronic
977355050 4:95935322-95935344 GGGACTGCAGCTTTCTTTTTTGG - Intergenic
977377918 4:96231751-96231773 GAGTCTGATGCTTTCTGTTTTGG - Intergenic
977616510 4:99092655-99092677 GGGCTTTGTGCTTTCTGCTTTGG - Intergenic
977940055 4:102848082-102848104 GGGTTAAGTACTTTCTGTTTCGG + Intronic
977964549 4:103129230-103129252 GGACCTGGTGCTTTCTGTTTTGG - Intronic
978245507 4:106567602-106567624 GGGTCTTGGGCTTCCTGCTTTGG - Intergenic
978526102 4:109667213-109667235 GGACCTGGTGCTTTCTGTTTTGG + Intronic
978631113 4:110745939-110745961 GAATCTGGTGCTTTCTGCTTTGG + Intergenic
979890944 4:126093533-126093555 GGCTCTGATGCTTTCTGCTTTGG + Intergenic
980543793 4:134230569-134230591 TGGTCTGTAGCTTTCTTTTTTGG + Intergenic
980807757 4:137835573-137835595 GGGGCTGCTGCTTTAAGTTTGGG - Intergenic
981126207 4:141109912-141109934 GAGGCTACTGCTTTCTGTTTGGG - Intronic
981287405 4:143034638-143034660 GGGTCTGGTGGGATGTGTTTGGG - Intergenic
982286079 4:153736635-153736657 GGGCTTGGTGCTTTCTTTTTTGG + Intronic
982491508 4:156036230-156036252 GGGCCTTATGCTTTCTGTTTTGG + Intergenic
982498565 4:156124506-156124528 AGACCTGGTACTTTCTGTTTTGG - Intergenic
982643904 4:157998120-157998142 GGGTATTGTGTTCTCTGTTTGGG - Intergenic
982666208 4:158267293-158267315 AGGCCTGGTGCTTTCTGTTTTGG + Intergenic
982873985 4:160621873-160621895 GGGCCTAGTTCTTTCTGTTTTGG - Intergenic
982891207 4:160853010-160853032 GGCTTTGTTGCTTTCTCTTTGGG - Intergenic
983368739 4:166831405-166831427 GGGTCTGGAGTTTTCTTTGTGGG + Intronic
983429979 4:167636350-167636372 GGGCTTGGTGCTTTCTTTTTTGG + Intergenic
983460208 4:168017411-168017433 GGGCCTGGTGGGTGCTGTTTTGG - Intergenic
983709075 4:170692693-170692715 GTGTCTGCTGCTTGATGTTTGGG - Intergenic
983985049 4:174049440-174049462 TGGCCTGGTGCTTTCTGTTTTGG + Intergenic
984307364 4:178011240-178011262 GGGCCTGAGGCTTTCTGTTTTGG + Intergenic
984313485 4:178095591-178095613 GGGTCTGATGCTTTCTGTTTTGG - Intergenic
984321373 4:178201062-178201084 GGGCCTTGTGCTTTCTGTTTTGG - Intergenic
984442032 4:179783733-179783755 AGGCCTGGTGTTTTCTCTTTTGG + Intergenic
984474782 4:180222347-180222369 TGGTCTGTAGCTTTCTTTTTTGG + Intergenic
985567485 5:627120-627142 TGGCCTGGTACTTTCTGTTTTGG + Intronic
985759721 5:1740898-1740920 GGGCCTGGTGCTTTCTGTTTTGG + Intergenic
986823972 5:11500567-11500589 GGGTCTGCTGCCTTTTGATTAGG - Intronic
986940364 5:12940839-12940861 GGGCCTGGTGCTTCCTGTTTTGG - Intergenic
987273015 5:16332172-16332194 GGGCCTGGAGCTTTCTGTTTTGG - Intergenic
987577339 5:19747098-19747120 GGGTCTTCTGCTCTCTGTCTAGG + Exonic
988631266 5:32934123-32934145 GTGTCTGCTGCTTTCTCTGTAGG - Intergenic
988647873 5:33114908-33114930 TGGCCTGGTGCTTTCTGTTTTGG + Intergenic
988870977 5:35389475-35389497 AGCTCTGGTTCTTTTTGTTTAGG - Intergenic
989776589 5:45215899-45215921 GGGCCTGGTGCTTTCTCTTTAGG - Intergenic
990078070 5:51875313-51875335 GGGCCTAGTACTTTCTGGTTTGG + Intergenic
990604186 5:57391763-57391785 AGGCCTGTTGCTTCCTGTTTTGG + Intergenic
991007965 5:61849759-61849781 GGGCATGGTGCTTTCTATTTTGG - Intergenic
991322989 5:65396960-65396982 GGGCCTAGTGCTTTCTGTTTGGG + Intronic
991629511 5:68641872-68641894 GGGCCTGGCATTTTCTGTTTTGG + Intergenic
992601144 5:78401454-78401476 GGGCCTGTTACCTTCTGTTTTGG + Intronic
992694404 5:79271503-79271525 GGGCCTGATGCATTCTGTTTTGG + Intronic
992991015 5:82283472-82283494 GGGCCTGGTGTTTTCTTTATGGG + Intronic
993202376 5:84832112-84832134 GGGACTGGTACTGTCTATTTAGG + Intergenic
993316604 5:86414960-86414982 GGTTATGGGGCTTTCTTTTTGGG - Intergenic
994875613 5:105417107-105417129 TGGTCTGTTGTTTTCTTTTTTGG - Intergenic
995039204 5:107569154-107569176 GGTTTTGGGGCTTTCTGTATTGG + Intronic
995311938 5:110723134-110723156 GGGCCTGGTACTTTCTGTTTTGG + Intronic
995656350 5:114431214-114431236 GGTCCTGGGGCTTTCTGTTTTGG + Intronic
996233597 5:121098758-121098780 AGGCCTGATGCTTTTTGTTTTGG - Intergenic
996235348 5:121122622-121122644 GGGCCTGGAGCTTTCTTTCTAGG + Intergenic
996429246 5:123353617-123353639 GGGTCTGGAGCCTTCTTTGTGGG + Intronic
996433571 5:123408636-123408658 AGACCTGGTACTTTCTGTTTGGG - Intronic
996494938 5:124144045-124144067 GGGTCTGGAGATTTCCTTTTTGG - Intergenic
996821855 5:127638223-127638245 TGGTCTAGTGCATCCTGTTTCGG - Intergenic
996901613 5:128548226-128548248 GAGCCTGGTACTTTCTTTTTTGG - Intronic
998084336 5:139304591-139304613 GGTGCAGGTGCTTTCTTTTTTGG + Intronic
998789438 5:145750138-145750160 CGGCTTGGTGATTTCTGTTTGGG - Intronic
998818623 5:146037700-146037722 GGGTCTGGAGTTTTCTGTATAGG - Intronic
999180619 5:149667673-149667695 CTGCCTGGGGCTTTCTGTTTTGG - Intergenic
999332333 5:150683659-150683681 GGTTCTGGTGTTTTCTCTGTGGG - Intergenic
999834015 5:155349772-155349794 GGGCCTGGTGTTTTCTGTTTTGG - Intergenic
1000757523 5:165180266-165180288 GGGTCTGCAGTTTTCTTTTTTGG + Intergenic
1001189620 5:169616683-169616705 ATGTTTGGTGCTTCCTGTTTTGG - Intergenic
1001967954 5:175926329-175926351 GGACCTGATGTTTTCTGTTTTGG - Intronic
1002009034 5:176261842-176261864 GGGCCTGGGGCTTTCTGTTTTGG - Intronic
1002217688 5:177650436-177650458 GGGCCTGGGGCTTTCTGTTTTGG + Intergenic
1002249491 5:177917472-177917494 GGACCTGATGTTTTCTGTTTTGG + Intergenic
1002579023 5:180196144-180196166 GGGCCTGGTATGTTCTGTTTGGG + Intronic
1002626398 5:180532587-180532609 GTGTCTGCTGCTTGCTGTGTGGG - Intronic
1003198417 6:3935943-3935965 GGGCCTGCTGCTTTCTGTTTTGG + Intergenic
1004033480 6:11897280-11897302 GGATTTGTTACTTTCTGTTTTGG + Intergenic
1005216897 6:23540054-23540076 TGGTCTGGACCTTTCTGTTTTGG + Intergenic
1005228261 6:23668813-23668835 TGGCCTGGAGCTTTCTGTTTTGG + Intergenic
1006354112 6:33543795-33543817 GGCTCTCCTGCTTTCTGTTCAGG - Intergenic
1006482696 6:34310575-34310597 GGGCTTGGTGTTTTCTGTTTTGG - Intronic
1007064951 6:38980587-38980609 GGGTCTGGTCAGTTCTTTTTGGG + Intronic
1007621627 6:43218912-43218934 GGGTCTGCTTCTTTCTCCTTGGG - Intronic
1007911448 6:45519069-45519091 GAGTAAGGTGCTATCTGTTTAGG + Intronic
1008813076 6:55528853-55528875 GGGTCATATGCTTCCTGTTTTGG - Intronic
1009956275 6:70458201-70458223 GGTTCTTGTGCTTGCTATTTTGG - Intronic
1010079501 6:71843227-71843249 GGGCTTGGTTCTTTCTGCTTTGG + Intergenic
1010137145 6:72568886-72568908 GGGCCTGGTGCTTTCTGTTTTGG - Intergenic
1010164794 6:72902788-72902810 GGGTCTGTAGTTTTCTTTTTTGG + Intronic
1010203761 6:73305535-73305557 GTGCCAGGTCCTTTCTGTTTTGG - Intronic
1010876301 6:81110931-81110953 GGGCCTGGTGGTTTTTGTTTGGG + Intergenic
1011782183 6:90801833-90801855 GGGTGAAGTGCTTTCTGTCTGGG + Intergenic
1011874845 6:91945479-91945501 GGGCCTGGTGCTTTTTGTTTTGG - Intergenic
1012090363 6:94886223-94886245 GGGCCTGATGCTTTTTATTTTGG + Intergenic
1012809061 6:103935017-103935039 GAGTCTGATGGTTTCTTTTTTGG - Intergenic
1012923043 6:105239268-105239290 GGGTCTGTAGTTTTCTTTTTTGG - Intergenic
1013028329 6:106303431-106303453 GGGTCTGGAGATTTCTTTTTGGG - Intronic
1013114499 6:107091669-107091691 GGGCCTGGTACTTTGTGTTTTGG - Intronic
1013366997 6:109444142-109444164 GGGTGAGGTGCTTTCTTTGTGGG + Exonic
1013472305 6:110476453-110476475 GGGTCTGTTTCTTTCCGTTGCGG - Intronic
1013720566 6:113022342-113022364 GGGCCTGGTATTTTCTATTTTGG - Intergenic
1014228333 6:118873643-118873665 GGTCCTGGTGTTTTGTGTTTTGG - Intronic
1014718099 6:124888905-124888927 AGGTCTTTTGCTTTCTTTTTCGG + Intergenic
1014835940 6:126160723-126160745 GTGTCTGCTGTTTTCAGTTTGGG - Intergenic
1014975169 6:127871816-127871838 GGGCCTGGAGATTTCTTTTTTGG - Intronic
1015245496 6:131069934-131069956 AACTCTGGTGCTTTCTTTTTGGG - Intergenic
1015668048 6:135653626-135653648 GGGTCTCATGGTTTCTGTTTTGG - Intergenic
1016715273 6:147219514-147219536 GGTCCTGGTACTTTCTATTTTGG + Intronic
1016991389 6:149931727-149931749 GGGTATGATGCTTACTGTCTGGG + Intergenic
1018526587 6:164717508-164717530 GGGCCTGGTGACTTCAGTTTAGG - Intergenic
1019105933 6:169666896-169666918 GAGTCTGGGCCTTTCTGTTTTGG - Intronic
1019502583 7:1371950-1371972 GGTTCTGATGTTTTCTGTGTTGG - Intergenic
1019627416 7:2024820-2024842 AGGTCTGGTGCTTTCCTTTTTGG - Intronic
1019761774 7:2818251-2818273 GGGGCTGGGGAATTCTGTTTTGG + Intronic
1021272106 7:18602084-18602106 GGACCTGGTGCTTTCCTTTTTGG + Intronic
1021381923 7:19978164-19978186 GGGCTTGGTGCTTTCTGTTTTGG + Intergenic
1021841412 7:24724534-24724556 GGGGCTGGCCCTTTCTGTTGAGG - Intronic
1022420607 7:30218809-30218831 GGGCTTGGCACTTTCTGTTTTGG - Intergenic
1022894699 7:34738314-34738336 GGGCCTGATGCTTTCTTTCTAGG + Intronic
1022899755 7:34794554-34794576 GGGCTTGATGCTTTCTGTTTTGG - Intronic
1022900479 7:34804014-34804036 GGGCCTGGTGTTTTCTTTTGTGG - Intronic
1023037417 7:36144606-36144628 GGACCTGGTGCTTTCTGTTTTGG - Intergenic
1023553623 7:41396644-41396666 GGGCCTGCTGCTTTCAGTTTTGG + Intergenic
1023878130 7:44302267-44302289 GGGCCTGGTGCTTTCTGTTTTGG - Intronic
1024668985 7:51574246-51574268 TGGTCTGTTGTTTTCTTTTTTGG + Intergenic
1024964555 7:55012118-55012140 GGGCTTGGTGCTTTCTGTTTTGG + Intergenic
1025102290 7:56145536-56145558 GGGTCTGGTTCGTTCCGTGTTGG + Intergenic
1027191520 7:75999196-75999218 AGGCTGGGTGCTTTCTGTTTTGG - Intronic
1028196866 7:87917347-87917369 GGGCCTGGTGCTTTTCGTTTTGG + Intergenic
1028485769 7:91355726-91355748 GGGTCTGGTGCTTTGTTTGGGGG + Intergenic
1028851293 7:95541133-95541155 GGCTCTGATGCTCTCTGTCTGGG + Intergenic
1028926690 7:96365137-96365159 GAGACTAGTGCTTTCTGTTTTGG + Intergenic
1030423584 7:109341554-109341576 GTGCCTGGTGCTTTCTCTTTTGG + Intergenic
1030834977 7:114272504-114272526 GGGCCTGGTGCTTTCTATTTTGG + Intronic
1031113001 7:117634117-117634139 GGACCTGGTGCTTTCTGTTTTGG + Intronic
1031139180 7:117922556-117922578 TGGTCTGTGGGTTTCTGTTTTGG - Intergenic
1031177250 7:118368886-118368908 GTGTCTGGTTCTTTGGGTTTTGG - Intergenic
1031408819 7:121418863-121418885 GGGTCTGGTGCTCTCTGTTTTGG + Intergenic
1033109836 7:138564126-138564148 GGGTATGGTGTTTCCAGTTTAGG + Intronic
1033876738 7:145829324-145829346 GGGCCTATTGCTTTCTATTTTGG - Intergenic
1033985239 7:147217770-147217792 GGACCTGATGCTTTCTGTTTTGG + Intronic
1035050374 7:155995346-155995368 GGCTCTGGTACTTTCTGTCTGGG + Intergenic
1035296977 7:157872829-157872851 GTGACGGGTGCTTTCTGTGTGGG + Intronic
1035612263 8:975258-975280 GGGCTTGGTGCTTACTGTTTTGG - Intergenic
1035681946 8:1494781-1494803 TGGTGTGGTGGTGTCTGTTTGGG - Intergenic
1035711854 8:1723395-1723417 GGGATGGGTGCTTTCTGTTTGGG - Intergenic
1035745952 8:1962267-1962289 GGGTCGGGGGCTTTCTCTCTGGG - Intergenic
1036649741 8:10634744-10634766 GGGGCTGGTGGGTTCTGTGTGGG - Intronic
1037140235 8:15510602-15510624 GGGCCTGGAGTTTTCTGTGTGGG - Intronic
1037254522 8:16938422-16938444 CGGCCTGGTCCTTTTTGTTTTGG - Intergenic
1038323643 8:26553167-26553189 GGGCCTGGTGCTTTCGGTTTTGG - Intronic
1038558770 8:28550130-28550152 GGGTCTAGTGCTTTCTGAGGAGG + Intronic
1038565138 8:28613608-28613630 GGGCCTGGTGCTTTCTGTTTTGG + Intronic
1038576753 8:28710999-28711021 GGGGCTGGAGATTTCTTTTTTGG + Intronic
1039193562 8:35004375-35004397 GTGTCTTGTCCTTTCTGTTCTGG - Intergenic
1039347222 8:36719567-36719589 GGGCCTGGTGCTTTCTTTTTTGG + Intergenic
1039651888 8:39350560-39350582 GGGCCTGATGCTTTCTCTTCTGG - Intergenic
1039671097 8:39599480-39599502 GGGCCTGGTGCTTCCTGTTGTGG + Intronic
1039782638 8:40801233-40801255 ACGTCTGGTGCTTTCTGTTTTGG - Intronic
1040088798 8:43373590-43373612 CTGTCTAGTGCTTTCTGGTTTGG + Intergenic
1040420268 8:47232928-47232950 GGGCTTGGTTCTTTCTGTGTTGG - Intergenic
1040624239 8:49127680-49127702 GGACCTGATGCTTTCTGTTTTGG + Intergenic
1040699917 8:50050467-50050489 TAGCCTGGTGCTTTTTGTTTTGG - Intronic
1041308393 8:56487929-56487951 GGGTCTGGAGCTTTCTTTTGCGG - Intergenic
1041339528 8:56828531-56828553 GGACCTGGTGCTGTCTGTTTTGG - Intergenic
1041570000 8:59326941-59326963 AGCTATGGTGCCTTCTGTTTTGG - Intergenic
1041892409 8:62884617-62884639 GAGCTTGGTGCTTTTTGTTTGGG + Intronic
1042053812 8:64740868-64740890 GGTCCTGGTGCTTTCTTTTTGGG - Intronic
1043412859 8:80017616-80017638 GGACCTGGGGCTTTCTGTTTTGG - Intronic
1044789257 8:95829983-95830005 GGGCCTGGTACTTTCTATTTTGG - Intergenic
1045409234 8:101899993-101900015 GGACCTGGAACTTTCTGTTTTGG + Intronic
1045459902 8:102416380-102416402 GGGTATGGTGTGATCTGTTTGGG - Intergenic
1045509847 8:102806149-102806171 GGGACTGGTGCTGCCTGCTTGGG - Intergenic
1045728048 8:105199195-105199217 GGACCTGGTGATTTCTATTTTGG + Intronic
1046190471 8:110788725-110788747 GGGTCTGTTGCTTGATGTGTGGG + Intergenic
1046484144 8:114863359-114863381 GGGCTTGGTGCTTTCTGTTTTGG - Intergenic
1047368609 8:124236133-124236155 GGGGTTGATGCTTTCTGCTTGGG + Intergenic
1047461370 8:125068679-125068701 AGGTCTGCTGCTTCTTGTTTGGG - Intronic
1048388882 8:133941141-133941163 GGGCCTGATGCTTTCTGTTTTGG - Intergenic
1049457828 8:142702835-142702857 GGGTCTAGGGGTTGCTGTTTGGG - Intronic
1049635873 8:143689073-143689095 GGGTGTGGTATTTTCTGTGTGGG + Exonic
1049857456 8:144871722-144871744 GGGTCTGGTGCGTTCTCCCTTGG + Intergenic
1049920629 9:360418-360440 TGGTCTGGTGCTTCCAGCTTAGG - Intronic
1050111730 9:2223845-2223867 GGGCCTGGTGCTTTCTGTTTTGG + Intergenic
1050440460 9:5656334-5656356 AGTCCTGGTTCTTTCTGTTTTGG + Intronic
1050464050 9:5902133-5902155 GGGTCTGGTGCTTTCTGTTTTGG + Intronic
1050585559 9:7108087-7108109 GGGTAGGGTGGCTTCTGTTTTGG + Intergenic
1050695339 9:8273350-8273372 GGGCCTGGTGCTTTCTGTTTTGG + Intergenic
1051160112 9:14198192-14198214 GGGCCTAGTGATTTCTGTTATGG - Intronic
1051277585 9:15411906-15411928 TGGTCTGTAGCTTTCTATTTTGG + Intergenic
1051797967 9:20896484-20896506 GGGAGTGGTGCTTTCTGTGTTGG + Intronic
1052570692 9:30218317-30218339 GAGTCTGGTGATTTATGTTGGGG + Intergenic
1052783660 9:32807868-32807890 GGGCCTTGTGCTTTTTGTTTTGG - Intergenic
1052967695 9:34353368-34353390 GGGTATGGGGATTTCTTTTTGGG - Intergenic
1053442508 9:38127831-38127853 GGGTCTGGTGCTGCCTGGCTGGG + Intergenic
1053554915 9:39126316-39126338 GGGCTTGGTACCTTCTGTTTGGG - Intronic
1053819031 9:41946572-41946594 GGGCTTGGTACTTTCTGTTTGGG - Intronic
1054109297 9:61090224-61090246 GGGCTTGGTACTTTCTGTTTGGG - Intergenic
1054611560 9:67240901-67240923 GGGCTTGGTACTTTCTGTTTGGG + Intergenic
1055004916 9:71495651-71495673 GGATCTGGTGTTTTCTGTTTTGG - Intergenic
1055519561 9:77066962-77066984 GGGACTGTTGATTTCTGTCTTGG + Intergenic
1056192799 9:84200660-84200682 TGTCCTGGTGTTTTCTGTTTTGG - Intergenic
1056212543 9:84378512-84378534 GGGCCTGGTACTTTCTGTTTTGG + Intergenic
1056427916 9:86496767-86496789 GAGCCTGGTGCTTTCTATTTTGG + Intergenic
1057264810 9:93608568-93608590 GAGCCTGGTGCTTTATATTTTGG + Intronic
1057287505 9:93771326-93771348 GCACCTGATGCTTTCTGTTTTGG - Intergenic
1057375918 9:94522913-94522935 GGGCCTGGAGATTTCTCTTTTGG + Intergenic
1057485651 9:95481232-95481254 GGGTTTTGTGTTTTCTGGTTGGG - Intronic
1058490869 9:105497488-105497510 GTGCCTGGTGCTTTCTGTTTTGG + Intronic
1058641646 9:107092441-107092463 GGGCCTGGAGATTTCTTTTTTGG - Intergenic
1059222751 9:112640592-112640614 CAGGCTGCTGCTTTCTGTTTGGG + Intronic
1059500432 9:114748121-114748143 GAGACTGCTGCTTTCTGTCTGGG + Intergenic
1059711348 9:116870615-116870637 GGGTCTGGCTATCTCTGTTTTGG - Intronic
1060083142 9:120671628-120671650 GGGCCTGGAGATTTCTCTTTTGG - Intronic
1060320735 9:122557835-122557857 AGGCCTGGTACTTTCTGTTTGGG + Intergenic
1060322388 9:122575313-122575335 GGGCCTAGTGCTTTCTGCTTTGG + Intergenic
1060513081 9:124248475-124248497 GGGGGTTGTGCTTGCTGTTTTGG - Intergenic
1060572014 9:124650755-124650777 GGGCCTACTGCTTTCTGTTTTGG - Intronic
1061172176 9:128965113-128965135 GGGTCTGGAGTTTTCTTTGTGGG + Intronic
1062522439 9:136963893-136963915 GGGTCTGGGGGTTGCTGTTCCGG + Intergenic
1185625641 X:1480001-1480023 GGGCCTGGAGCCTTTTGTTTGGG - Intronic
1186710408 X:12189288-12189310 GGGCCTGGTGCTTTATGTTTGGG - Intronic
1186728316 X:12381230-12381252 TGGCCTGTTGCTTTCTGTATTGG - Intronic
1187914503 X:24140670-24140692 GGATCTGCTCCTTTCAGTTTGGG + Intergenic
1189604112 X:42657938-42657960 TGGTCTGTTGTTTTCTTTTTTGG - Intergenic
1190324243 X:49196996-49197018 GGGTCTGGTTTTTTTTTTTTTGG + Intronic
1190399551 X:50019063-50019085 GGGTCTAGGGCTTTCTGTCTTGG + Intronic
1190447535 X:50543625-50543647 GGGCCTACTACTTTCTGTTTTGG - Intergenic
1191896943 X:66002690-66002712 GTGTCTGCTGCTTTGTGTGTGGG + Intergenic
1192187928 X:68966473-68966495 CAGCCTGGAGCTTTCTGTTTTGG + Intergenic
1192310467 X:70008902-70008924 GGGCCTGGTGCTTTCCCTTTTGG + Intronic
1192836825 X:74808692-74808714 GGGCCTGGTGCTTTCTGTTTTGG + Intronic
1192862469 X:75090981-75091003 TGGACCAGTGCTTTCTGTTTTGG - Intronic
1192903868 X:75528699-75528721 GGGCCTGGTGATTTCTGTTTTGG + Intergenic
1193034222 X:76932175-76932197 GGGTCTGATACTTTCTGTTTGGG + Intergenic
1194102685 X:89726311-89726333 GGGACTGGTGCTTTTTGTTTTGG + Intergenic
1194167972 X:90544897-90544919 TGGCCTGCTGCTTTCTGTTTTGG - Intergenic
1194528275 X:95008214-95008236 GGGCCTGGGGTTTTCAGTTTTGG + Intergenic
1194542971 X:95197689-95197711 GGATCTGATGCTTTCTGTTATGG + Intergenic
1195216089 X:102704421-102704443 GGGCCTGATGCTTTCTCATTTGG - Intergenic
1195556670 X:106234777-106234799 GGGTCTGTAGTTTTCTTTTTTGG - Intergenic
1195658743 X:107358144-107358166 GGTTCTAGTGCTTTCTGTTTTGG - Intergenic
1195897957 X:109767570-109767592 GTGCTTGGTGCTTTCTGTTGTGG - Intergenic
1196263255 X:113610667-113610689 GGGGATGGTGCTTTCTTTTTTGG + Intergenic
1196852730 X:119953868-119953890 TGGCCAGGTGCTTTCTGTTCTGG + Intergenic
1197138486 X:123090277-123090299 GGCCCTGGTCCTTTTTGTTTAGG - Intergenic
1197539358 X:127737175-127737197 GGGCCAGGTGCTTTCTGTTTTGG - Intergenic
1197556035 X:127955067-127955089 GGGCTTGGCGATTTCTGTTTTGG + Intergenic
1197907457 X:131441622-131441644 GGGTCAGGGGCTTTCTTTTTTGG - Intergenic
1197908989 X:131459875-131459897 GGGCCTAGTGCTTTCTGTTTTGG - Intergenic
1198446343 X:136720006-136720028 GGGCTTAATGCTTTCTGTTTTGG - Intronic
1198538800 X:137614384-137614406 GGGTCTGGAGATTTGTTTTTTGG - Intergenic
1198819253 X:140628849-140628871 GAGCCTAGTGATTTCTGTTTGGG - Intergenic
1199193528 X:144999848-144999870 GGGCCTTGTGCTTTCTGGTATGG + Intergenic
1199254473 X:145702761-145702783 GGGTCTGGAGCTTTCTTTTTTGG - Intergenic
1200175304 X:154110640-154110662 GGGCCTGGTGCTTTCTTTTTTGG + Intergenic
1200455361 Y:3384303-3384325 GGGACTGGTGCTTTTTGTTTTGG + Intergenic
1200514224 Y:4122693-4122715 TGGCCTGCTGCTTTCTGTTTTGG - Intergenic
1201980820 Y:19908664-19908686 GGGCCTGTAGCTTTTTGTTTTGG - Intergenic
1202082100 Y:21093706-21093728 AGGTCTGGTCCCTTCTGTATAGG - Intergenic