ID: 952442795

View in Genome Browser
Species Human (GRCh38)
Location 3:33349927-33349949
Sequence GACCCGGATGGTGGTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952442790_952442795 -5 Left 952442790 3:33349909-33349931 CCAAAACAGAAAGCACCAGACCC 0: 5
1: 27
2: 110
3: 140
4: 446
Right 952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG 0: 1
1: 0
2: 0
3: 6
4: 64
952442789_952442795 -1 Left 952442789 3:33349905-33349927 CCTTCCAAAACAGAAAGCACCAG 0: 24
1: 76
2: 117
3: 174
4: 434
Right 952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952442795 Original CRISPR GACCCGGATGGTGGTTTTAC TGG Intronic
902577106 1:17385312-17385334 GACCAGAATGGAGGTTTTCCAGG + Intronic
903759190 1:25685871-25685893 GACTCGTATGGTGATTTTAGGGG + Intronic
906489515 1:46257337-46257359 GACCCTGAAGGTAGTTTTAATGG - Intronic
910229500 1:84971709-84971731 CACCTGGCTGGGGGTTTTACAGG + Intronic
915505433 1:156352971-156352993 TACTGGGATGGTGGTTTTGCTGG - Intronic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG + Intronic
922316256 1:224445045-224445067 GACCTGGGTGATGGTTTCACGGG - Intronic
922494967 1:226049479-226049501 TACCAGGATGGTGGTATTATGGG - Intergenic
923539359 1:234877080-234877102 GCCCCGTATGGTGGGATTACAGG + Intergenic
1069472043 10:68702216-68702238 GACCTGGATGGAGGTTACACAGG - Intergenic
1069533511 10:69236229-69236251 CTCCCGAATGGTGGTATTACAGG + Intronic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1079173135 11:18115146-18115168 TACCTTGATGGTGGTTCTACTGG - Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1082670573 11:56032051-56032073 GATACTGATGGTGGTTTCACTGG + Intergenic
1098366208 12:69705927-69705949 AACCCGCATCGTGGTTTTCCGGG + Intergenic
1101366746 12:104078916-104078938 CACCCAGATGGTAGTTTTATGGG + Intronic
1101981655 12:109412627-109412649 GATCCGCATGGTGGTTACACAGG - Intronic
1117305075 14:54465997-54466019 GAACCGGCTGGTGGTTTGGCCGG - Intergenic
1118923131 14:70168039-70168061 GACCCGAATAGTGGTTGTGCTGG + Exonic
1122076017 14:99235104-99235126 AACCCGGATGGGGCTTTTCCAGG - Intronic
1122601606 14:102924352-102924374 GACCCGGATGGTGGGTAGAGGGG - Intronic
1132653603 16:1032366-1032388 GACCTGGGGGGTGGTTCTACAGG - Intergenic
1135073738 16:19375353-19375375 GATCCAGATGCTGGTTTTACAGG - Intergenic
1136512518 16:30748126-30748148 GACCCGGAAGTTGGGTTTACTGG - Intergenic
1147588772 17:41667828-41667850 GACGCGGATGGTGGTGCCACTGG + Intergenic
1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG + Exonic
1160859766 19:1232843-1232865 GCCCCGGATGGTGGTGTTCGTGG - Intronic
1168616972 19:57846050-57846072 GACTCTGATGATGGTTTCACGGG - Exonic
924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG + Intergenic
927981951 2:27380080-27380102 GACTCGGAAGGTGGGTTTTCGGG - Exonic
928319209 2:30269789-30269811 GACCTGGGTAGTGGTTTTATGGG - Intronic
931554608 2:63488583-63488605 GTCCTGGATGGTGATTTTATGGG + Intronic
944969259 2:204973080-204973102 GAGGACGATGGTGGTTTTACTGG - Intronic
946220452 2:218221459-218221481 GACCTGGTTGGTCTTTTTACAGG + Intronic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1174846270 20:53946187-53946209 GATTTGGATGGTGGTTTTAGGGG - Intronic
1175059863 20:56232120-56232142 TACCTGGATGGTGGTTTTGGAGG + Intergenic
1175190055 20:57205609-57205631 AACCCAGATGGTGATTTTGCTGG + Intronic
1177761721 21:25409160-25409182 GAGTAGAATGGTGGTTTTACAGG + Intergenic
1181757397 22:25033976-25033998 GACTGTGATGGTGGTTTCACAGG - Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953481038 3:43252470-43252492 GACCTGGGTGGTGATTATACAGG - Intergenic
962056592 3:131878533-131878555 AATCTGGATGCTGGTTTTACAGG + Intronic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
965208036 3:165747190-165747212 GATTGGGATGGTGGTTTTGCAGG + Intergenic
972578478 4:40373789-40373811 GACCCGGATGGTGGTTACGTAGG + Intergenic
987082457 5:14437814-14437836 TACCAGGATGGTGGGATTACGGG - Intronic
988936541 5:36089012-36089034 GACTTCGGTGGTGGTTTTACAGG - Intergenic
996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG + Intergenic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
999436380 5:151566689-151566711 GACCCTGATGCTGGTTTTAATGG - Exonic
999717279 5:154371430-154371452 GACTCTGATGATGGTTCTACCGG - Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1005396090 6:25383240-25383262 GGCTCGGATGGTGGTTTTTGAGG + Intronic
1006688889 6:35862287-35862309 GACCCTGATGGTGGCATTAGTGG - Intronic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1008532347 6:52474926-52474948 AACCTGGATGGTGGTTATATGGG + Intronic
1036599097 8:10242491-10242513 GACCCAGGTGGTGGTTGTAAGGG + Intronic
1037503279 8:19505777-19505799 TTCCCGGGTGGTGGTTTTGCTGG - Exonic
1047233510 8:123018262-123018284 CACCCAGATGGTGATTTAACTGG + Intronic
1047292176 8:123540757-123540779 GACCCGGAGGGTGGGACTACGGG - Intronic
1052058256 9:23926895-23926917 GACCTGGAAGGTGGCTTTGCTGG + Intergenic
1185599182 X:1327310-1327332 AACCCGGGAGGTGGTTTTGCAGG + Intergenic
1196841672 X:119865007-119865029 GACCCGGGTGGTGGTTATGCAGG + Intergenic
1198049066 X:132931023-132931045 CACCGGTATGGTTGTTTTACTGG - Intronic